Homologs in group_3279

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_12820 EHELCC_12820 100.0 Morganella morganii S2 yrbN Protein YrbN
NLDBIP_13160 NLDBIP_13160 100.0 Morganella morganii S4 yrbN Protein YrbN
LHKJJB_13395 LHKJJB_13395 100.0 Morganella morganii S3 yrbN Protein YrbN
HKOGLL_11635 HKOGLL_11635 100.0 Morganella morganii S5 yrbN Protein YrbN

Distribution of the homologs in the orthogroup group_3279

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3279

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_08705
Feature type CDS
Gene yrbN
Product Protein YrbN
Location 122474 - 122554 (strand: 1)
Length 81 (nucleotides) / 26 (amino acids)

Contig

Accession contig_9
Length 163724 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3279
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Protein Sequence

MKTTDMLSDGLCRLAAILYEAPLHDH

Flanking regions ( +/- flanking 50bp)

GGATGTTTTGTTCGTTTTATAATTTTATTTGAGCCAGTTCACACTTTTAAATGAAAACAACCGACATGCTTTCCGATGGGTTGTGTAGACTGGCCGCCATTTTGTATGAGGCACCTTTACATGACCACTGAGACTGAAATCTCTTTTGCTGACATTGGTTTATCAGCTGATATTTTGACTG