Homologs in group_1210

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06590 FBDBKF_06590 96.5 Morganella morganii S1 ettA energy-dependent translational throttle protein EttA
EHELCC_09635 EHELCC_09635 96.5 Morganella morganii S2 ettA energy-dependent translational throttle protein EttA
NLDBIP_10015 NLDBIP_10015 96.5 Morganella morganii S4 ettA energy-dependent translational throttle protein EttA
LHKJJB_07740 LHKJJB_07740 96.5 Morganella morganii S3 ettA energy-dependent translational throttle protein EttA
HKOGLL_07290 HKOGLL_07290 96.5 Morganella morganii S5 ettA energy-dependent translational throttle protein EttA
PMI_RS18470 PMI_RS18470 90.6 Proteus mirabilis HI4320 ettA energy-dependent translational throttle protein EttA

Distribution of the homologs in the orthogroup group_1210

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1210

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A0A0H2VFI8 0.0 1027 89 0 555 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9W5 0.0 1026 89 0 555 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 0.0 1026 89 0 555 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W4 0.0 1026 89 0 555 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P45127 0.0 999 85 0 554 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WQK3 0.0 583 55 5 561 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK2 0.0 583 55 5 561 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P12622 1.61e-107 326 57 1 290 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 2.53e-14 77 46 1 101 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
O05519 8.79e-95 305 34 10 540 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 6.77e-26 115 29 3 251 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 7.44e-21 100 30 5 243 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O06476 4.29e-93 300 36 7 518 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
O06476 2.1e-28 123 30 6 268 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
Q57242 4.76e-85 280 35 4 510 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 3e-20 98 30 5 245 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P43672 9.36e-83 273 34 7 516 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 2.88e-17 89 30 6 247 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
O31716 2.05e-75 251 32 9 515 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 2.94e-21 100 27 4 238 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
Q8K9I3 6.43e-73 246 32 5 490 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9I3 1.47e-21 102 31 5 220 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9LV93 3.51e-72 247 31 7 522 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 5.71e-26 115 31 5 240 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 9.87e-21 99 29 4 248 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
O34512 6.1e-69 234 29 7 500 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 3.74e-20 97 29 6 265 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
P57445 8.02e-69 236 30 7 519 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57445 4.21e-17 88 29 4 212 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P0A9U3 1.29e-68 233 31 10 521 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U3 4.53e-22 103 31 4 235 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U3 2.24e-19 95 30 7 242 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 1.29e-68 233 31 10 521 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U4 4.53e-22 103 31 4 235 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U4 2.24e-19 95 30 7 242 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 1.29e-68 233 31 10 521 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P0A9U5 4.53e-22 103 31 4 235 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P0A9U5 2.24e-19 95 30 7 242 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P63389 1.02e-67 233 31 14 535 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63390 1.02e-67 233 31 14 535 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
A0A0H2VBH0 1.42e-67 233 31 14 535 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9FIB4 3.72e-67 233 31 7 514 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 1.74e-23 108 28 4 235 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 3.66e-23 107 31 5 248 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q45978 7.89e-57 203 32 13 550 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q45978 6.28e-16 84 29 4 227 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P25256 2.78e-54 195 32 13 521 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 4.07e-24 109 29 2 241 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 8.26e-11 68 31 6 214 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
Q8T6B4 3.79e-54 201 28 9 537 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
P44808 2.2e-52 192 31 16 531 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9FJH6 2.64e-50 185 30 11 495 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q9FJH6 3.79e-18 91 28 4 257 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q9FJH6 1.49e-15 83 28 6 254 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
P40024 3.16e-50 186 28 12 538 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 4.44e-50 187 27 12 540 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P45167 5.83e-50 181 36 1 334 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 2.7e-10 66 29 8 275 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 5.22e-05 49 39 1 68 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9UG63 3.92e-48 180 28 13 543 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q9UG63 6.44e-13 75 26 5 251 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q99LE6 5.22e-48 179 29 12 543 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q99LE6 6.71e-13 75 26 5 251 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q8H0V6 6.55e-48 181 29 16 527 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8T6B7 1.65e-47 177 26 11 538 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B7 2.99e-14 79 26 8 254 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q9USH9 3.17e-47 179 28 15 549 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9M1H3 5.35e-47 178 28 16 574 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9M1H3 4.42e-18 91 28 5 252 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
O59672 5.4e-47 178 26 11 550 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0DX93 2.36e-46 172 30 14 535 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 1.68e-17 89 32 6 209 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P39115 3.11e-46 173 31 7 373 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 3.5e-24 109 33 5 220 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 6.44e-22 102 30 10 287 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
Q2KJA2 3.99e-46 174 28 12 552 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q2KJA2 1.8e-13 77 27 5 251 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
O42943 7.28e-45 171 26 14 568 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O42943 3.5e-19 94 29 4 231 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q66H39 9.47e-45 171 26 11 539 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q66H39 2.63e-19 95 30 6 244 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q66H39 3.24e-16 85 28 6 238 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q8K268 1.25e-44 171 27 12 528 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q8K268 3.68e-19 95 30 6 244 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q8K268 9.66e-17 87 29 5 231 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q5R9Z5 3.21e-44 170 27 11 525 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q5R9Z5 9.79e-19 93 30 6 244 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q5R9Z5 6.82e-16 84 30 6 217 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q9NUQ8 3.82e-44 170 27 11 525 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q9NUQ8 1.11e-19 96 30 6 244 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q9NUQ8 8.13e-16 84 30 6 217 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q8SRV5 6.09e-42 161 30 8 373 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 9.54e-15 80 29 4 204 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 6.89e-11 68 29 7 206 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q6MG08 2.03e-35 145 27 12 544 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 3.31e-13 76 28 6 231 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 2.52e-12 73 25 5 239 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q767L0 2.1e-35 145 26 12 560 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 3.6e-13 76 28 6 231 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 9.94e-13 74 25 5 239 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q8NE71 2.11e-35 145 27 13 539 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 2.99e-13 76 28 6 231 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 2.67e-12 73 25 5 239 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q7YR37 8.42e-35 143 27 13 539 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 2.94e-13 76 28 6 231 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 1.32e-11 71 25 5 239 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q6P542 4.46e-34 141 26 11 549 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 5.15e-14 79 29 6 231 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 5.7e-12 72 25 5 239 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
P23212 2.05e-32 133 27 24 554 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 8.81e-17 86 30 3 177 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
O14134 1.01e-25 115 26 15 426 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 3.91e-17 89 28 3 212 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 3.04e-10 67 32 5 143 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 9.71e-05 49 35 0 59 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6LQ00 1.53e-25 114 25 16 511 3 PBPRA2240 Putative ABC transporter ATP-binding protein PBPRA2240 Photobacterium profundum (strain SS9)
Q8DQY5 5.67e-24 109 27 22 531 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
O93796 7.58e-24 110 26 11 380 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 2.79e-17 89 33 8 236 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 2.46e-09 63 34 0 89 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 0.000144 48 35 0 76 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P0A9U2 1.18e-23 108 24 16 544 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U2 6.15e-12 72 28 5 205 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U1 1.18e-23 108 24 16 544 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
P0A9U1 6.15e-12 72 28 5 205 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
Q832R5 2.09e-23 107 25 19 531 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q832R5 5.99e-09 62 26 8 212 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q97SA3 2.77e-23 107 27 23 528 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97SA3 1.09e-07 58 24 5 234 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
O94489 3.53e-23 107 27 11 381 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 4.48e-12 72 30 7 208 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 7.33e-09 62 33 0 89 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 0.000103 49 38 0 65 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 0.000416 47 28 2 136 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P16521 3.92e-23 107 26 12 394 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 1.97e-16 86 32 6 237 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 3.38e-09 63 34 0 89 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 7.11e-05 49 36 0 76 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P25997 4.12e-23 107 26 11 394 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 1.51e-16 87 33 4 203 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 3.64e-08 60 33 0 87 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 0.00023 48 41 0 63 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8DY60 8.34e-23 105 27 22 520 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8DY60 1.93e-06 54 23 9 234 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8DY60 3.76e-05 50 27 3 173 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
O34362 1.08e-22 105 23 18 536 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 4.53e-10 65 26 12 252 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
D0MYB4 1.48e-22 105 29 5 245 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 4e-20 98 31 6 225 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 8.13e-07 55 40 0 64 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 4.11e-05 50 41 0 63 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 0.000575 46 30 0 73 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
Q08972 1.71e-22 105 26 12 389 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 3.89e-19 95 31 6 220 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 2.74e-08 60 40 2 83 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 0.000852 46 38 0 63 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8XK20 2.01e-22 104 24 20 584 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8E3S6 3.2e-22 103 26 22 520 3 gbs1680 Putative ABC transporter ATP-binding protein gbs1680 Streptococcus agalactiae serotype III (strain NEM316)
Q8E3S6 3.54e-05 50 27 3 173 3 gbs1680 Putative ABC transporter ATP-binding protein gbs1680 Streptococcus agalactiae serotype III (strain NEM316)
P29551 3.2e-22 105 27 13 378 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 1.02e-15 84 29 5 204 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 7.71e-09 62 36 0 87 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 2.63e-05 50 39 0 61 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 0.000138 48 35 0 76 3 TEF3 Elongation factor 3 Pneumocystis carinii
P53978 4.53e-22 104 26 10 382 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 4.06e-19 95 32 7 236 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 2.41e-09 63 34 0 87 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 9.6e-05 49 35 0 76 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q88ZZ2 1.1e-21 102 24 18 528 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZZ2 0.000786 45 27 7 179 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q75EV6 1.18e-21 103 25 12 398 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 1.7e-16 87 32 7 236 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 1.67e-08 61 33 0 89 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 0.000149 48 41 0 63 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q8ES39 1.79e-21 101 23 21 551 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ES39 2.92e-12 72 25 9 285 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q926D8 2.72e-21 97 29 7 233 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q926D8 2.5e-13 73 26 9 258 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q7MFH3 4.24e-21 100 24 15 542 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q7MFH3 5.03e-06 53 29 5 175 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q8XXY9 4.91e-21 97 38 6 176 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XXY9 8e-09 60 29 7 188 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q81CT8 5.44e-21 100 26 17 483 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81CT8 0.000191 48 26 5 204 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8D3Z9 2.28e-20 98 24 16 543 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8D3Z9 2.01e-06 54 29 5 175 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8GNH6 7.13e-20 94 40 6 167 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q8GNH6 9.51e-11 67 28 6 190 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q6YRJ4 9.28e-20 96 23 16 494 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q6YRJ4 1.66e-13 77 27 8 256 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q81PZ8 1.34e-19 95 26 18 492 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q81PZ8 4.35e-05 50 26 5 194 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q87G35 1.48e-19 95 24 17 537 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87G35 3.39e-05 50 28 6 175 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6HI76 1.71e-19 95 26 18 493 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HI76 0.000175 48 25 6 199 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q7AH43 2.02e-19 93 29 6 193 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q7AH43 4.33e-08 58 24 7 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
O52618 3.27e-19 92 39 5 167 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
O52618 1.3e-12 72 31 6 187 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q73R11 3.88e-19 94 21 16 514 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73R11 8.64e-10 64 28 7 224 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73R11 2.91e-08 60 24 9 221 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P72335 7.31e-19 90 37 5 167 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P72335 4.45e-09 61 27 9 243 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P37009 1.18e-18 90 29 6 193 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
P37009 2.51e-08 59 24 7 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q73XU8 1.34e-18 91 30 10 276 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q73XU8 5.13e-10 65 29 7 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q1M7W6 1.37e-18 90 36 5 176 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M7W6 2.4e-10 65 26 11 320 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P55476 2.27e-18 90 38 5 170 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q737I0 2.4e-18 92 26 17 492 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q737I0 2.62e-08 60 24 7 238 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6FFL0 2.42e-18 88 31 6 194 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FFL0 4.55e-15 79 31 6 206 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P37624 2.56e-18 92 23 16 483 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P37624 1.62e-05 51 25 5 174 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
Q3JSQ0 2.57e-18 89 37 6 166 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q3JSQ0 1.16e-09 63 27 5 190 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 2.57e-18 89 37 6 166 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q62K72 1.16e-09 63 27 5 190 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q63TX3 2.7e-18 89 37 6 166 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q63TX3 1.11e-09 63 27 5 190 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
A1JRI2 2.83e-18 88 30 5 220 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 1.63e-11 68 30 6 186 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q1BWI2 3.78e-18 89 37 6 166 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q1BWI2 1.49e-08 60 29 6 187 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q2SVP3 3.96e-18 88 36 6 166 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVP3 7.97e-10 63 29 6 187 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q1R597 4.32e-18 87 31 6 218 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q1R597 1.07e-09 62 28 9 234 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
O70014 4.8e-18 87 32 6 218 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
O70014 2.47e-10 64 29 9 234 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
Q7N8B9 4.92e-18 89 30 6 195 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N8B9 1.53e-07 57 25 9 229 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q32AY3 5.03e-18 87 32 6 218 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q32AY3 2.54e-10 64 29 9 234 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
P08720 5.29e-18 88 36 5 176 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
P08720 2.58e-09 62 26 11 320 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
Q84EY8 5.61e-18 87 36 9 197 3 hmuV Hemin import ATP-binding protein HmuV Enterobacter cloacae
O31427 5.72e-18 87 29 8 235 1 skfE SkfA peptide export ATP-binding protein SkfE Bacillus subtilis (strain 168)
Q9KLQ5 6.14e-18 89 28 6 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KLQ5 6.66e-06 52 22 8 236 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6LKD4 6.14e-18 89 30 8 200 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q6LKD4 1.26e-07 57 23 6 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q02R79 6.64e-18 89 28 7 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02R79 4.51e-12 71 32 6 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HY19 6.95e-18 89 28 7 232 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HY19 5.07e-12 71 32 6 201 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8FCJ1 7.57e-18 87 31 6 218 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCJ1 3.52e-10 64 29 9 234 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBU8 7.57e-18 87 31 6 218 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBU8 3.52e-10 64 29 9 234 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P26050 1.14e-17 87 35 5 172 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P26050 2.17e-08 59 29 7 187 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P23703 1.48e-17 87 38 6 167 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P23703 1.01e-08 60 27 10 243 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P31134 1.85e-17 87 32 7 198 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
P31134 7.38e-10 64 27 8 230 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q7N3S7 2.2e-17 85 31 4 197 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N3S7 2.58e-07 55 27 8 229 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9MUN1 2.21e-17 87 27 5 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9MUN1 6.43e-12 70 28 5 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
P9WQM1 2.28e-17 87 31 10 264 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM1 4.56e-10 65 30 7 220 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 2.28e-17 87 31 10 264 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQM0 4.56e-10 65 30 7 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 2.28e-17 87 31 10 264 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A4W3 4.56e-10 65 30 7 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8X5N2 2.8e-17 85 31 6 218 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q8X5N2 1.69e-10 65 29 9 234 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
P15031 4.13e-17 84 36 5 172 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
P15031 0.000626 45 24 7 213 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
Q13ZJ1 4.52e-17 85 36 6 172 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q13ZJ1 9.53e-08 57 27 6 190 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q93KD4 5.41e-17 83 29 6 218 1 tupC Tungstate uptake system ATP-binding protein TupC Peptoclostridium acidaminophilum
Q93KD4 1.06e-13 73 30 6 210 1 tupC Tungstate uptake system ATP-binding protein TupC Peptoclostridium acidaminophilum
Q3ISC1 5.55e-17 84 35 4 172 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q3ISC1 0.000169 47 28 7 182 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q9TKX3 8.03e-17 85 30 6 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9TKX3 1.74e-09 63 29 7 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q1B677 8.07e-17 85 31 6 218 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q1B677 1.37e-07 57 26 7 260 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
O34946 8.44e-17 83 29 8 237 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34946 1.2e-11 68 26 5 183 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
P37774 8.86e-17 83 27 7 222 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
P37774 2.2e-08 58 42 1 76 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
P50332 9.56e-17 85 38 6 167 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
P50332 3.88e-09 62 30 6 186 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
Q897I2 1.06e-16 86 26 12 369 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 3.55e-14 78 29 7 231 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q56953 1.09e-16 84 34 5 183 3 yfeB Chelated iron transport system membrane protein YfeB Yersinia pestis
Q56953 0.000306 46 26 9 206 3 yfeB Chelated iron transport system membrane protein YfeB Yersinia pestis
Q1R0Z6 1.69e-16 83 32 7 197 3 phnC Phosphonates import ATP-binding protein PhnC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1R0Z6 5.94e-06 51 27 6 213 3 phnC Phosphonates import ATP-binding protein PhnC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q2J3T0 1.94e-16 82 33 7 177 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q0I2Z4 2.1e-16 84 27 7 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q0I2Z4 2.23e-09 62 25 7 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q8KLG1 2.42e-16 83 34 5 171 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8KLG1 4.87e-09 61 29 9 213 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6MU19 2.82e-16 84 26 5 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6MU19 1.6e-08 60 26 6 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q8YUV1 2.84e-16 82 31 10 245 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q93DX8 3.18e-16 82 34 7 180 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q93DX8 1.16e-14 77 31 7 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q39GT7 3.49e-16 82 36 7 168 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GT7 3.86e-08 58 27 6 193 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2SSS4 3.55e-16 83 26 5 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q2SSS4 1.2e-08 60 27 6 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q8DIA0 3.57e-16 83 30 8 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8DIA0 1.6e-11 69 29 6 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q6D734 3.93e-16 83 27 6 193 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D734 3.02e-07 56 22 8 242 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7NX01 3.99e-16 83 30 8 218 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NX01 9.62e-09 60 28 6 228 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q24QI5 4.24e-16 83 30 6 212 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q9Z3I3 4.38e-16 82 34 5 171 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q9Z3I3 7.59e-08 57 29 7 188 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q5UW69 5.49e-16 81 35 7 200 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5UW69 0.00043 45 34 1 78 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P0C0E2 6.28e-16 80 27 5 214 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 6.28e-16 80 27 5 214 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
Q7M8M4 7.39e-16 81 31 9 220 3 phnC Phosphonates import ATP-binding protein PhnC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q7M8M4 1.53e-07 56 27 7 218 3 phnC Phosphonates import ATP-binding protein PhnC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8TQ05 7.45e-16 84 26 16 416 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQ05 5.22e-05 49 29 12 237 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8PUE7 7.7e-16 84 24 16 488 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PUE7 1.59e-06 54 21 8 253 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8U4L3 8.82e-16 80 28 8 239 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U4L3 4.28e-11 67 28 10 247 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8REG7 9.13e-16 80 29 4 179 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q28VN1 1.11e-15 80 28 6 219 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q28VN1 1.13e-12 71 32 7 186 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
O34338 1.19e-15 80 31 8 198 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
O34338 3.24e-09 61 26 6 224 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
Q8D653 1.3e-15 82 27 8 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q8D653 2.83e-12 71 29 6 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q5L222 1.33e-15 82 28 8 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5L222 6.5e-09 61 25 7 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q6GDC0 1.5e-15 83 21 17 530 3 SAR2766 Putative ABC transporter ATP-binding protein SAR2766 Staphylococcus aureus (strain MRSA252)
Q6GDC0 1.63e-07 57 25 12 274 3 SAR2766 Putative ABC transporter ATP-binding protein SAR2766 Staphylococcus aureus (strain MRSA252)
Q14Q07 1.72e-15 81 29 6 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q14Q07 1.92e-08 60 26 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q9CP06 1.86e-15 81 29 4 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q9CP06 7.07e-07 55 25 8 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q21BU8 2e-15 81 30 10 224 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q21BU8 1.85e-10 66 28 9 250 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
P44531 2.1e-15 80 26 7 212 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44531 6.1e-07 55 23 7 224 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q73EL7 2.12e-15 81 29 8 221 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73EL7 4.22e-11 68 26 10 249 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HP89 2.53e-15 80 29 8 221 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HP89 5.1e-11 67 25 9 249 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
A0AGP9 2.66e-15 81 31 7 173 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A0AGP9 2.79e-09 62 25 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q81ZF5 2.72e-15 80 29 8 221 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q81ZF5 8.31e-11 67 25 8 230 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q6D201 2.97e-15 80 30 10 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D201 3.94e-11 68 30 11 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q63GR8 3.12e-15 80 29 8 221 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q63GR8 9.78e-11 67 25 10 249 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q8Y8T6 3.28e-15 80 31 7 173 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y8T6 1.46e-08 60 25 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92DL6 3.31e-15 80 31 7 173 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92DL6 3.92e-09 62 25 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P56344 3.32e-15 78 28 7 230 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
P56344 4.34e-12 69 30 7 230 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q81IN8 3.36e-15 80 29 8 221 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81IN8 2.77e-10 65 25 10 250 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q50966 3.43e-15 80 32 6 208 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q9PDN2 3.78e-15 80 29 7 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q9PDN2 3.47e-08 59 29 7 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q9CM80 3.89e-15 80 28 6 192 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q9CM80 5.82e-07 55 24 7 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q722B1 3.9e-15 80 31 7 173 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q722B1 6.06e-09 61 25 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q8Z0H0 4.04e-15 80 30 8 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8Z0H0 6.36e-10 64 27 8 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q21JQ9 4.12e-15 78 27 7 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8R9L8 4.2e-15 82 25 22 540 3 TTE1589 Putative ABC transporter ATP-binding protein TTE1589 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8R9L8 4.67e-05 50 26 6 183 3 TTE1589 Putative ABC transporter ATP-binding protein TTE1589 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A1TXH7 4.41e-15 80 29 2 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1TXH7 2.23e-09 63 29 9 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q1R155 4.65e-15 78 26 4 218 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1R155 3.44e-11 67 30 7 198 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q57293 5.07e-15 80 28 6 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q57293 5.1e-06 52 24 7 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
P57383 6.56e-15 77 28 7 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57383 1.97e-10 64 27 6 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5HCL3 6.66e-15 81 21 17 530 3 SACOL2708 Putative ABC transporter ATP-binding protein SACOL2708 Staphylococcus aureus (strain COL)
Q5HCL3 4.24e-07 56 24 12 274 3 SACOL2708 Putative ABC transporter ATP-binding protein SACOL2708 Staphylococcus aureus (strain COL)
Q12I82 6.69e-15 77 28 5 195 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q99QV7 6.84e-15 81 21 17 530 3 SAV2684 Putative ABC transporter ATP-binding protein SAV2684 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99QV7 5.4e-07 56 24 12 274 3 SAV2684 Putative ABC transporter ATP-binding protein SAV2684 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A342 6.84e-15 81 21 17 530 3 SA2476 Putative ABC transporter ATP-binding protein SA2476 Staphylococcus aureus (strain N315)
Q7A342 5.4e-07 56 24 12 274 3 SA2476 Putative ABC transporter ATP-binding protein SA2476 Staphylococcus aureus (strain N315)
Q891M1 7e-15 80 22 15 504 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q891M1 3.13e-06 53 23 9 272 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q6N7Y6 7.2e-15 78 35 5 175 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q3SQ65 7.25e-15 78 29 6 215 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q5PBX2 7.58e-15 77 30 4 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Anaplasma marginale (strain St. Maries)
Q5PBX2 8.11e-07 53 25 6 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Anaplasma marginale (strain St. Maries)
Q5GRS1 8.19e-15 77 28 4 180 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q5GRS1 9.18e-08 57 22 3 180 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q1LKJ2 8.51e-15 79 32 4 165 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LKJ2 2.66e-11 68 27 7 239 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q65S66 8.64e-15 79 27 7 214 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65S66 1.07e-05 51 22 7 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
O83590 8.9e-15 77 29 8 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Treponema pallidum (strain Nichols)
O83590 2.2e-09 61 28 7 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Treponema pallidum (strain Nichols)
Q87RE5 9.48e-15 77 30 5 206 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87RE5 1.04e-14 77 28 5 212 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P14788 9.53e-15 79 29 7 215 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P14788 6.16e-11 67 28 7 221 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9V2E4 9.54e-15 77 28 9 253 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q9V2E4 3.45e-08 58 29 9 227 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q1B8V9 1e-14 79 30 3 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
Q1B8V9 7e-06 52 25 7 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 1e-14 79 30 3 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
A1UG51 7e-06 52 25 7 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
O57872 1.08e-14 77 28 7 208 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O57872 2.2e-08 58 29 11 227 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q9KQB8 1.14e-14 77 32 6 186 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KQB8 1.47e-14 77 29 6 215 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q97JB8 1.16e-14 78 30 9 231 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97JB8 2.23e-11 68 26 6 249 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P74548 1.26e-14 79 29 8 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P74548 1.57e-09 63 29 7 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6MCV4 1.3e-14 79 32 6 164 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q6MCV4 1.3e-05 51 27 9 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
A3DDF6 1.3e-14 79 27 4 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A3DDF6 1.96e-07 57 26 6 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q87DT9 1.32e-14 79 29 7 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87DT9 1.9e-08 60 30 8 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q5YZY9 1.4e-14 78 29 6 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q5YZY9 1.53e-08 60 28 6 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
P49938 1.42e-14 77 29 4 212 3 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Bacillus subtilis (strain 168)
P49938 9.86e-07 53 25 6 235 3 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Bacillus subtilis (strain 168)
Q55281 1.44e-14 77 29 9 211 3 mntA Manganese transport system ATP-binding protein MntA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q58762 1.46e-14 78 33 7 189 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58762 3.31e-07 55 29 9 187 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9KS33 1.65e-14 79 29 8 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q65UE1 1.87e-14 78 30 4 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65UE1 7.4e-06 52 25 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q62K82 1.88e-14 78 31 8 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q62K82 2.82e-11 68 30 7 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
O69063 2.07e-14 78 27 11 253 3 htxD Hypophosphite import ATP-binding protein HtxD Stutzerimonas stutzeri
Q63TY1 2.12e-14 78 31 8 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q63TY1 3.06e-11 68 30 7 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q5FQN4 2.16e-14 75 32 6 200 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Gluconobacter oxydans (strain 621H)
Q8RI39 2.17e-14 78 30 9 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8RI39 1.32e-10 67 28 8 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q1RGL1 2.24e-14 76 30 6 189 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q1RGL1 7.16e-14 74 28 7 224 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
P54592 2.4e-14 77 30 8 229 3 yhcH Uncharacterized ABC transporter ATP-binding protein YhcH Bacillus subtilis (strain 168)
P94440 2.48e-14 77 29 7 213 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P94440 1.64e-09 63 27 6 234 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q7NIW1 2.52e-14 77 33 5 162 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7NIW1 7.23e-10 64 29 8 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q73P71 2.54e-14 76 28 9 227 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P71 3.05e-08 58 23 7 248 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q0SK28 2.75e-14 76 31 4 182 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q0SK28 9.16e-12 68 32 7 205 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q9G4F5 2.76e-14 77 29 9 218 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q9G4F5 3.32e-11 68 29 10 249 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q72D73 2.82e-14 76 31 5 212 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72D73 5.5e-10 63 29 5 219 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q7W9U5 2.91e-14 77 28 6 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7W9U5 2.39e-08 59 28 8 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q0I3Y9 2.92e-14 78 30 4 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q0I3Y9 6.18e-07 55 26 8 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q7WGW1 3.19e-14 77 28 6 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7WGW1 9.51e-09 60 28 8 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q2FNX9 3.74e-14 76 28 8 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q2FNX9 3.16e-13 73 28 7 206 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q0I5E9 3.76e-14 77 27 6 216 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q0I5E9 7.44e-11 67 26 10 275 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q74DN5 4.04e-14 75 29 4 199 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q74DN5 1.59e-10 65 29 8 228 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q5X627 4.24e-14 77 26 3 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q5X627 6.53e-11 67 28 8 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q5ZWE4 4.32e-14 77 26 4 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZWE4 7.08e-11 67 28 8 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q07LU3 4.36e-14 76 30 7 218 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisA53)
Q160Y9 4.57e-14 75 28 6 219 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q160Y9 7.55e-13 72 29 5 193 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q7VZE5 4.63e-14 77 29 5 195 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7VZE5 3.04e-08 59 29 8 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q9KD30 4.72e-14 75 29 7 201 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2KBP5 4.73e-14 75 27 5 198 1 bioM Biotin transport ATP-binding protein BioM Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2KBP5 2.1e-10 64 29 10 220 1 bioM Biotin transport ATP-binding protein BioM Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q16BC5 4.97e-14 75 30 10 222 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q16BC5 6.33e-07 54 28 8 222 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q0VTB6 6.2e-14 75 31 7 207 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VTB6 4.86e-11 67 28 7 222 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q6CYU2 6.27e-14 75 28 6 221 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6CYU2 6.52e-05 48 39 3 88 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P42246 6.54e-14 76 29 7 201 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
P42246 2.23e-07 56 23 9 257 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
Q2K8C8 6.62e-14 76 29 8 240 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K8C8 9.3e-09 60 30 10 239 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8UH62 6.94e-14 76 26 5 217 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UH62 1.77e-09 63 26 6 229 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92VJ2 6.96e-14 77 28 5 196 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q92VJ2 5.76e-10 64 29 7 227 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q5E586 7.1e-14 77 29 6 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q92W56 7.82e-14 77 29 8 268 3 araG Arabinose import ATP-binding protein AraG Rhizobium meliloti (strain 1021)
Q92W56 1.7e-10 67 23 17 503 3 araG Arabinose import ATP-binding protein AraG Rhizobium meliloti (strain 1021)
Q85A69 8.23e-14 76 29 3 189 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q85A69 5.11e-11 68 28 4 220 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
D4GSY7 8.24e-14 75 29 6 225 3 HVO_1886 Probable anion import ATP-binding protein HVO_1886 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
D4GSY7 2.23e-08 59 29 6 211 3 HVO_1886 Probable anion import ATP-binding protein HVO_1886 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q5WXF0 8.38e-14 76 26 4 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q5WXF0 3.56e-10 65 28 8 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q6NBT1 8.4e-14 76 28 7 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6NBT1 4.28e-10 65 29 8 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8PNN4 8.72e-14 76 30 7 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q8PNN4 1.4e-05 51 43 2 78 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q89UD2 8.8e-14 76 28 6 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89UD2 4.41e-11 68 29 8 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5SSE9 8.81e-14 78 31 8 215 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
Q5SSE9 9.62e-07 55 23 5 185 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
Q089M3 9.51e-14 73 27 5 187 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shewanella frigidimarina (strain NCIMB 400)
P63396 9.75e-14 77 23 24 617 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63396 6.42e-05 49 25 8 212 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ5 9.75e-14 77 23 24 617 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ5 6.42e-05 49 25 8 212 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ4 9.75e-14 77 23 24 617 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQJ4 6.42e-05 49 25 8 212 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O68106 9.99e-14 75 30 11 244 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O68106 7.88e-09 60 31 9 242 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P54591 1.02e-13 74 27 5 203 3 yhcG Uncharacterized ABC transporter ATP-binding protein YhcG Bacillus subtilis (strain 168)
P54591 1.6e-08 58 28 11 227 3 yhcG Uncharacterized ABC transporter ATP-binding protein YhcG Bacillus subtilis (strain 168)
Q8NUH8 1.02e-13 77 21 17 530 3 MW2603 Putative ABC transporter ATP-binding protein MW2603 Staphylococcus aureus (strain MW2)
Q8NUH8 1.17e-06 55 24 12 274 3 MW2603 Putative ABC transporter ATP-binding protein MW2603 Staphylococcus aureus (strain MW2)
Q6G5Z1 1.02e-13 77 21 17 530 3 SAS2569 Putative ABC transporter ATP-binding protein SAS2569 Staphylococcus aureus (strain MSSA476)
Q6G5Z1 1.17e-06 55 24 12 274 3 SAS2569 Putative ABC transporter ATP-binding protein SAS2569 Staphylococcus aureus (strain MSSA476)
Q88KY4 1.03e-13 74 28 6 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88KY4 6.35e-11 65 27 9 251 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
O07016 1.12e-13 75 32 4 165 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
O07016 2.74e-07 56 25 9 266 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
Q9JZW0 1.19e-13 76 28 8 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JZW0 6.6e-11 67 30 9 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8RD07 1.2e-13 74 31 8 222 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD07 3.87e-12 69 29 6 217 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9K876 1.23e-13 75 29 8 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K876 3.95e-10 65 26 6 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q87H79 1.26e-13 77 22 16 544 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8TQW9 1.28e-13 77 23 14 485 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQW9 1.49e-08 60 25 8 231 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q5NHP2 1.37e-13 73 33 7 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q5NHP2 2.05e-11 67 29 10 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q2A4V5 1.37e-13 73 33 7 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain LVS)
Q2A4V5 2.05e-11 67 29 10 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain LVS)
Q14J44 1.37e-13 73 33 7 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain FSC 198)
Q14J44 2.05e-11 67 29 10 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain FSC 198)
Q8R7Y5 1.39e-13 75 28 7 225 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8R7Y5 2.6e-06 52 25 9 233 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9WXX0 1.51e-13 76 23 18 494 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX0 3.04e-09 63 26 9 254 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX0 3.71e-05 50 21 7 255 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9JUX4 1.59e-13 75 28 8 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JUX4 1.56e-11 69 31 9 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q81GC1 1.6e-13 75 28 3 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GC1 1.38e-10 66 27 7 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81XB3 1.6e-13 73 27 6 228 1 fatE Petrobactin import ATP-binding protein FatE Bacillus anthracis
Q81XB3 0.000426 45 29 3 98 1 fatE Petrobactin import ATP-binding protein FatE Bacillus anthracis
P31060 1.63e-13 76 24 8 350 2 modF ABC transporter ATP-binding protein ModF Escherichia coli (strain K12)
Q03ZL6 1.64e-13 74 30 6 186 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
O84071 1.68e-13 74 28 8 215 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q7VNG4 1.68e-13 75 28 4 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7VNG4 6.5e-06 52 25 7 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9HZL7 1.71e-13 73 29 6 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HZL7 1.97e-13 73 30 8 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q72FW5 1.87e-13 75 26 7 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72FW5 4.72e-05 49 28 9 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q63H62 2.07e-13 74 28 9 248 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q63H62 2.55e-11 68 30 8 215 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q0I3C2 2.07e-13 73 31 6 186 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q0I3C2 7.74e-11 65 28 8 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q88ZJ6 2.11e-13 75 29 4 163 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZJ6 1.33e-08 60 25 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q48QM2 2.14e-13 74 29 7 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q48QM2 3.41e-08 58 27 9 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JJC9 2.14e-13 74 29 7 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JJC9 3.41e-08 58 27 9 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS9429)
P0C0E8 2.14e-13 74 29 7 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M1
P0C0E8 3.41e-08 58 27 9 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M1
Q8NSN2 2.16e-13 75 27 9 269 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NSN2 3.29e-13 74 28 7 222 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P0C0E9 2.2e-13 74 29 7 209 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Streptococcus pyogenes
P0C0E9 3.47e-08 58 27 9 220 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Streptococcus pyogenes
P0CZ29 2.2e-13 74 29 7 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ29 3.47e-08 58 27 9 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain SSI-1)
A2RH11 2.2e-13 74 29 7 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M5 (strain Manfredo)
A2RH11 3.47e-08 58 27 9 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J449 2.2e-13 74 29 7 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1J449 3.47e-08 58 27 9 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JEC8 2.2e-13 74 29 7 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JEC8 3.47e-08 58 27 9 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q7CMM7 2.2e-13 74 29 7 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q7CMM7 3.47e-08 58 27 9 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5X9B5 2.2e-13 74 29 7 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5X9B5 3.47e-08 58 27 9 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ28 2.2e-13 74 29 7 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0CZ28 3.47e-08 58 27 9 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q32EX7 2.45e-13 73 29 8 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q32EX7 2.3e-11 67 28 11 250 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
P44662 2.66e-13 74 29 6 189 3 HI_0361 Probable iron transport system ATP-binding protein HI_0361 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6G1D9 2.72e-13 72 24 6 229 3 BQ02700 Putative ABC transporter ATP-binding protein BQ02700 Bartonella quintana (strain Toulouse)
Q6G1D9 1.24e-09 62 26 10 231 3 BQ02700 Putative ABC transporter ATP-binding protein BQ02700 Bartonella quintana (strain Toulouse)
Q8FV85 2.75e-13 75 26 7 226 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8FV85 5.23e-10 65 27 7 233 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 2.75e-13 75 26 7 226 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YD40 5.23e-10 65 27 7 233 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 2.75e-13 75 26 7 226 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q579H8 5.23e-10 65 27 7 233 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 2.75e-13 75 26 7 226 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q2YIV5 5.23e-10 65 27 7 233 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q6ME20 2.91e-13 74 28 7 215 3 metN Methionine import ATP-binding protein MetN Protochlamydia amoebophila (strain UWE25)
Q6ME20 8.26e-09 61 26 6 212 3 metN Methionine import ATP-binding protein MetN Protochlamydia amoebophila (strain UWE25)
Q6LX68 2.92e-13 73 29 6 216 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q6LX68 4.76e-06 52 25 8 232 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q7VV72 2.97e-13 75 29 8 217 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7VV72 9.9e-05 48 36 1 80 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 2.97e-13 75 29 8 217 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7W4E1 9.9e-05 48 36 1 80 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 2.97e-13 75 29 8 217 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7WFU9 9.9e-05 48 36 1 80 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P94420 2.99e-13 73 27 5 207 1 yclP Petrobactin import ATP-binding protein YclP Bacillus subtilis (strain 168)
P94420 4.9e-10 63 25 5 251 1 yclP Petrobactin import ATP-binding protein YclP Bacillus subtilis (strain 168)
Q5MZ53 3.03e-13 73 27 4 197 3 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q5MZ53 1.88e-08 59 29 6 206 3 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55108 3.03e-13 73 27 4 197 1 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q55108 1.88e-08 59 29 6 206 1 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8TTN2 3.14e-13 75 29 6 203 3 MA_0394 Putative ABC transporter ATP-binding protein MA_0394 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TTN2 5.62e-10 65 29 8 227 3 MA_0394 Putative ABC transporter ATP-binding protein MA_0394 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8E8K8 3.25e-13 74 27 8 216 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8E8K8 1.5e-09 63 28 7 234 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q1J982 3.31e-13 73 28 7 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1J982 3.14e-08 58 27 9 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q0BN75 3.32e-13 72 31 7 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain OSU18)
Q0BN75 2.25e-11 67 29 10 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain OSU18)
Q55740 3.34e-13 73 30 8 219 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55740 1.06e-08 60 26 3 220 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q02SA6 3.65e-13 73 33 5 178 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02SA6 4.91e-08 57 26 9 297 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1QE80 3.69e-13 75 29 6 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QE80 7.55e-08 58 28 7 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P45769 4e-13 72 30 7 226 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q20ZP0 4.1e-13 73 30 9 223 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisB18)
Q20ZP0 6.47e-08 57 29 9 231 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisB18)
Q9HX79 4.12e-13 73 32 5 178 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HX79 1.93e-07 56 26 9 297 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q487I2 4.13e-13 72 27 4 186 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q890D1 4.43e-13 72 27 5 220 2 larO Nickel import ATP-binding protein LarO Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P75957 4.87e-13 72 29 8 214 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
P75957 3.67e-11 66 28 11 250 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q1MBG4 5.26e-13 75 31 4 176 3 araG Arabinose import ATP-binding protein AraG Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MBG4 8.55e-08 58 21 14 519 3 araG Arabinose import ATP-binding protein AraG Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8PC11 5.36e-13 73 28 7 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PC11 1.45e-05 50 43 2 78 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9PKX1 5.5e-13 72 29 8 212 3 TC_0339 Probable metal transport system ATP-binding protein TC_0339 Chlamydia muridarum (strain MoPn / Nigg)
Q3J1N0 5.51e-13 73 30 5 192 3 metN Methionine import ATP-binding protein MetN Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
O65934 5.52e-13 75 28 7 216 1 Rv1747 ABC transporter ATP-binding/permease protein Rv1747 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O65934 5.43e-10 65 29 7 222 1 Rv1747 ABC transporter ATP-binding/permease protein Rv1747 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q6N9W0 5.68e-13 74 32 6 186 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8RHL0 5.69e-13 72 31 5 177 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8RHL0 5.69e-08 57 28 11 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P45171 6.29e-13 73 29 4 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45171 5.57e-06 52 24 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8EK40 6.41e-13 71 27 7 194 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q4QK57 6.58e-13 73 28 4 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q4QK57 6.94e-06 52 24 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
O34314 6.67e-13 72 30 5 192 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
O34314 6.11e-08 57 29 4 197 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
Q4FTM3 7.08e-13 71 31 9 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FTM3 4.14e-12 69 27 7 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
O27739 7.17e-13 73 29 6 208 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O27739 2.17e-09 62 29 11 252 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q81TH8 7.74e-13 73 28 3 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q81TH8 3.84e-11 68 27 7 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q6HPN0 7.81e-13 72 28 6 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HPN0 2.6e-11 68 30 8 215 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 7.81e-13 72 28 6 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
Q81VQ2 2.6e-11 68 30 8 215 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 7.81e-13 72 28 6 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
A0R8K8 2.6e-11 68 30 8 215 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q48C94 7.93e-13 72 29 6 191 3 tauB Taurine import ATP-binding protein TauB Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5WKG4 8.08e-13 72 31 7 186 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q5WKG4 5.09e-10 63 30 5 202 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q63E84 8.26e-13 73 28 3 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q63E84 3.29e-11 68 27 7 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 8.26e-13 73 28 3 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73BM0 3.29e-11 68 27 7 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 8.26e-13 73 28 3 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
A0RBB0 3.29e-11 68 27 7 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q3K9F9 8.3e-13 71 27 6 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q3K9F9 4.21e-12 69 28 6 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q6HLQ9 8.41e-13 73 28 3 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HLQ9 3.12e-11 68 27 7 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q92LX3 8.7e-13 73 29 7 207 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q92LX3 5.01e-09 62 27 7 222 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q8ENB3 8.94e-13 74 21 15 508 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ENB3 1.44e-09 64 27 7 200 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q4K441 9.16e-13 72 28 5 210 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K441 2.06e-06 53 38 1 80 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5JEB0 9.3e-13 73 34 6 176 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5JEB0 3.57e-07 55 27 6 202 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P10091 9.4e-13 73 30 6 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
P10091 1.15e-12 73 29 4 189 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q8GEH7 9.64e-13 72 30 6 192 3 metN Methionine import ATP-binding protein MetN Erwinia pyrifoliae (strain DSM 12162 / Ep1/96)
Q7MKU3 9.94e-13 73 28 7 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q7MKU3 3.47e-07 56 26 8 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 9.94e-13 73 28 7 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q8D9J4 3.47e-07 56 26 8 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q7MFC4 9.99e-13 73 29 7 220 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q7MFC4 1.7e-09 63 25 6 219 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 9.99e-13 73 29 7 220 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q8D3V0 1.7e-09 63 25 6 219 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q72AQ6 1e-12 72 28 10 251 3 phnC Phosphonates import ATP-binding protein PhnC Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72AQ6 0.000122 47 27 9 232 3 phnC Phosphonates import ATP-binding protein PhnC Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q5WJP0 1.02e-12 73 30 7 225 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q5WJP0 8.93e-07 54 26 7 257 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q97KS6 1.02e-12 73 28 5 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KS6 5.68e-07 55 23 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q46RX0 1.02e-12 71 30 5 190 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q4KFA2 1.03e-12 71 26 6 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KFA2 1.41e-11 67 28 6 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
O86311 1.04e-12 72 33 5 162 1 Rv1218c Multidrug efflux system ATP-binding protein Rv1218c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q15TB1 1.04e-12 71 28 5 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q15TB1 1.35e-10 65 28 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q55463 1.07e-12 72 28 6 194 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55463 1.45e-10 65 29 7 219 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0HJG0 1.1e-12 71 33 8 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella sp. (strain MR-4)
Q0HJG0 1.21e-10 65 27 8 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella sp. (strain MR-4)
Q8U6M1 1.23e-12 72 28 8 240 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U6M1 7.51e-08 58 30 13 243 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6N798 1.24e-12 73 29 7 220 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6N798 4.73e-07 55 25 7 251 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q28NZ8 1.29e-12 70 31 5 184 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Jannaschia sp. (strain CCS1)
P44692 1.29e-12 71 27 4 213 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44692 3.11e-08 58 25 6 205 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8G358 1.41e-12 70 30 3 165 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella suis biovar 1 (strain 1330)
Q57FS7 1.41e-12 70 30 3 165 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella abortus biovar 1 (strain 9-941)
Q2YNU0 1.41e-12 70 30 3 165 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella abortus (strain 2308)
Q6FAN3 1.5e-12 72 26 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FAN3 6.1e-11 67 27 9 223 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q830W6 1.53e-12 72 26 7 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q830W6 6.35e-11 67 26 6 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q18C09 1.56e-12 72 27 5 208 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q18C09 7.64e-11 67 26 6 227 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q884I3 1.58e-12 70 27 7 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q884I3 3.03e-12 69 28 7 234 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8YEM5 1.58e-12 70 30 3 165 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q0I074 1.61e-12 70 26 7 194 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shewanella sp. (strain MR-7)
A0A1U9YI12 1.67e-12 74 30 11 264 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
A0A1U9YI12 8.05e-11 68 26 10 264 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
A0A1U9YI12 1.42e-06 55 29 7 190 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
Q3Z300 1.68e-12 70 29 8 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q3Z300 1.27e-10 65 28 11 250 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 1.68e-12 70 29 8 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q1RD37 1.27e-10 65 28 11 250 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 1.68e-12 70 29 8 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FIM7 1.27e-10 65 28 11 250 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 1.68e-12 70 29 8 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TIV6 1.27e-10 65 28 11 250 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8XZP8 1.71e-12 72 28 9 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XZP8 1.7e-11 69 29 6 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9KAG5 1.72e-12 73 22 19 509 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KAG5 1.08e-08 61 23 7 222 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A1TAI4 1.76e-12 72 31 4 166 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A1TAI4 3.12e-06 53 26 6 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q3JKX3 1.81e-12 71 32 5 177 3 tauB Taurine import ATP-binding protein TauB Burkholderia pseudomallei (strain 1710b)
Q3JKX3 3.6e-06 52 28 9 213 3 tauB Taurine import ATP-binding protein TauB Burkholderia pseudomallei (strain 1710b)
Q62AW4 1.81e-12 71 32 5 177 3 tauB Taurine import ATP-binding protein TauB Burkholderia mallei (strain ATCC 23344)
Q62AW4 3.6e-06 52 28 9 213 3 tauB Taurine import ATP-binding protein TauB Burkholderia mallei (strain ATCC 23344)
O83658 1.82e-12 72 28 12 244 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
O83658 1.13e-08 60 31 9 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q2K3Y7 1.85e-12 73 31 4 176 3 araG Arabinose import ATP-binding protein AraG Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K3Y7 1.46e-09 64 22 15 521 3 araG Arabinose import ATP-binding protein AraG Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1WSB8 1.86e-12 71 28 7 215 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ligilactobacillus salivarius (strain UCC118)
Q1WSB8 1.59e-08 59 27 5 200 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ligilactobacillus salivarius (strain UCC118)
Q12298 1.98e-12 73 23 13 381 1 YDR061W Uncharacterized ABC transporter ATP-binding protein YDR061W Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8UCM5 2.05e-12 70 29 8 212 3 hmuV Hemin import ATP-binding protein HmuV Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2JLH7 2.05e-12 71 29 8 222 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q2JLH7 6.97e-08 57 27 7 247 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q578K3 2.05e-12 72 30 7 189 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q578K3 1.27e-08 60 30 9 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 2.05e-12 72 30 7 189 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q2YKX3 1.27e-08 60 30 9 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q1RDS4 2.06e-12 70 29 4 186 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
Q1RDS4 7.58e-05 48 41 1 62 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 2.06e-12 70 29 4 186 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
A1A9L0 7.58e-05 48 41 1 62 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q609Q1 2.09e-12 72 30 5 179 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q609Q1 2.32e-09 62 30 7 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
P63354 2.13e-12 72 26 5 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63354 1.85e-10 66 30 8 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 2.13e-12 72 26 5 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P63353 1.85e-10 66 30 8 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q0TJC1 2.13e-12 70 29 4 186 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TJC1 2.46e-07 55 27 6 202 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q63JZ3 2.15e-12 70 33 6 178 3 tauB Taurine import ATP-binding protein TauB Burkholderia pseudomallei (strain K96243)
Q63JZ3 5.78e-06 51 28 9 213 3 tauB Taurine import ATP-binding protein TauB Burkholderia pseudomallei (strain K96243)
Q927N8 2.16e-12 71 28 10 263 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q927N8 2.22e-06 53 24 7 218 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q03PF2 2.18e-12 72 26 5 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03PF2 1.46e-10 66 26 7 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P45073 2.19e-12 70 30 5 169 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45073 1.23e-09 62 30 7 203 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45022 2.2e-12 70 26 8 224 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45022 2.01e-11 68 27 8 223 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q31VE6 2.26e-12 70 28 8 217 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q31VE6 2.53e-12 70 23 7 263 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
P33594 2.35e-12 70 24 8 265 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
P33594 1.02e-11 68 28 8 213 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q4KBU0 2.38e-12 71 26 6 248 3 metN3 Methionine import ATP-binding protein MetN 3 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0SFW6 2.43e-12 72 28 7 213 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q0SFW6 4.76e-08 58 24 8 274 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q3YW48 2.46e-12 70 24 8 265 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q3YW48 1.28e-11 68 28 8 213 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q0AGF4 2.46e-12 72 32 5 170 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q0AGF4 2.47e-08 59 28 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q8Y454 2.51e-12 70 27 10 260 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y454 1.94e-06 53 24 7 218 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P47426 2.53e-12 71 29 4 196 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47426 1.87e-06 53 35 1 91 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q92XW1 2.55e-12 72 28 5 196 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q92XW1 7.85e-10 64 29 8 228 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q2FVF1 2.57e-12 70 27 7 224 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FVF1 5.03e-07 54 25 8 259 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q0HNQ5 2.63e-12 69 26 7 194 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shewanella sp. (strain MR-4)
Q5LUR8 2.64e-12 70 28 5 228 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LUR8 1.9e-10 65 28 8 244 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1QCN2 2.71e-12 70 30 8 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QCN2 3.21e-12 69 27 7 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P57066 2.72e-12 70 31 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P57066 1.24e-09 62 27 9 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q73F67 2.79e-12 70 27 6 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73F67 1.88e-11 68 30 8 215 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8FZV2 2.87e-12 70 33 7 200 3 BR1368 Putative ABC transporter ATP-binding protein BR1368/BS1330_I1363 Brucella suis biovar 1 (strain 1330)
Q8FZV2 1.33e-09 62 25 6 244 3 BR1368 Putative ABC transporter ATP-binding protein BR1368/BS1330_I1363 Brucella suis biovar 1 (strain 1330)
Q8UA73 2.89e-12 71 29 7 193 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UA73 1.59e-08 60 26 11 256 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6NJ07 2.89e-12 71 29 7 226 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q6NJ07 7.05e-10 64 25 6 235 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
P0C2H2 2.92e-12 73 27 7 237 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli
P0C2H2 2.5e-08 60 28 8 243 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli
P0C2H3 2.92e-12 73 27 7 237 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Escherichia coli O1:K1 / APEC
P0C2H3 2.5e-08 60 28 8 243 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Escherichia coli O1:K1 / APEC
Q3A9G5 2.93e-12 71 26 10 285 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q3A9G5 2.03e-10 65 28 7 219 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q92WJ0 2.95e-12 71 29 4 202 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q92WJ0 1.21e-07 57 31 10 232 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q8FJ95 2.96e-12 70 29 4 186 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FJ95 0.000272 46 40 2 64 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P32010 3.02e-12 71 28 7 240 1 drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA Streptomyces peucetius
P32010 3.44e-05 49 29 12 265 1 drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA Streptomyces peucetius
Q02QT1 3.06e-12 70 27 4 202 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02QT1 2.63e-05 49 38 1 80 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
O66646 3.08e-12 69 33 7 202 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Aquifex aeolicus (strain VF5)
O66646 3.3e-06 52 25 8 220 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Aquifex aeolicus (strain VF5)
Q48KI4 3.08e-12 69 26 7 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48KI4 9.21e-12 68 28 7 234 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q58429 3.09e-12 70 26 6 226 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58429 3.68e-10 64 24 6 197 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q1IKM7 3.2e-12 69 26 5 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Koribacter versatilis (strain Ellin345)
Q1IKM7 8.59e-09 59 30 6 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Koribacter versatilis (strain Ellin345)
A0A0H3JT74 3.28e-12 70 27 7 224 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain Mu50 / ATCC 700699)
A0A0H3JT74 8.1e-08 57 25 8 260 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8FVV5 3.57e-12 71 31 6 174 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q8FVV5 7.51e-08 58 29 10 236 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q3IM24 3.62e-12 70 33 7 192 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q3IM24 0.000185 47 23 4 177 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q9HPH7 3.63e-12 70 30 6 211 3 VNG_1631G Putative ABC transporter ATP-binding protein VNG_1631G Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q9HPH7 1.53e-05 50 26 8 222 3 VNG_1631G Putative ABC transporter ATP-binding protein VNG_1631G Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q4ZV73 3.65e-12 69 26 7 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q4ZV73 8.46e-12 68 28 7 234 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q5WBL0 3.66e-12 70 27 7 233 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q5WBL0 5.37e-06 51 40 1 62 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q65QT6 3.75e-12 71 30 6 221 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65QT6 4.99e-07 55 28 3 163 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8X4L6 3.88e-12 70 27 7 214 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q8X4L6 9.3e-12 69 23 7 263 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q32AQ1 3.95e-12 70 24 8 265 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q32AQ1 5.53e-12 69 28 8 217 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q50294 4.15e-12 70 28 8 195 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q50294 2.52e-07 55 23 7 205 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P9WQL9 4.19e-12 71 29 5 182 1 drrA Doxorubicin resistance ATP-binding protein DrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL8 4.19e-12 71 29 5 182 3 drrA Doxorubicin resistance ATP-binding protein DrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q134N9 4.46e-12 71 32 6 177 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q03ZQ0 4.5e-12 71 27 7 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03ZQ0 8.44e-11 67 28 6 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q668L6 4.64e-12 72 31 7 226 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q668L6 1.4e-08 61 24 9 229 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q3K506 4.81e-12 70 28 5 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q3K506 2.2e-06 53 38 1 80 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
O85818 4.87e-12 71 27 4 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
O85818 7.05e-07 55 26 8 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q48CA0 4.89e-12 70 28 6 208 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48CA0 2.37e-11 68 28 8 227 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q7CJG3 4.94e-12 72 31 7 226 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis
Q7CJG3 1.55e-08 61 24 9 229 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis
Q1C5W7 4.94e-12 72 31 7 226 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C5W7 1.55e-08 61 24 9 229 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q1CJW8 4.94e-12 72 31 7 226 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJW8 1.55e-08 61 24 9 229 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q50293 4.95e-12 70 29 3 184 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q50293 1.24e-06 53 35 1 91 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q44613 5.06e-12 69 28 8 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q44613 2.21e-09 61 25 6 238 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q7MFA1 5.23e-12 69 28 8 237 3 hmuV Hemin import ATP-binding protein HmuV Vibrio vulnificus (strain YJ016)
Q7MFA1 1.05e-10 65 25 6 217 3 hmuV Hemin import ATP-binding protein HmuV Vibrio vulnificus (strain YJ016)
Q93SH7 5.33e-12 69 31 5 174 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q93SH7 6.03e-07 54 30 11 217 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9K6J9 5.53e-12 71 22 19 505 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K6J9 1.89e-09 63 27 5 199 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2YQP3 5.54e-12 69 33 7 200 3 BAB1_1388 Putative ABC transporter ATP-binding protein BAB1_1388 Brucella abortus (strain 2308)
Q2YQP3 1.11e-09 62 25 6 244 3 BAB1_1388 Putative ABC transporter ATP-binding protein BAB1_1388 Brucella abortus (strain 2308)
Q57CD8 5.54e-12 69 33 7 200 3 BruAb1_1365 Putative ABC transporter ATP-binding protein BruAb1_1365 Brucella abortus biovar 1 (strain 9-941)
Q57CD8 1.11e-09 62 25 6 244 3 BruAb1_1365 Putative ABC transporter ATP-binding protein BruAb1_1365 Brucella abortus biovar 1 (strain 9-941)
Q7MIR0 5.58e-12 68 27 3 195 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Vibrio vulnificus (strain YJ016)
Q7MIR0 2.34e-10 63 27 5 217 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Vibrio vulnificus (strain YJ016)
Q2KAW9 5.61e-12 72 22 16 522 3 RHE_CH01212 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1QVQ7 5.93e-12 70 28 9 249 3 metN Methionine import ATP-binding protein MetN Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1QVQ7 2.21e-10 65 29 5 176 3 metN Methionine import ATP-binding protein MetN Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q03I82 6e-12 69 29 10 223 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q03I82 1.95e-09 62 26 7 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q87PH3 6.29e-12 70 27 5 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q1R5D8 6.3e-12 69 24 8 265 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q1R5D8 8.09e-12 69 28 8 217 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 6.3e-12 69 24 8 265 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCM9 8.09e-12 69 28 8 217 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 6.3e-12 69 24 8 265 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBX8 8.09e-12 69 28 8 217 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FRX8 6.3e-12 70 25 7 258 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8FRX8 2.79e-11 68 30 6 202 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q21XJ9 6.32e-12 69 28 9 232 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21XJ9 9.18e-10 63 28 7 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q87UI3 6.34e-12 69 28 6 208 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UI3 1.37e-06 53 38 1 80 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8X8E3 6.51e-12 68 29 8 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q8X8E3 5.32e-10 63 28 11 250 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q1GHY4 6.56e-12 68 28 7 206 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Ruegeria sp. (strain TM1040)
O33570 6.65e-12 68 29 7 183 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
O33570 2.47e-06 52 28 4 180 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P25885 6.7e-12 69 32 5 175 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
P33982 6.74e-12 69 29 4 174 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q8G5P8 6.8e-12 71 27 6 218 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q8G5P8 4.38e-07 55 25 6 223 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q65VG9 7.13e-12 70 26 8 281 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65VG9 1.33e-11 69 26 8 241 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8ENU2 7.23e-12 70 28 7 221 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ENU2 5.59e-06 52 31 1 80 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q3IX40 7.42e-12 70 31 3 163 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IX40 3.21e-07 56 25 5 220 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A0ALT7 7.63e-12 69 27 10 260 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A0ALT7 1.25e-06 53 24 7 218 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q9KL04 7.69e-12 70 30 9 223 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KL04 5.34e-10 65 27 6 201 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A3PRY1 7.76e-12 70 31 3 163 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A3PRY1 1.54e-07 57 25 5 220 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A3CVD3 7.8e-12 69 29 7 224 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A3CVD3 1.09e-11 68 29 8 215 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q8DB62 8.01e-12 68 27 3 195 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Vibrio vulnificus (strain CMCP6)
Q8DB62 2.65e-10 63 27 5 217 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Vibrio vulnificus (strain CMCP6)
Q01937 8.03e-12 70 28 6 212 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q01937 2.05e-08 60 27 7 224 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15355
Feature type CDS
Gene ettA
Product energy-dependent translational throttle protein EttA
Location 55718 - 57385 (strand: -1)
Length 1668 (nucleotides) / 555 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000005
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1210
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF12848 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0488 General function prediction only (R) R ATPase components of ABC transporters with duplicated ATPase domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06020 energy-dependent translational throttle protein EttA - -

Protein Sequence

MAQYVYSMHRVGKIVPPKRHILKNISLSFFPGAKIGVLGLNGAGKSTLLRIMAGVDTDIEGEARPQPGLKIGYLPQEPKLNLEHTVREAVEEAVGEVKHALTRLDEVYALYADPDADFDKLAKEQGELEAIIQSHDGHNLDNQLERAADALRLAPWDSKIANLSGGERRRVAICRLLLEKPDMLLLDEPTNHLDAESVGWLERFLHDYEGTVVAITHDRYFLDNVAGWILELDRGEGIPWEGNYSSWLEQKDARLAQEASSEAARRKSIEKELEWIRQNPKGRQSKGKARLARFDELNSVEYQKRNETNELFIPPGPRLGDKVLEVENLSKSYDDRTLIDNLSFSLPKGAIVGIIGPNGAGKSTLFRMISGQEQPDSGTISLGDTVTIASVDQFRDSMDDKKTVWEEVSGGQDIMRVGTTEIPSRAYVGRFNFKGVDQGKRVGELSGGERGRLHLAKLLQVGGNMLLLDEPTNDLDIETLRALENALLEFPGCAMVISHDRWFLDRIATHIIDYQDEGKVEFFEGNFSEYEDYKKRTLGEAALQPHRMKYKRMTK

Flanking regions ( +/- flanking 50bp)

ATATCATAAACTATTAAATAATTTACTTATTTTTCAAAAAGGTATACACATTGGCTCAATACGTCTATTCGATGCACCGCGTCGGCAAAATCGTGCCACCGAAGCGTCATATACTGAAAAATATTTCACTGAGTTTCTTCCCCGGTGCAAAAATTGGTGTTCTCGGCCTGAACGGTGCCGGTAAATCAACTCTGCTGCGCATCATGGCCGGTGTCGATACCGACATTGAGGGCGAAGCCCGCCCGCAGCCGGGACTGAAAATCGGTTACCTGCCGCAGGAACCGAAACTGAATCTTGAACATACTGTCCGTGAAGCAGTTGAAGAAGCGGTCGGAGAAGTAAAACATGCGCTGACCCGTCTGGATGAAGTGTACGCCCTGTATGCAGATCCTGATGCGGATTTCGACAAGCTTGCCAAAGAGCAGGGTGAGCTGGAAGCCATTATTCAGTCACATGATGGTCATAACCTGGATAACCAGCTGGAACGTGCGGCAGATGCCCTGCGTTTAGCGCCATGGGACTCCAAAATTGCCAATCTGTCCGGGGGTGAACGCCGCCGTGTGGCAATCTGCCGTCTGCTGCTGGAAAAACCGGACATGCTGCTGCTGGATGAACCGACTAACCACCTGGATGCTGAATCTGTTGGTTGGCTGGAGCGCTTCCTGCATGACTATGAAGGTACTGTCGTGGCGATTACCCATGACCGTTACTTCCTGGATAATGTCGCAGGCTGGATCCTGGAACTGGACCGCGGTGAAGGTATTCCGTGGGAAGGTAACTACTCCAGTTGGCTGGAGCAGAAAGATGCGCGCCTGGCACAGGAAGCTTCATCTGAGGCTGCCCGCCGTAAATCTATCGAGAAAGAGCTGGAGTGGATCCGTCAAAATCCGAAAGGCCGTCAGTCCAAAGGTAAGGCGCGTCTGGCCCGCTTTGATGAACTGAACAGTGTCGAATACCAGAAACGCAACGAGACTAACGAACTCTTTATTCCGCCTGGTCCGCGTCTGGGTGACAAAGTGCTGGAAGTGGAAAATCTGAGTAAATCTTACGATGACCGCACCCTGATCGATAACCTGAGTTTCTCTCTGCCGAAAGGTGCGATTGTCGGGATTATCGGACCAAACGGCGCGGGTAAATCGACGCTGTTCCGCATGATAAGCGGTCAGGAACAACCGGATTCCGGCACTATCTCACTGGGTGATACTGTGACTATCGCGTCTGTCGATCAGTTCCGTGATTCCATGGATGATAAGAAAACCGTCTGGGAAGAAGTATCCGGCGGGCAGGATATCATGCGTGTCGGCACAACGGAGATCCCGAGCCGTGCCTACGTCGGACGCTTTAACTTCAAGGGTGTTGACCAGGGCAAACGCGTGGGTGAGTTATCCGGCGGTGAACGTGGTCGTCTGCATCTGGCGAAGCTGTTGCAGGTCGGCGGAAACATGTTGCTGCTCGATGAACCAACCAATGACCTGGATATCGAAACCCTGCGGGCGCTGGAAAATGCCCTGCTGGAGTTCCCGGGCTGCGCCATGGTTATTTCCCATGACCGTTGGTTCCTTGACCGTATCGCCACTCACATCATCGATTATCAGGATGAAGGAAAAGTGGAATTCTTTGAAGGTAACTTCAGCGAATACGAAGACTACAAAAAACGGACACTCGGCGAAGCCGCACTTCAGCCACACCGGATGAAGTACAAGCGTATGACCAAGTAACGGGATGTTCTCAGAAAAGCCGTACCATGAAAATGGCGCGGCTTTTTTAT