Homologs in group_1210

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_09635 EHELCC_09635 100.0 Morganella morganii S2 ettA energy-dependent translational throttle protein EttA
NLDBIP_10015 NLDBIP_10015 100.0 Morganella morganii S4 ettA energy-dependent translational throttle protein EttA
LHKJJB_07740 LHKJJB_07740 100.0 Morganella morganii S3 ettA energy-dependent translational throttle protein EttA
HKOGLL_07290 HKOGLL_07290 100.0 Morganella morganii S5 ettA energy-dependent translational throttle protein EttA
F4V73_RS15355 F4V73_RS15355 96.5 Morganella psychrotolerans ettA energy-dependent translational throttle protein EttA
PMI_RS18470 PMI_RS18470 90.9 Proteus mirabilis HI4320 ettA energy-dependent translational throttle protein EttA

Distribution of the homologs in the orthogroup group_1210

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1210

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9W5 0.0 1021 89 0 548 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 0.0 1021 89 0 548 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
A0A0H2VFI8 0.0 1021 89 0 548 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9W4 0.0 1021 89 0 548 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P45127 0.0 998 86 0 548 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WQK3 0.0 577 56 4 541 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK3 1.8e-22 104 29 6 271 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK3 3.94e-20 97 29 6 248 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK2 0.0 577 56 4 541 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQK2 1.8e-22 104 29 6 271 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQK2 3.94e-20 97 29 6 248 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P12622 4.57e-106 322 57 1 290 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 1.27e-14 77 46 1 103 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
O06476 1.12e-95 307 37 7 518 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
O06476 3.67e-28 122 31 6 268 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
O05519 1.23e-94 305 34 11 540 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 1.17e-25 114 29 3 251 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 6.65e-22 103 31 5 243 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
Q57242 5.41e-83 274 35 4 510 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P43672 5.83e-81 268 33 7 516 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 1.26e-16 86 31 6 217 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 1.78e-16 86 30 6 233 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
O31716 2.43e-76 254 32 9 515 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 4.53e-20 97 27 7 243 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
Q8K9I3 4.08e-71 241 31 5 490 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9I3 9.37e-21 99 30 6 222 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9LV93 2.04e-69 239 31 8 522 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 5.34e-25 113 31 5 240 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 8.12e-21 100 29 4 248 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
P0A9U3 2.02e-68 233 31 8 517 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U3 7.55e-23 105 32 5 231 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U3 9.33e-20 96 30 7 242 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 2.02e-68 233 31 8 517 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U4 7.55e-23 105 32 5 231 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U4 9.33e-20 96 30 7 242 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 2.02e-68 233 31 8 517 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P0A9U5 7.55e-23 105 32 5 231 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P0A9U5 9.33e-20 96 30 7 242 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P57445 4.49e-68 233 31 7 519 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57445 4e-17 88 29 4 212 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
O34512 2.75e-67 229 28 7 500 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 2.12e-19 95 29 6 265 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
Q9FIB4 6.65e-67 232 31 6 514 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 9.72e-23 105 30 5 248 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 9.81e-23 105 28 4 235 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
A0A0H2VBH0 1.54e-66 230 31 13 530 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63389 1.87e-66 230 31 13 530 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63390 1.87e-66 230 31 13 530 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P25256 2.78e-57 203 32 12 521 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 4.24e-24 109 30 2 241 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 3.11e-12 72 32 5 202 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
Q45978 3.5e-56 201 32 13 550 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q45978 8e-16 84 29 4 227 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8T6B4 4.33e-56 207 28 9 536 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 2.23e-12 73 28 8 252 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
P44808 2.57e-51 189 31 16 529 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44808 3.89e-16 85 30 5 240 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9FJH6 5.42e-51 187 30 13 539 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q9FJH6 1.48e-18 92 29 5 257 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
P45167 7.45e-51 184 36 1 334 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 3.05e-11 69 29 10 291 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 0.000133 48 38 1 68 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8T6B7 1.06e-50 186 27 11 538 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B7 7.11e-16 84 25 4 260 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
P43535 4.27e-50 187 27 13 540 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9UG63 5.29e-50 185 30 16 540 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q9UG63 3.18e-11 69 25 5 237 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q99LE6 5.68e-50 185 30 15 537 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q99LE6 3.17e-11 69 25 5 237 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q9USH9 7.49e-50 187 30 15 543 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P40024 3.13e-49 182 28 11 533 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8H0V6 5.77e-49 183 29 14 532 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
O59672 1.82e-48 182 27 12 540 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P39115 7.31e-48 177 29 13 513 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 5.14e-23 106 32 5 220 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 1.19e-20 99 30 3 214 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
Q2KJA2 1.66e-47 178 29 13 553 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q2KJA2 1.09e-11 71 26 5 237 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q9M1H3 5.33e-46 175 27 16 577 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9M1H3 5.08e-19 94 28 5 252 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q5R9Z5 6.48e-46 175 28 12 520 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q5R9Z5 6.04e-18 91 29 6 244 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q8K268 1.01e-45 174 27 13 523 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q8K268 2.81e-18 92 30 6 244 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q9NUQ8 1.22e-45 174 28 12 520 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q9NUQ8 8.69e-19 93 30 6 244 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
O42943 7.78e-45 171 27 14 543 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O42943 2.32e-20 98 29 4 231 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q66H39 1.01e-44 171 28 16 529 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q66H39 1.89e-18 92 30 6 244 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
P0DX93 1.42e-43 164 29 14 541 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 3.55e-18 90 32 6 209 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
Q8SRV5 1.95e-43 166 30 8 373 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 4.5e-15 81 30 4 204 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 8.76e-12 71 28 8 230 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q6MG08 1.52e-37 151 27 11 544 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q8NE71 1.88e-37 151 28 12 539 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 2.09e-13 77 25 4 239 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q767L0 2.76e-37 150 27 11 544 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 5.61e-14 78 25 4 239 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q7YR37 5.76e-37 149 28 12 539 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 9.83e-13 74 25 4 239 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q6P542 5.1e-36 147 26 10 542 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 7.46e-13 75 25 5 239 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
P23212 4.56e-32 132 29 14 392 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 2.51e-17 88 31 6 197 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
O94489 5.54e-26 116 27 11 370 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 9.24e-12 71 29 6 204 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.02e-07 58 31 0 89 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 9.92e-05 49 38 0 65 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O93796 1.11e-25 115 27 10 380 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 7.03e-18 91 33 8 236 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 3.23e-08 60 32 0 89 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 0.000137 48 35 0 76 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O14134 9.84e-25 112 26 15 426 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 4.48e-18 92 28 3 212 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 5.36e-09 62 31 5 141 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 0.000714 46 33 0 59 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6LQ00 1.83e-24 110 25 18 516 3 PBPRA2240 Putative ABC transporter ATP-binding protein PBPRA2240 Photobacterium profundum (strain SS9)
D0MYB4 2.53e-24 111 30 5 245 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 7.48e-22 103 32 5 221 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 1.13e-05 52 37 0 64 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 3.48e-05 50 41 0 63 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
Q08972 3.12e-24 111 27 11 389 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 4.8e-19 95 30 6 220 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.22e-07 58 39 1 74 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 0.000781 46 38 0 63 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P29551 4.91e-24 110 28 16 380 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 2.2e-15 83 29 4 200 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 1.02e-07 58 34 0 87 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 0.000138 48 35 0 76 3 TEF3 Elongation factor 3 Pneumocystis carinii
P25997 6.21e-24 110 26 12 367 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 1.17e-16 87 33 4 200 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 4.85e-07 56 31 0 87 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 0.000211 48 41 0 63 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P53978 7.67e-24 110 26 11 382 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 4.59e-19 95 31 7 236 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 3.34e-08 60 32 0 87 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 9.67e-05 49 35 0 76 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 1.71e-23 108 25 11 372 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 2.07e-16 86 33 9 238 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 4.92e-08 59 32 0 89 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 7.6e-05 49 36 0 76 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8ES39 1.59e-22 104 23 20 551 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ES39 1.46e-12 73 26 8 272 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P0A9U2 2.19e-22 104 24 17 554 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U2 7.93e-12 71 29 4 199 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U1 2.19e-22 104 24 17 554 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
P0A9U1 7.93e-12 71 29 4 199 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
Q8DQY5 3e-22 103 26 21 529 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q75EV6 3.6e-22 104 25 10 372 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 9.45e-17 87 31 7 236 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 2.22e-07 57 31 0 89 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 0.000133 48 41 0 63 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
O34362 4.5e-22 103 23 17 533 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 1.83e-09 63 30 8 179 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q7MFH3 7e-22 102 25 16 536 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q81CT8 1.42e-21 102 26 21 514 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q88ZZ2 1.78e-21 101 24 20 522 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q926D8 2.92e-21 96 29 7 233 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q926D8 3.89e-13 73 27 10 259 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8DY60 3.01e-21 100 26 20 516 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8DY60 7.33e-07 55 23 8 240 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8DY60 1.88e-05 51 27 3 173 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q832R5 4.13e-21 100 25 18 531 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q73R11 4.38e-21 100 22 16 515 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73R11 2.37e-09 63 29 8 224 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73R11 1.94e-08 60 24 9 221 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q97SA3 4.84e-21 100 25 20 521 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97SA3 1.25e-07 58 25 7 236 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8D3Z9 5.76e-21 100 25 18 541 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8D3Z9 2.47e-05 50 28 5 175 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8E3S6 1.11e-20 99 25 20 516 3 gbs1680 Putative ABC transporter ATP-binding protein gbs1680 Streptococcus agalactiae serotype III (strain NEM316)
Q8E3S6 1.78e-05 51 27 3 173 3 gbs1680 Putative ABC transporter ATP-binding protein gbs1680 Streptococcus agalactiae serotype III (strain NEM316)
Q7AH43 4.67e-20 95 29 6 193 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q7AH43 5.96e-08 58 23 7 225 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q8XXY9 7.47e-20 94 38 6 176 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XXY9 1.27e-09 63 28 9 232 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
O70014 2.15e-19 91 32 6 218 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
O70014 6.03e-10 63 28 7 233 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
Q1R597 2.15e-19 91 32 6 218 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q1R597 6.14e-10 63 28 7 233 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q32AY3 2.3e-19 91 32 6 218 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q32AY3 6.03e-10 63 28 7 233 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
P31134 2.65e-19 93 34 7 198 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
P31134 8.66e-12 70 29 9 230 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
P37009 2.85e-19 92 29 6 193 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
P37009 9.48e-08 57 23 7 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q8GNH6 2.99e-19 92 40 6 167 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q8GNH6 1.45e-11 69 28 10 245 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q1M7W6 3.24e-19 92 37 5 176 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M7W6 3.15e-09 62 26 11 319 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8FCJ1 3.31e-19 90 32 6 218 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCJ1 7.75e-10 63 28 7 233 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBU8 3.31e-19 90 32 6 218 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBU8 7.75e-10 63 28 7 233 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q87G35 3.75e-19 94 25 17 542 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87G35 0.000162 48 28 7 175 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q97WT4 3.77e-19 94 23 22 541 3 SSO2030 Putative ABC transporter ATP-binding protein SSO2030 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q97WT4 3.7e-06 53 25 7 237 3 SSO2030 Putative ABC transporter ATP-binding protein SSO2030 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q6YRJ4 3.94e-19 94 22 18 520 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q6YRJ4 6.08e-14 78 26 8 257 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q8XK20 4.82e-19 94 24 20 522 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 1.35e-06 54 25 6 212 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q84EY8 5.68e-19 90 37 9 196 3 hmuV Hemin import ATP-binding protein HmuV Enterobacter cloacae
A0KPH6 7.43e-19 89 36 8 195 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A0KPH6 2.67e-11 67 25 4 220 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q8X5N2 1.17e-18 89 32 6 218 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q8X5N2 3.49e-10 64 28 7 233 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q73XU8 1.18e-18 91 31 10 276 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q73XU8 3.27e-11 68 31 7 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P08720 1.44e-18 90 37 5 176 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
P08720 4.08e-08 58 25 11 319 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
O52618 1.68e-18 90 40 5 167 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
O52618 1.3e-11 69 31 9 211 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q737I0 1.77e-18 92 26 19 496 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q737I0 0.000493 46 25 6 199 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9KLQ5 1.79e-18 90 29 6 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KLQ5 3.16e-06 53 23 7 245 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7N8B9 1.81e-18 90 31 6 195 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N8B9 7.99e-07 55 24 8 229 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1R0Z6 1.96e-18 89 34 7 197 3 phnC Phosphonates import ATP-binding protein PhnC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1R0Z6 5.73e-06 51 27 7 214 3 phnC Phosphonates import ATP-binding protein PhnC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
P37624 3.09e-18 92 24 16 471 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P37624 3.55e-05 50 23 4 173 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
A1JRI2 3.38e-18 87 29 3 220 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 3.11e-11 67 31 8 189 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q6MU19 4.06e-18 89 28 5 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6MU19 8.46e-10 64 27 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6FFL0 4.64e-18 87 31 6 194 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FFL0 5.06e-16 81 29 4 205 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
O34946 5.16e-18 86 29 7 237 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34946 1.33e-11 68 26 5 183 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q2SSS4 5.21e-18 89 28 5 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q2SSS4 5.96e-10 64 28 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
P37774 5.76e-18 87 28 6 221 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
P37774 2.85e-09 61 27 7 237 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q93KD4 8.7e-18 85 29 6 218 1 tupC Tungstate uptake system ATP-binding protein TupC Peptoclostridium acidaminophilum
Q93KD4 4e-13 72 29 6 210 1 tupC Tungstate uptake system ATP-binding protein TupC Peptoclostridium acidaminophilum
Q56953 8.78e-18 87 35 5 183 3 yfeB Chelated iron transport system membrane protein YfeB Yersinia pestis
P9WQM1 9e-18 88 32 10 264 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM1 3.41e-10 65 31 8 210 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 9e-18 88 32 10 264 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQM0 3.41e-10 65 31 8 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 9e-18 88 32 10 264 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A4W3 3.41e-10 65 31 8 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P72335 1.18e-17 87 37 5 167 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P72335 6.06e-10 64 28 11 244 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P23703 1.47e-17 87 39 6 167 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P23703 2.5e-09 62 29 10 231 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6LKD4 1.5e-17 87 30 8 200 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q6LKD4 9.63e-07 54 23 6 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
O31427 1.51e-17 85 29 8 235 1 skfE SkfA peptide export ATP-binding protein SkfE Bacillus subtilis (strain 168)
Q9MUN1 1.65e-17 87 28 5 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9MUN1 5.97e-14 77 30 8 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q5L222 2.11e-17 87 29 8 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5L222 1.62e-09 63 25 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
P55476 2.86e-17 86 37 5 170 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55476 7.01e-07 55 27 10 244 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P15031 2.93e-17 85 37 5 172 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
P15031 3.62e-06 52 27 7 212 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
Q2J3T0 3.28e-17 85 34 7 177 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q897I2 3.37e-17 87 25 12 375 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 2.14e-12 72 28 7 231 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q24QI5 3.58e-17 86 31 6 212 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q02R79 4.86e-17 86 28 7 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02R79 1.59e-12 72 31 7 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HY19 4.86e-17 86 28 7 232 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HY19 1.77e-12 72 31 7 201 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0I2Z4 5e-17 86 27 7 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q0I2Z4 9.09e-09 60 24 7 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q8U4L3 5.23e-17 84 30 9 236 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U4L3 1.15e-09 62 29 11 241 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q93D97 6.42e-17 87 24 24 517 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q7M8M4 7.24e-17 84 32 9 220 3 phnC Phosphonates import ATP-binding protein PhnC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q7M8M4 8.43e-08 57 27 9 218 3 phnC Phosphonates import ATP-binding protein PhnC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A1TXH7 8.79e-17 85 27 5 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1TXH7 7.13e-09 61 30 8 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q8YUV1 1.04e-16 83 31 10 245 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9TKX3 1.05e-16 85 30 6 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9TKX3 1.22e-10 66 29 8 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q6DB87 1.19e-16 86 22 15 513 3 rbsA Ribose import ATP-binding protein RbsA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6DB87 1.48e-09 64 27 9 215 3 rbsA Ribose import ATP-binding protein RbsA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6DB87 1.75e-08 60 28 8 198 3 rbsA Ribose import ATP-binding protein RbsA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q14Q07 1.29e-16 85 29 6 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q14Q07 8.8e-10 64 27 6 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q6D734 1.36e-16 84 29 6 193 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D734 8.23e-08 58 24 7 241 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1B677 1.64e-16 84 32 7 218 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q1B677 3.4e-08 58 26 8 260 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q3JSQ0 1.68e-16 84 36 6 166 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q3JSQ0 4.77e-11 67 31 7 187 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 1.68e-16 84 36 6 166 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q62K72 4.77e-11 67 31 7 187 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q63TX3 1.79e-16 84 36 6 166 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q63TX3 4.51e-11 67 31 7 187 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
P26050 1.89e-16 83 35 5 172 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P26050 1.83e-10 65 32 11 211 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2SVP3 1.99e-16 83 35 6 166 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVP3 9.94e-12 69 32 7 187 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9V2E4 2.02e-16 82 29 8 241 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q9V2E4 4.94e-08 57 29 10 227 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q3ISC1 2.5e-16 82 34 4 172 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q3ISC1 2.51e-06 52 29 5 181 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
O57872 2.61e-16 82 28 9 237 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O57872 1.55e-08 59 29 11 227 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8DIA0 2.77e-16 83 30 8 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8DIA0 2.17e-13 75 30 7 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P44531 2.77e-16 83 28 7 212 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44531 3.07e-06 53 23 7 227 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1BWI2 3.14e-16 83 36 6 166 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q1BWI2 1.42e-10 66 31 9 210 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
P54592 3.69e-16 82 31 8 229 3 yhcH Uncharacterized ABC transporter ATP-binding protein YhcH Bacillus subtilis (strain 168)
P0C0E2 3.72e-16 81 28 5 214 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 3.72e-16 81 28 5 214 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
Q2IYS5 4.09e-16 82 32 6 216 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
Q2IYS5 1.98e-07 56 28 8 228 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
Q3SQ65 4.2e-16 82 30 6 215 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q8K9M6 4.93e-16 81 31 5 197 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9M6 3.43e-09 60 26 6 221 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q13ZJ1 7.6e-16 82 36 6 172 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q13ZJ1 6.76e-09 60 28 7 190 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q9KS33 8.71e-16 82 28 9 256 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q97X60 9.32e-16 83 23 21 526 3 SSO1893 Putative ABC transporter ATP-binding protein SSO1893 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q97X60 0.000112 48 26 8 215 3 SSO1893 Putative ABC transporter ATP-binding protein SSO1893 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q5UW69 9.55e-16 80 34 6 199 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5UW69 0.00026 46 34 1 78 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q6D201 1.07e-15 82 31 9 198 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D201 9.59e-12 70 32 12 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9CM80 1.09e-15 82 29 6 192 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q9CM80 2.28e-06 53 24 7 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q07LU3 1.14e-15 80 33 8 216 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisA53)
Q7NX01 1.16e-15 82 30 8 218 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NX01 4.11e-10 65 29 7 228 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q57293 1.22e-15 82 29 6 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q57293 1.77e-05 50 23 7 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q8TQ05 1.38e-15 83 24 19 551 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQ05 0.000364 47 28 10 215 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q93DX8 1.56e-15 80 33 7 180 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q93DX8 1.27e-13 74 31 7 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q8D653 1.69e-15 81 27 8 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q8D653 1.2e-12 72 30 7 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
A0AGP9 1.74e-15 81 29 9 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A0AGP9 4.46e-09 62 25 7 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
P56344 1.81e-15 79 28 7 230 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
P56344 1.37e-13 73 30 7 230 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q8RI39 1.94e-15 81 31 9 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8RI39 2.81e-10 65 29 8 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q31I51 2.07e-15 79 27 7 226 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31I51 1.22e-10 65 26 6 204 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q9CP06 2.12e-15 81 29 4 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q9CP06 1.69e-05 50 23 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q92DL6 2.18e-15 81 31 7 173 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92DL6 5.68e-09 61 25 7 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8Y8T6 2.28e-15 81 29 9 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y8T6 2.09e-08 60 25 7 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P50332 2.4e-15 81 37 6 167 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
P50332 1.91e-08 60 30 7 186 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
Q16BC5 2.48e-15 79 30 9 221 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q16BC5 1.17e-06 53 27 6 212 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q8Z0H0 2.49e-15 80 31 9 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8Z0H0 1.29e-10 66 29 9 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q21BU8 2.57e-15 81 29 10 224 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q21BU8 4.21e-09 62 26 7 230 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q722B1 2.82e-15 81 31 7 173 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q722B1 9.7e-09 60 25 7 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
O34338 3.01e-15 79 31 8 198 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
O34338 9.59e-09 59 26 5 234 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
Q72D73 3.04e-15 79 31 5 212 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72D73 1.49e-10 65 29 5 219 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q0I3Y9 3.9e-15 80 30 4 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q0I3Y9 3.86e-07 56 25 7 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q65S66 4.17e-15 80 27 7 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65S66 4.05e-06 52 24 8 236 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P42246 4.21e-15 79 29 7 201 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
P42246 2.35e-06 53 23 10 286 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
Q6N7Y6 4.55e-15 79 35 5 171 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8PUE7 4.62e-15 81 26 11 338 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PUE7 6.12e-07 55 25 10 246 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8KLG1 4.82e-15 79 33 5 171 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8KLG1 4.35e-11 67 30 10 213 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5E586 4.89e-15 80 29 6 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87H79 4.92e-15 81 23 15 521 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87H79 1.33e-07 57 27 8 199 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6NBT1 5.29e-15 80 28 8 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6NBT1 1.7e-10 66 31 9 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P14788 5.84e-15 79 29 7 215 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P14788 6.45e-12 70 28 7 221 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O68106 6.48e-15 78 31 11 244 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O68106 2.94e-08 58 30 8 241 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q8R9L8 6.8e-15 81 24 22 540 3 TTE1589 Putative ABC transporter ATP-binding protein TTE1589 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9PDN2 9e-15 79 29 7 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q9PDN2 2.46e-08 59 31 9 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q9Z3I3 9.03e-15 78 34 5 171 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q9Z3I3 4.82e-10 64 32 11 212 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q97JB8 9.92e-15 78 29 9 231 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97JB8 1.01e-11 69 26 6 227 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q73P71 1.03e-14 77 28 9 227 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q5YZY9 1.04e-14 79 29 6 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q5YZY9 1.62e-09 63 30 8 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q20ZP0 1.05e-14 77 32 9 223 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisB18)
Q20ZP0 4.32e-09 61 29 9 221 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisB18)
Q7W9U5 1.06e-14 79 28 6 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7W9U5 3.5e-08 59 29 8 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q92W56 1.07e-14 80 29 8 268 3 araG Arabinose import ATP-binding protein AraG Rhizobium meliloti (strain 1021)
Q92W56 1.6e-10 67 23 17 515 3 araG Arabinose import ATP-binding protein AraG Rhizobium meliloti (strain 1021)
Q8REG7 1.08e-14 77 29 4 179 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q7WGW1 1.12e-14 79 28 6 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7WGW1 1.13e-08 60 28 8 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q73EL7 1.2e-14 79 28 9 221 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73EL7 4.17e-11 68 26 10 249 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9I6L0 1.27e-14 78 28 8 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I6L0 2.17e-12 72 31 8 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KQB8 1.45e-14 77 32 6 186 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KQB8 2.21e-13 73 28 6 213 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6HP89 1.48e-14 78 28 9 221 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HP89 1.23e-10 66 25 10 251 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q0VTB6 1.52e-14 77 31 7 207 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VTB6 3.54e-11 67 29 8 222 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q65UE1 1.59e-14 79 30 4 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65UE1 2.11e-06 53 26 8 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q81ZF5 1.61e-14 78 28 9 221 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q81ZF5 2.14e-10 65 25 9 232 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
O83590 1.62e-14 76 27 7 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Treponema pallidum (strain Nichols)
O83590 1.42e-08 58 27 5 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Treponema pallidum (strain Nichols)
Q7VZE5 1.66e-14 78 29 5 195 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7VZE5 4.57e-08 58 29 8 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q5PBX2 1.72e-14 76 30 4 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Anaplasma marginale (strain St. Maries)
Q5PBX2 3.07e-06 52 24 5 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Anaplasma marginale (strain St. Maries)
Q8UH62 1.79e-14 78 27 5 217 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UH62 7.4e-11 67 27 6 229 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q63GR8 1.8e-14 78 28 9 221 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q63GR8 1.04e-10 67 25 10 249 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q2K8C8 1.8e-14 78 29 9 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K8C8 5.61e-10 64 31 11 239 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1B8V9 1.92e-14 79 31 4 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
Q1B8V9 2.41e-07 56 26 7 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 1.92e-14 79 31 4 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
A1UG51 2.41e-07 56 26 7 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
A3DDF6 1.92e-14 78 28 5 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A3DDF6 3.91e-07 55 25 6 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
P44662 1.94e-14 77 30 6 188 3 HI_0361 Probable iron transport system ATP-binding protein HI_0361 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P94440 1.94e-14 77 30 7 213 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P94440 5.07e-10 64 27 6 234 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q81IN8 1.95e-14 78 28 9 221 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81IN8 8.68e-10 63 25 10 251 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q21JQ9 2.15e-14 76 27 7 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q5FA19 2.19e-14 78 32 7 208 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5FA19 4.76e-09 62 30 5 187 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P57383 2.25e-14 76 29 8 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57383 3.67e-08 57 26 6 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q39GT7 2.28e-14 77 35 7 168 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GT7 5.68e-10 64 28 6 210 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q5X627 2.65e-14 78 27 3 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q5X627 1.24e-10 67 28 8 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q50966 2.67e-14 77 31 6 208 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q8UCM5 2.68e-14 76 30 8 212 3 hmuV Hemin import ATP-binding protein HmuV Agrobacterium fabrum (strain C58 / ATCC 33970)
Q62K82 2.7e-14 77 31 8 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q62K82 3.57e-12 71 30 7 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q8NR12 2.73e-14 79 23 18 521 3 rbsA Ribose import ATP-binding protein RbsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NR12 9.76e-12 71 33 9 206 3 rbsA Ribose import ATP-binding protein RbsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q63TY1 2.8e-14 77 31 8 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q63TY1 3.44e-12 71 30 7 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q6CYU2 2.8e-14 76 29 5 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6CYU2 5.2e-05 48 39 3 88 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5GRS1 2.82e-14 76 28 4 180 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q5ZWE4 2.83e-14 78 26 4 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZWE4 3.78e-10 65 28 8 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q72AQ6 2.89e-14 76 29 10 251 3 phnC Phosphonates import ATP-binding protein PhnC Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72AQ6 1.73e-05 50 27 9 236 3 phnC Phosphonates import ATP-binding protein PhnC Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q6F0V4 2.98e-14 77 27 7 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q6F0V4 2.12e-07 56 28 8 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q74DN5 3.19e-14 76 30 6 199 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q74DN5 1.27e-09 62 31 7 208 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q9G4F5 3.3e-14 77 29 8 217 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q9G4F5 1.47e-11 69 30 10 241 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q87DT9 3.3e-14 77 29 7 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87DT9 1.48e-08 60 31 10 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q7MKU3 3.4e-14 77 28 7 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q7MKU3 2.67e-06 53 24 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 3.4e-14 77 28 7 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q8D9J4 2.67e-06 53 24 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q8PNN4 4.03e-14 77 30 7 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q8PNN4 8.32e-08 58 29 9 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q55281 4.28e-14 75 29 9 211 3 mntA Manganese transport system ATP-binding protein MntA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5SSE9 4.31e-14 79 32 8 215 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
Q5SSE9 3.78e-07 57 24 5 185 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
Q5WXF0 4.58e-14 77 26 4 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q5WXF0 1.47e-09 63 28 8 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q88AS5 4.7e-14 77 29 8 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88AS5 2.04e-12 72 30 9 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q12I82 5.05e-14 75 28 5 193 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q12I82 1.58e-07 55 29 10 210 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q2FNX9 5.13e-14 75 29 7 206 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q2FNX9 9.57e-13 72 27 7 237 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q92VJ2 5.13e-14 77 28 5 196 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q92VJ2 3.49e-12 71 31 8 227 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q5FQN4 5.71e-14 74 33 6 200 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Gluconobacter oxydans (strain 621H)
Q85A69 5.91e-14 77 29 3 189 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q85A69 3.53e-11 68 28 5 220 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
O07016 6.19e-14 76 32 4 165 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
O07016 2.39e-07 56 25 9 274 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
Q1MBG4 6.21e-14 77 31 4 176 3 araG Arabinose import ATP-binding protein AraG Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MBG4 1.4e-07 57 21 14 519 3 araG Arabinose import ATP-binding protein AraG Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9KD30 6.57e-14 75 30 7 199 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P74548 6.89e-14 76 28 8 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P74548 2.89e-11 68 31 9 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O69063 6.92e-14 76 27 11 253 3 htxD Hypophosphite import ATP-binding protein HtxD Stutzerimonas stutzeri
Q6MCV4 7.19e-14 77 32 6 164 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q6MCV4 2.49e-07 56 27 8 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q2KBP5 7.33e-14 74 27 5 198 1 bioM Biotin transport ATP-binding protein BioM Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2KBP5 7.26e-11 65 30 10 220 1 bioM Biotin transport ATP-binding protein BioM Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P37494 7.36e-14 74 30 4 184 3 yybJ Uncharacterized ABC transporter ATP-binding protein YybJ Bacillus subtilis (strain 168)
P37494 5.35e-10 63 23 7 232 3 yybJ Uncharacterized ABC transporter ATP-binding protein YybJ Bacillus subtilis (strain 168)
Q48C94 7.78e-14 75 30 6 191 3 tauB Taurine import ATP-binding protein TauB Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q72FW5 8e-14 76 27 7 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q891M1 9e-14 77 21 15 507 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q891M1 1.1e-06 55 23 9 269 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q55740 9.07e-14 75 30 8 219 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55740 1.14e-07 57 38 0 75 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P94420 9.16e-14 74 27 5 207 1 yclP Petrobactin import ATP-binding protein YclP Bacillus subtilis (strain 168)
P94420 2.81e-09 61 26 7 241 1 yclP Petrobactin import ATP-binding protein YclP Bacillus subtilis (strain 168)
Q89UD2 9.43e-14 76 27 6 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89UD2 7.59e-12 70 31 8 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9JZW0 9.63e-14 76 28 8 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JZW0 5.11e-10 65 29 7 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9K876 9.72e-14 76 29 8 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K876 1.17e-12 73 28 7 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0I5E9 1.02e-13 76 28 7 212 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q0I5E9 2.49e-08 59 24 9 273 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q88KY4 1.06e-13 73 29 6 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88KY4 4.93e-10 63 26 10 241 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
O65934 1.06e-13 77 29 6 218 1 Rv1747 ABC transporter ATP-binding/permease protein Rv1747 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O65934 7.43e-10 65 29 8 223 1 Rv1747 ABC transporter ATP-binding/permease protein Rv1747 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q28VN1 1.09e-13 74 28 6 219 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q28VN1 9.09e-13 71 32 7 186 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q88ZJ6 1.21e-13 76 30 4 163 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZJ6 4.69e-07 55 24 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P0C0E9 1.21e-13 75 30 8 209 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Streptococcus pyogenes
P0C0E9 1.14e-07 57 26 7 220 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Streptococcus pyogenes
P0CZ29 1.21e-13 75 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ29 1.14e-07 57 26 7 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain SSI-1)
A2RH11 1.21e-13 75 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M5 (strain Manfredo)
A2RH11 1.14e-07 57 26 7 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J449 1.21e-13 75 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1J449 1.14e-07 57 26 7 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JEC8 1.21e-13 75 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JEC8 1.14e-07 57 26 7 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q7CMM7 1.21e-13 75 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q7CMM7 1.14e-07 57 26 7 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5X9B5 1.21e-13 75 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5X9B5 1.14e-07 57 26 7 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ28 1.21e-13 75 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0CZ28 1.14e-07 57 26 7 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q9JUX4 1.22e-13 75 28 8 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JUX4 1.28e-09 63 26 5 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q48QM2 1.22e-13 75 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q48QM2 1.12e-07 57 26 7 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JJC9 1.22e-13 75 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JJC9 1.12e-07 57 26 7 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS9429)
P0C0E8 1.22e-13 75 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M1
P0C0E8 1.12e-07 57 26 7 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M1
Q089M3 1.23e-13 73 28 5 187 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shewanella frigidimarina (strain NCIMB 400)
Q9WY65 1.26e-13 74 29 9 251 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q1R155 1.29e-13 73 25 4 218 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1R155 7.4e-12 68 31 7 198 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q0SK28 1.35e-13 74 32 5 184 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q0SK28 1.28e-12 71 33 7 209 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q8GEH7 1.37e-13 75 31 6 192 3 metN Methionine import ATP-binding protein MetN Erwinia pyrifoliae (strain DSM 12162 / Ep1/96)
Q63H62 1.37e-13 74 29 9 248 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q63H62 3.68e-12 70 30 8 215 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q58762 1.38e-13 75 32 7 189 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58762 1.71e-08 59 27 7 196 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8PC11 1.57e-13 75 29 7 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PC11 1.75e-08 60 30 8 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q0B5V4 1.63e-13 76 25 7 259 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B5V4 1.32e-06 54 26 4 195 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B5V4 2.07e-05 50 25 5 204 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B5V4 2.32e-05 50 24 7 216 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q7VNG4 1.64e-13 75 28 4 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q1LKJ2 1.64e-13 75 32 4 165 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LKJ2 7.54e-12 70 28 8 239 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q9K6J9 1.66e-13 76 22 17 506 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K6J9 4.31e-10 65 28 5 199 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7NWX3 1.67e-13 75 29 6 214 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NWX3 1.16e-07 57 28 7 232 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0I3C2 1.78e-13 73 31 6 186 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q0I3C2 2.92e-12 69 28 9 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q8RD07 1.79e-13 73 30 8 222 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD07 4.42e-12 69 30 6 214 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q1J982 1.87e-13 74 29 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1J982 9.73e-08 57 26 7 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1B8U4 1.93e-13 73 32 7 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium sp. (strain MCS)
Q1B8U4 2.19e-07 55 27 4 165 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium sp. (strain MCS)
P45171 2.02e-13 75 29 4 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45171 1.88e-06 53 26 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O84071 2.14e-13 73 28 8 215 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q6LX68 2.19e-13 74 29 6 216 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q6LX68 1.29e-05 50 25 7 215 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q7NIW1 2.25e-13 75 32 5 162 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7NIW1 1.57e-11 69 30 7 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q55462 2.41e-13 76 31 5 212 2 cmpC Bicarbonate transport ATP-binding protein CmpC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55462 4.04e-11 69 30 8 194 2 cmpC Bicarbonate transport ATP-binding protein CmpC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8G358 2.42e-13 72 32 3 165 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella suis biovar 1 (strain 1330)
Q8G358 1.91e-07 55 27 4 213 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella suis biovar 1 (strain 1330)
Q57FS7 2.42e-13 72 32 3 165 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella abortus biovar 1 (strain 9-941)
Q57FS7 1.91e-07 55 27 4 213 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella abortus biovar 1 (strain 9-941)
Q2YNU0 2.42e-13 72 32 3 165 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella abortus (strain 2308)
Q2YNU0 1.91e-07 55 27 4 213 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella abortus (strain 2308)
Q4QK57 2.42e-13 75 29 4 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q4QK57 2.7e-06 53 26 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q8NSN2 2.63e-13 75 29 7 222 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NSN2 6.29e-13 73 26 7 269 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8FZV2 2.68e-13 73 33 7 200 3 BR1368 Putative ABC transporter ATP-binding protein BR1368/BS1330_I1363 Brucella suis biovar 1 (strain 1330)
Q8FZV2 4.18e-09 60 26 6 233 3 BR1368 Putative ABC transporter ATP-binding protein BR1368/BS1330_I1363 Brucella suis biovar 1 (strain 1330)
Q82MV1 2.85e-13 73 34 7 185 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82MV1 6.76e-12 69 29 7 221 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q2K3Y7 2.85e-13 75 31 4 176 3 araG Arabinose import ATP-binding protein AraG Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K3Y7 1.54e-09 63 22 16 517 3 araG Arabinose import ATP-binding protein AraG Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8ENB3 2.86e-13 75 21 17 523 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ENB3 2.45e-09 63 27 7 200 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8YEM5 2.9e-13 72 32 3 165 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YEM5 1.71e-07 55 27 4 213 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q46RX0 2.94e-13 72 30 5 190 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q2JLH7 3.06e-13 73 29 8 222 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q2JLH7 2.19e-07 55 27 6 246 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q2YQP3 3.09e-13 73 33 7 200 3 BAB1_1388 Putative ABC transporter ATP-binding protein BAB1_1388 Brucella abortus (strain 2308)
Q2YQP3 2.47e-08 58 24 5 245 3 BAB1_1388 Putative ABC transporter ATP-binding protein BAB1_1388 Brucella abortus (strain 2308)
Q57CD8 3.09e-13 73 33 7 200 3 BruAb1_1365 Putative ABC transporter ATP-binding protein BruAb1_1365 Brucella abortus biovar 1 (strain 9-941)
Q57CD8 2.47e-08 58 24 5 245 3 BruAb1_1365 Putative ABC transporter ATP-binding protein BruAb1_1365 Brucella abortus biovar 1 (strain 9-941)
Q32EX7 3.1e-13 72 30 9 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q32EX7 1.14e-11 68 28 11 250 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
O34314 3.13e-13 73 31 5 192 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
O34314 3.49e-11 67 29 4 211 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
Q87PH3 3.2e-13 75 27 4 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P54591 3.23e-13 72 27 5 203 3 yhcG Uncharacterized ABC transporter ATP-binding protein YhcG Bacillus subtilis (strain 168)
P54591 7.61e-08 57 28 11 227 3 yhcG Uncharacterized ABC transporter ATP-binding protein YhcG Bacillus subtilis (strain 168)
Q2K0S7 3.26e-13 75 22 14 526 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K0S7 2.06e-10 67 25 6 213 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8TQW9 3.31e-13 75 23 15 479 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQW9 2.98e-08 60 25 8 233 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q160Y9 3.37e-13 73 30 6 185 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q160Y9 5.6e-13 72 27 6 219 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q1QE80 3.45e-13 75 29 6 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QE80 3.07e-09 62 31 9 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P32010 3.45e-13 74 30 9 240 1 drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA Streptomyces peucetius
P32010 6.09e-06 52 30 12 262 1 drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA Streptomyces peucetius
Q0BFQ0 3.69e-13 73 32 8 199 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BFQ0 8.2e-13 73 31 7 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q8E8K8 3.74e-13 74 27 8 216 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8E8K8 1.02e-10 67 29 8 237 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q578K3 3.82e-13 74 31 7 189 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q578K3 3.15e-08 59 30 10 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 3.82e-13 74 31 7 189 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q2YKX3 3.15e-08 59 30 10 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q8U6M1 4.07e-13 74 28 9 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U6M1 5.99e-09 61 30 12 246 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q487I2 4.26e-13 72 28 4 186 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
P49938 4.32e-13 73 28 4 212 3 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Bacillus subtilis (strain 168)
P49938 1.05e-07 57 25 5 235 3 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Bacillus subtilis (strain 168)
Q8XZP8 4.4e-13 74 28 9 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XZP8 2.68e-12 72 30 6 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q609Q1 4.44e-13 74 31 5 179 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q609Q1 4.63e-10 65 30 7 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q6HPN0 4.64e-13 73 28 6 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HPN0 3.41e-12 70 30 8 215 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 4.64e-13 73 28 6 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
Q81VQ2 3.41e-12 70 30 8 215 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 4.64e-13 73 28 6 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
A0R8K8 3.41e-12 70 30 8 215 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q6ME20 4.66e-13 73 28 7 215 3 metN Methionine import ATP-binding protein MetN Protochlamydia amoebophila (strain UWE25)
Q6ME20 5.65e-10 64 28 7 212 3 metN Methionine import ATP-binding protein MetN Protochlamydia amoebophila (strain UWE25)
Q6LR20 4.77e-13 74 27 8 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q6LR20 1.11e-06 54 25 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q5F6V6 4.87e-13 75 30 6 223 3 macB Macrolide export ATP-binding/permease protein MacB Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5F6V6 1.14e-05 52 26 9 207 3 macB Macrolide export ATP-binding/permease protein MacB Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5MK06 4.96e-13 75 30 6 223 1 macB Macrolide export ATP-binding/permease protein MacB Neisseria gonorrhoeae
Q5MK06 2.17e-05 51 26 9 207 1 macB Macrolide export ATP-binding/permease protein MacB Neisseria gonorrhoeae
Q3IX40 5.13e-13 73 32 3 163 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IX40 3.57e-08 59 26 7 229 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IM24 5.21e-13 72 32 5 192 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q3IM24 0.000478 45 25 5 190 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q81GC1 5.21e-13 73 28 3 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GC1 3.07e-10 65 26 7 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A3PRY1 5.41e-13 73 33 3 163 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A3PRY1 1.79e-08 60 27 7 229 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
O86311 5.48e-13 73 33 5 162 1 Rv1218c Multidrug efflux system ATP-binding protein Rv1218c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q0SFW6 5.55e-13 73 29 7 213 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q0SFW6 7.3e-07 55 24 6 274 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
P75957 5.95e-13 72 30 9 214 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
P75957 1.44e-11 67 28 11 250 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q9HZL7 5.97e-13 72 28 6 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HZL7 1.69e-12 70 27 7 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O83658 6.05e-13 73 28 12 244 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
O83658 2.9e-08 59 31 9 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q5WJP0 6.19e-13 73 30 7 225 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q5WJP0 1.37e-06 54 25 6 253 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q12298 6.23e-13 74 23 13 381 1 YDR061W Uncharacterized ABC transporter ATP-binding protein YDR061W Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O27739 6.24e-13 73 29 6 208 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O27739 8.85e-09 60 28 10 253 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O85818 6.49e-13 73 28 4 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q39JR1 6.69e-13 74 23 19 532 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39JR1 1.9e-08 60 28 7 220 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8EK40 6.73e-13 71 28 5 189 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9K0N7 6.97e-13 75 30 6 223 3 macB Macrolide export ATP-binding/permease protein MacB Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q39GY8 7e-13 74 24 20 508 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GY8 3.34e-09 63 26 7 250 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GY8 0.000139 48 27 6 175 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q6G1D9 7.16e-13 71 24 7 235 3 BQ02700 Putative ABC transporter ATP-binding protein BQ02700 Bartonella quintana (strain Toulouse)
Q6G1D9 3.88e-10 63 26 9 230 3 BQ02700 Putative ABC transporter ATP-binding protein BQ02700 Bartonella quintana (strain Toulouse)
Q6N9W0 7.35e-13 73 30 4 185 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6N9W0 2.63e-09 62 25 6 238 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q3J1N0 7.55e-13 73 30 5 192 3 metN Methionine import ATP-binding protein MetN Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q6D4E2 8.13e-13 73 29 5 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q92WJ0 8.19e-13 73 29 5 203 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q92WJ0 8.41e-09 61 31 11 232 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q8FVV5 8.41e-13 73 32 6 174 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q8FVV5 1.29e-07 57 28 11 239 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q9LK50 8.48e-13 74 31 9 216 2 ABCG26 ABC transporter G family member 26 Arabidopsis thaliana
Q9LK50 0.000473 46 29 6 145 2 ABCG26 ABC transporter G family member 26 Arabidopsis thaliana
A1B9Q7 8.49e-13 73 28 6 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
A1B9Q7 1.99e-09 63 27 9 236 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
Q5MZ53 8.51e-13 72 27 4 197 3 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q5MZ53 8.45e-10 63 29 4 208 3 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55108 8.51e-13 72 27 4 197 1 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q55108 8.45e-10 63 29 4 208 1 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P47705 8.6e-13 72 27 6 220 3 MG467 Putative ABC transporter ATP-binding protein MG467 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q92LX3 8.82e-13 73 27 6 205 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q92LX3 1.08e-08 60 28 9 225 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q7VV72 9.17e-13 73 29 9 217 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7VV72 0.000128 48 36 1 79 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 9.17e-13 73 29 9 217 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7W4E1 0.000128 48 36 1 79 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 9.17e-13 73 29 9 217 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7WFU9 0.000128 48 36 1 79 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8R7Y5 9.23e-13 72 27 7 225 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8R7Y5 5.21e-06 52 25 9 234 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8FRX8 9.56e-13 73 28 7 251 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8FRX8 2.36e-11 68 30 6 202 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8FV85 9.72e-13 73 26 7 226 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8FV85 4.57e-09 62 27 6 232 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 9.72e-13 73 26 7 226 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YD40 4.57e-09 62 27 6 232 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 9.72e-13 73 26 7 226 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q579H8 4.57e-09 62 27 6 232 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 9.72e-13 73 26 7 226 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q2YIV5 4.57e-09 62 27 6 232 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
D5AQY6 9.86e-13 71 29 8 223 1 nikO Nickel import ATP-binding protein NikO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
D5AQY6 8.7e-06 50 25 7 229 1 nikO Nickel import ATP-binding protein NikO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q03ZL6 1.02e-12 72 29 6 186 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q1LNM0 1.04e-12 72 32 8 194 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LNM0 1.77e-09 62 28 6 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q3K9F9 1.04e-12 71 27 6 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q3K9F9 4.68e-12 69 26 7 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q8UKE4 1.09e-12 74 28 8 265 3 macB Macrolide export ATP-binding/permease protein MacB Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UKE4 6.39e-05 49 23 7 192 3 macB Macrolide export ATP-binding/permease protein MacB Agrobacterium fabrum (strain C58 / ATCC 33970)
Q97KS6 1.1e-12 73 28 5 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KS6 6.53e-08 58 24 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P44692 1.1e-12 72 27 4 213 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44692 2.73e-08 58 25 6 205 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q65QT6 1.11e-12 73 30 6 221 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65QT6 3.16e-06 53 27 3 163 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8UA73 1.11e-12 72 29 7 193 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UA73 2.97e-11 68 25 7 263 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92S10 1.13e-12 73 28 6 213 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium meliloti (strain 1021)
Q92S10 4.89e-05 49 25 5 192 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium meliloti (strain 1021)
P31060 1.17e-12 73 24 8 350 2 modF ABC transporter ATP-binding protein ModF Escherichia coli (strain K12)
Q8TTN2 1.19e-12 73 27 6 211 3 MA_0394 Putative ABC transporter ATP-binding protein MA_0394 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TTN2 1.56e-10 67 28 8 227 3 MA_0394 Putative ABC transporter ATP-binding protein MA_0394 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P33982 1.23e-12 72 30 4 174 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P33982 2.65e-09 62 27 5 199 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9KAG5 1.24e-12 73 22 18 509 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KAG5 1.42e-10 67 25 7 222 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7W025 1.27e-12 71 30 8 212 3 hmuV Hemin import ATP-binding protein HmuV Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W025 2.81e-07 55 28 8 233 3 hmuV Hemin import ATP-binding protein HmuV Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q02SA6 1.3e-12 71 32 5 178 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02SA6 5.34e-09 60 30 4 200 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain UCBPP-PA14)
Q4K441 1.3e-12 71 27 5 210 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K441 1.59e-10 65 29 5 223 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5WKG4 1.39e-12 71 31 7 186 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q5WKG4 5.28e-11 66 30 5 202 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
A3CVD3 1.4e-12 71 30 8 215 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A3CVD3 1.05e-11 69 28 6 224 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q73F67 1.45e-12 71 28 6 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73F67 2.21e-12 71 30 8 215 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8YA75 1.49e-12 72 28 8 213 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8YA75 1.04e-06 54 24 8 254 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5PMK1 1.58e-12 72 27 6 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PMK1 7.7e-06 52 25 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9HX79 1.58e-12 71 32 5 178 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HX79 1.66e-08 59 29 4 200 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0I354 1.61e-12 70 30 8 223 3 thiQ Thiamine import ATP-binding protein ThiQ Histophilus somni (strain 129Pt)
Q0I354 4.3e-07 54 33 7 162 3 thiQ Thiamine import ATP-binding protein ThiQ Histophilus somni (strain 129Pt)
Q8U8D6 1.62e-12 71 29 4 228 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U8D6 2.3e-10 65 26 7 217 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8Z7H7 1.62e-12 72 27 6 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q8Z7H7 7.3e-06 52 25 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q9PKX1 1.63e-12 71 29 8 212 3 TC_0339 Probable metal transport system ATP-binding protein TC_0339 Chlamydia muridarum (strain MoPn / Nigg)
Q9PKX1 1.35e-07 56 27 7 220 3 TC_0339 Probable metal transport system ATP-binding protein TC_0339 Chlamydia muridarum (strain MoPn / Nigg)
Q92XW1 1.63e-12 72 28 5 196 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q92XW1 1.09e-11 70 30 8 227 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q492R2 1.63e-12 70 30 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Blochmanniella pennsylvanica (strain BPEN)
P40790 1.65e-12 72 27 6 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P40790 7.77e-06 52 25 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 1.65e-12 72 27 6 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q57QC8 7.77e-06 52 25 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
P63354 1.68e-12 72 26 5 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63354 4.61e-11 68 32 9 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 1.68e-12 72 26 5 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P63353 4.61e-11 68 32 9 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q44613 1.7e-12 70 29 8 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q44613 4.42e-09 60 25 9 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8G5P8 1.74e-12 72 28 6 215 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q8G5P8 6.38e-09 61 26 6 222 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
A0A1U9YI12 1.74e-12 74 29 10 258 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
A0A1U9YI12 4.44e-11 69 27 8 222 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
A0A1U9YI12 3.91e-05 50 24 7 191 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
P10091 1.76e-12 72 29 5 190 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
P10091 3.37e-12 71 29 6 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
D4GSY7 1.79e-12 71 29 7 227 3 HVO_1886 Probable anion import ATP-binding protein HVO_1886 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
D4GSY7 7.98e-10 63 30 6 211 3 HVO_1886 Probable anion import ATP-binding protein HVO_1886 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
A1TAI4 1.8e-12 72 32 4 166 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A1TAI4 1.72e-06 53 26 5 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q884I3 1.82e-12 70 27 7 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q884I3 2.26e-11 67 26 6 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2SMN9 1.89e-12 73 31 8 236 3 macB Macrolide export ATP-binding/permease protein MacB Hahella chejuensis (strain KCTC 2396)
Q9WXX0 1.92e-12 73 22 16 485 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX0 1.03e-10 67 26 9 259 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX0 3.87e-05 50 21 10 252 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q03PF2 1.94e-12 72 27 5 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03PF2 8.19e-09 61 26 4 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q6NJ07 2.08e-12 72 30 7 226 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q6NJ07 7.84e-10 64 25 6 235 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q9K7C3 2.1e-12 73 23 15 507 3 araG L-arabinose transport ATP-binding protein AraG Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K7C3 2.66e-11 69 28 6 199 3 araG L-arabinose transport ATP-binding protein AraG Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K7C3 3.22e-09 63 26 6 226 3 araG L-arabinose transport ATP-binding protein AraG Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q21XJ9 2.11e-12 71 28 9 232 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21XJ9 4.6e-10 64 29 7 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q0I074 2.12e-12 70 27 7 194 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shewanella sp. (strain MR-7)
Q830W6 2.13e-12 72 26 7 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q830W6 3.22e-11 68 26 6 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q6WB63 2.16e-12 71 31 8 196 3 phnC Phosphonates import ATP-binding protein PhnC Alcaligenes faecalis
Q6WB63 7.98e-08 57 29 5 200 3 phnC Phosphonates import ATP-binding protein PhnC Alcaligenes faecalis
P29959 2.23e-12 70 30 4 166 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q664P8 2.3e-12 70 27 5 190 3 tauB Taurine import ATP-binding protein TauB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q664P8 1.35e-06 53 28 6 202 3 tauB Taurine import ATP-binding protein TauB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q65TB7 2.32e-12 70 30 7 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65TB7 4.27e-11 66 30 9 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8RHL0 2.33e-12 70 31 5 177 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q32EY4 2.34e-12 72 26 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q724C0 2.37e-12 72 28 8 213 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q724C0 3.14e-06 53 24 7 253 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q4KBU0 2.4e-12 71 27 7 248 3 metN3 Methionine import ATP-binding protein MetN 3 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3Z300 2.42e-12 70 30 9 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q3Z300 5.61e-11 66 28 11 250 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 2.42e-12 70 30 9 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q1RD37 5.61e-11 66 28 11 250 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 2.42e-12 70 30 9 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FIM7 5.61e-11 66 28 11 250 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 2.42e-12 70 30 9 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TIV6 5.61e-11 66 28 11 250 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P25885 2.45e-12 70 33 5 175 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
Q46ZU5 2.46e-12 71 29 4 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46ZU5 6.27e-11 67 31 7 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q890D1 2.55e-12 70 27 5 220 2 larO Nickel import ATP-binding protein LarO Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q1CCR9 2.55e-12 70 28 4 174 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CCR9 1.38e-06 53 28 6 202 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZJD0 2.55e-12 70 28 4 174 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis
Q8ZJD0 1.38e-06 53 28 6 202 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis
Q1C2S1 2.55e-12 70 28 4 174 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C2S1 1.38e-06 53 28 6 202 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis bv. Antiqua (strain Antiqua)
Q4KFA2 2.56e-12 70 27 6 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KFA2 5.17e-11 66 26 7 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6NBX6 2.57e-12 70 30 7 190 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q55463 2.58e-12 70 28 7 203 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55463 6.68e-11 66 28 6 224 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q07QX6 2.59e-12 73 31 10 235 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
Q07QX6 1.04e-05 52 28 6 198 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
Q81TH8 2.85e-12 71 27 3 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q81TH8 1e-10 66 26 7 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q0T5R2 2.88e-12 72 26 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q2FVF1 2.96e-12 70 27 7 224 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q18C09 2.96e-12 71 26 6 227 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q18C09 3.9e-12 70 27 5 208 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q0HNQ5 3.01e-12 69 27 7 194 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shewanella sp. (strain MR-4)
Q4KK16 3.03e-12 70 27 6 191 3 tauB Taurine import ATP-binding protein TauB Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1RD28 3.07e-12 72 26 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 3.07e-12 72 26 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q88CL2 3.07e-12 71 28 8 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88CL2 5.31e-11 67 30 9 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q63E84 3.16e-12 71 27 3 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q63E84 9.43e-11 67 26 7 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 3.16e-12 71 27 3 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73BM0 9.43e-11 67 26 7 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 3.16e-12 71 27 3 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
A0RBB0 9.43e-11 67 26 7 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q3K506 3.16e-12 70 28 5 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q3K506 4.2e-06 52 38 1 78 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q0SRL2 3.18e-12 71 26 4 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q0SRL2 5.06e-08 58 27 5 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q6HLQ9 3.19e-12 71 27 3 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HLQ9 8.61e-11 67 26 7 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
P69877 3.21e-12 72 26 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 3.21e-12 72 26 7 213 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 3.21e-12 72 26 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 3.21e-12 72 26 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 3.21e-12 72 26 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q24XJ2 3.25e-12 71 26 5 177 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q24XJ2 3.68e-08 58 26 6 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q87UH7 3.28e-12 70 28 6 191 3 tauB Taurine import ATP-binding protein TauB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q7VM95 3.38e-12 71 28 10 225 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7VM95 2.23e-07 56 26 9 255 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q48CA0 3.43e-12 70 28 6 208 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48CA0 1.62e-07 56 38 2 97 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48CA0 0.000388 46 47 0 44 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9ZJ34 3.59e-12 71 30 5 178 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain J99 / ATCC 700824)
Q9ZJ34 1.99e-08 59 24 6 255 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain J99 / ATCC 700824)
A0A0H3JT74 3.6e-12 70 27 7 224 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain Mu50 / ATCC 700699)
A0A0H3JT74 7.13e-08 57 25 8 260 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q48KI4 3.69e-12 69 27 7 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48KI4 5.9e-11 65 26 6 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1GHY4 3.79e-12 68 29 6 201 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Ruegeria sp. (strain TM1040)
Q166I9 3.82e-12 68 31 8 184 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q5LUR8 3.9e-12 70 28 4 219 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LUR8 2.72e-11 67 32 5 184 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A1URR2 3.91e-12 71 27 8 232 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
A1URR2 9.11e-08 57 28 5 170 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q73DH7 3.91e-12 72 28 4 197 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73DH7 8.31e-10 65 23 20 512 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5JEB0 3.96e-12 71 33 6 176 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5JEB0 4.84e-08 58 27 7 215 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9YG51 4e-12 70 28 8 244 3 pstB Phosphate import ATP-binding protein PstB Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q9YG51 0.000114 47 30 2 99 3 pstB Phosphate import ATP-binding protein PstB Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q72Y96 4e-12 71 28 8 224 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q72Y96 1.08e-06 54 22 7 259 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q3Z2Z3 4.06e-12 71 26 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 4.06e-12 71 26 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
P9WQL3 4.12e-12 71 29 6 184 1 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL3 5.82e-08 58 28 7 241 1 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL2 4.12e-12 71 29 6 184 3 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQL2 5.82e-08 58 28 7 241 3 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q815Y7 4.15e-12 71 28 8 224 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q815Y7 1.2e-06 54 22 7 259 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P47426 4.19e-12 70 28 4 191 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47426 3e-07 55 25 8 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8XIZ5 4.45e-12 71 26 4 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q8XIZ5 3.9e-08 58 25 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 4.45e-12 71 26 4 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TNZ3 3.9e-08 58 25 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_06590
Feature type CDS
Gene ettA
Product energy-dependent translational throttle protein EttA
Location 157981 - 159627 (strand: 1)
Length 1647 (nucleotides) / 548 (amino acids)
In genomic island -

Contig

Accession contig_6
Length 178871 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1210
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF12848 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0488 General function prediction only (R) R ATPase components of ABC transporters with duplicated ATPase domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06020 energy-dependent translational throttle protein EttA - -

Protein Sequence

MHRVGKIVPPKRHILKDISLSFFPGAKIGVLGLNGAGKSTLLRIMAGVDTDIEGEARPQPGLNIGYLPQEPKLNPEHTVREAVEEAVAEVKNALTRLDEVYALYADPDADFDKLAKEQGELEAIIQSHDGHNLDNQLERAADALRLPAWDAKIGNLSGGERRRVAICRLLLEKPDMLLLDEPTNHLDAESVAWLERFLHDYEGTVVAITHDRYFLDNVAGWILELDRGEGIPWEGNYSSWLEQKDARLAQEASSEAARRKSIEKELEWIRQNPKGRQSKGKARLARFEELNSVEYQKRNETNELFIPPGPRLGDKVLEVENLTKSYDGRTLIDNLSFSLPKGAIVGIIGPNGAGKSTLFRMISGKEQPDSGTITLGDTVTIASVDQFRDAMDDKKTVWEEVSGGQDIMRIGTTEIPSRAYVGRFNFKGVDQGKRVGELSGGERGRLHLAKLLQVGGNMLLLDEPTNDLDIETLRALENALLEFPGCAMVISHDRWFLDRIATHIIDYQDEGKVEFFEGNFSEYEDYKKRTLGEAALEPHRIKYKRMTK

Flanking regions ( +/- flanking 50bp)

GCCCCATCAACGAAAAAAGGTATACTACATTGGCTCAATACGTTTATTCGATGCACCGTGTCGGCAAAATTGTGCCGCCGAAGCGTCATATACTGAAAGATATCTCTCTGAGTTTCTTCCCGGGCGCCAAAATCGGTGTTCTCGGCCTGAATGGTGCCGGTAAATCAACCCTGCTGCGCATCATGGCAGGTGTGGATACCGATATTGAGGGCGAAGCACGTCCGCAGCCCGGCCTGAACATCGGCTATCTGCCGCAGGAACCGAAACTGAATCCGGAACACACTGTCCGTGAAGCGGTTGAAGAAGCGGTTGCGGAAGTGAAAAATGCCCTGACCCGTCTGGATGAAGTGTACGCGCTGTACGCCGATCCGGATGCGGATTTTGACAAACTCGCCAAAGAGCAGGGTGAGCTGGAAGCGATTATCCAGTCTCATGACGGTCATAATCTGGATAACCAGCTGGAACGTGCGGCAGATGCCCTGCGTTTACCGGCCTGGGATGCCAAAATCGGTAATCTGTCCGGGGGTGAGCGCCGCCGTGTGGCTATCTGCCGCCTGCTGCTGGAAAAACCGGATATGCTGCTGCTCGACGAACCGACCAACCACCTGGATGCGGAATCTGTCGCCTGGCTGGAACGCTTCCTGCACGACTACGAGGGCACCGTTGTGGCGATCACCCACGACCGTTACTTCCTTGATAACGTCGCCGGCTGGATCCTCGAGCTTGACCGCGGTGAAGGTATTCCGTGGGAAGGAAACTACTCCAGCTGGCTGGAGCAGAAAGATGCCCGTCTGGCACAGGAAGCGTCTTCTGAAGCAGCCCGCCGCAAATCTATCGAGAAAGAGCTGGAGTGGATCCGTCAGAATCCGAAAGGCCGTCAATCCAAAGGCAAGGCCCGTCTGGCCCGCTTTGAGGAACTGAACAGCGTCGAGTACCAGAAACGTAACGAGACCAACGAACTCTTTATTCCGCCTGGTCCGCGTCTGGGTGACAAAGTTCTGGAAGTGGAAAACCTGACCAAATCCTATGATGGCCGTACCCTGATCGATAACCTGAGTTTCTCGCTGCCGAAAGGGGCGATTGTCGGGATTATCGGGCCGAACGGCGCGGGTAAATCCACCCTGTTCCGTATGATCAGCGGTAAAGAACAGCCGGATTCCGGTACTATCACTCTCGGTGATACCGTGACTATCGCGTCTGTTGATCAGTTCCGTGATGCCATGGATGATAAGAAAACCGTCTGGGAAGAAGTGTCCGGCGGGCAGGATATCATGCGTATCGGCACCACTGAGATCCCGAGCCGTGCTTATGTCGGACGCTTTAACTTCAAAGGCGTTGACCAGGGCAAACGTGTCGGTGAGTTATCCGGTGGTGAGCGCGGCCGTCTGCATCTGGCCAAACTGCTGCAGGTCGGCGGCAACATGCTGCTGCTCGATGAACCGACCAACGACCTGGATATCGAAACCCTGCGCGCACTGGAAAACGCCCTGCTGGAATTCCCGGGCTGCGCCATGGTCATTTCCCATGACCGCTGGTTCCTTGACCGTATCGCCACCCATATCATCGACTATCAGGATGAGGGCAAAGTGGAGTTCTTCGAAGGTAACTTCAGTGAATATGAAGATTACAAGAAACGGACTCTCGGCGAGGCCGCACTGGAGCCGCACCGCATCAAGTACAAACGTATGACCAAATAGGCCATATAACGGAAAATGCCGCGTGGTGAGGGACCGCGCGGCATTTTTTG