Homologs in group_1133

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_09510 EHELCC_09510 100.0 Morganella morganii S2 nhaR transcriptional activator NhaR
NLDBIP_09890 NLDBIP_09890 100.0 Morganella morganii S4 nhaR transcriptional activator NhaR
LHKJJB_07865 LHKJJB_07865 100.0 Morganella morganii S3 nhaR transcriptional activator NhaR
HKOGLL_07415 HKOGLL_07415 100.0 Morganella morganii S5 nhaR transcriptional activator NhaR
F4V73_RS15460 F4V73_RS15460 96.1 Morganella psychrotolerans nhaR transcriptional activator NhaR
PMI_RS00060 PMI_RS00060 87.9 Proteus mirabilis HI4320 nhaR transcriptional activator NhaR

Distribution of the homologs in the orthogroup group_1133

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1133

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9G3 0.0 504 79 0 297 3 nhaR Transcriptional activator protein NhaR Shigella flexneri
P0A9G2 0.0 504 79 0 297 1 nhaR Transcriptional activator protein NhaR Escherichia coli (strain K12)
P52692 5.83e-147 417 67 1 295 3 nhaR Transcriptional activator protein NhaR Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0A4T7 3.89e-11 66 25 8 262 3 pcaQ HTH-type transcriptional regulator PcaQ Rhizobium radiobacter
P0A4T6 3.89e-11 66 25 8 262 3 pcaQ HTH-type transcriptional regulator PcaQ Agrobacterium fabrum (strain C58 / ATCC 33970)
Q47005 3.25e-09 60 24 7 236 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
O32186 9.08e-09 58 27 0 142 3 yusT Uncharacterized HTH-type transcriptional regulator YusT Bacillus subtilis (strain 168)
P77744 4.38e-08 57 23 2 178 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
P48271 6.28e-08 56 38 1 84 3 rbcR Probable RuBisCO transcriptional regulator Cyanophora paradoxa
P25544 1.96e-07 55 25 2 161 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
P27111 2.22e-07 55 24 2 158 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
P14145 3.05e-07 54 29 4 171 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
Q08597 4.38e-07 53 25 2 144 3 nac Nitrogen assimilation regulatory protein nac Klebsiella aerogenes
O34685 4.59e-07 53 24 0 145 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
A0T0G2 7.24e-07 53 24 3 152 3 rbcR Probable RuBisCO transcriptional regulator Phaeodactylum tricornutum (strain CCAP 1055/1)
P52659 1.08e-06 52 30 3 144 3 abaB HTH-type transcriptional regulator AbaB Streptomyces antibioticus
Q44311 1.13e-06 52 26 1 136 3 soxR HTH-type transcriptional regulator SoxR Arthrobacter sp. (strain TE1826)
Q85G62 1.22e-06 52 35 0 74 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
B4TNR5 1.76e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella schwarzengrund (strain CVM19633)
A0T0V5 1.79e-06 52 25 3 149 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
B5FN59 1.92e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella dublin (strain CT_02021853)
B4SYF7 1.98e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella newport (strain SL254)
P0A2Q0 2.03e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q1 2.03e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhi
B5BIR0 2.03e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain AKU_12601)
C0Q2U0 2.03e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi C (strain RKS4594)
A9MXD5 2.03e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJZ0 2.03e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TAZ8 2.03e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella heidelberg (strain SL476)
B5EZ22 2.03e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella agona (strain SL483)
A1JI47 3.86e-06 51 24 2 169 3 hdfR HTH-type transcriptional regulator HdfR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8X4M5 4.93e-06 50 24 2 158 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
P49518 5.94e-06 50 23 2 141 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
Q6B936 8.93e-06 50 32 0 82 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
A7Z5E4 1.07e-05 49 22 0 145 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P20668 1.18e-05 49 24 4 164 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
Q63H01 1.2e-05 49 24 1 144 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ZK / E33L)
Q73EY2 1.2e-05 49 24 1 144 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81VJ1 1.34e-05 49 24 1 144 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
P52665 1.56e-05 47 25 2 144 3 budR HTH-type transcriptional regulator BudR (Fragment) Klebsiella aerogenes
P52661 1.83e-05 49 23 3 182 1 gbpR HTH-type transcriptional regulator GbpR Azospirillum brasilense
Q6HPH4 2.04e-05 48 24 1 144 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81IX0 2.73e-05 48 24 1 144 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q3MCB5 3.28e-05 48 35 0 74 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A0R8S0 3.5e-05 48 24 1 144 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis (strain Al Hakam)
P07774 3.54e-05 48 23 0 142 1 catM HTH-type transcriptional regulator CatM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8YQ82 3.55e-05 48 35 0 74 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q1XDT2 4.13e-05 48 33 0 74 3 rbcR Probable RuBisCO transcriptional regulator Neopyropia yezoensis
P94501 4.4e-05 48 32 0 77 1 gltR HTH-type transcriptional regulator GltR Bacillus subtilis (strain 168)
P51205 4.9e-05 47 33 0 74 3 rbcR Probable RuBisCO transcriptional regulator Porphyra purpurea
P73123 5.53e-05 47 33 0 74 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P71025 5.97e-05 47 22 2 159 3 czcR HTH-type transcriptional regulator CzcR Bacillus subtilis (strain 168)
P0A4T3 6.61e-05 47 19 1 149 1 occR Octopine catabolism/uptake operon regulatory protein OccR Rhizobium radiobacter
P0A4T4 6.61e-05 47 19 1 149 1 occR Octopine catabolism/uptake operon regulatory protein OccR Agrobacterium tumefaciens (strain Ach5)
O68014 7.39e-05 47 23 0 137 1 benM HTH-type transcriptional regulator BenM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P77746 7.7e-05 47 21 4 156 2 ybdO Uncharacterized HTH-type transcriptional regulator YbdO Escherichia coli (strain K12)
P96725 8.37e-05 47 27 2 124 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
P55181 9.18e-05 47 25 7 220 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
Q46M57 0.000101 47 32 0 80 1 tfdR HTH-type transcriptional regulator TdfR Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46M54 0.000102 47 32 0 80 1 tfdS HTH-type transcriptional regulator TfdS Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B1JQ39 0.000133 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G51 0.000133 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRF4 0.000133 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis (strain Pestoides F)
Q1CNN4 0.000133 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8E7 0.000133 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAA7 0.000133 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis
B2JZG4 0.000133 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBT5 0.000133 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD20 0.000133 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q06610 0.000161 46 25 4 159 3 rbcR RuBisCO operon transcriptional regulator Acidithiobacillus ferrooxidans
P16931 0.000164 46 22 3 187 3 dgdR HTH-type transcriptional regulator DgdR Burkholderia cepacia
O78432 0.00018 46 32 0 74 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
P0DV33 0.000186 46 22 2 198 1 admX HTH-type transcriptional regulator AdmX Serratia plymuthica
P42722 0.000192 46 27 3 151 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A2CI69 0.000195 46 28 0 74 3 rbcR Probable RuBisCO transcriptional regulator Chlorokybus atmophyticus
P39592 0.000207 45 32 1 86 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
Q1R4H3 0.000229 45 23 5 162 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain UTI89 / UPEC)
P59369 0.000229 45 23 5 162 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAV4 0.000229 45 23 5 162 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N260 0.000229 45 23 5 162 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O81 (strain ED1a)
B7MGH6 0.000229 45 23 5 162 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O45:K1 (strain S88 / ExPEC)
P37499 0.000271 45 24 2 165 3 yybE Uncharacterized HTH-type transcriptional regulator YybE Bacillus subtilis (strain 168)
Q3YVK2 0.000298 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Shigella sonnei (strain Ss046)
P0A8S0 0.000298 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri
Q0SYV7 0.000298 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri serotype 5b (strain 8401)
Q31UM0 0.000298 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 4 (strain Sb227)
B1LLU0 0.000298 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SMS-3-5 / SECEC)
P0A8R9 0.000298 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12)
B1IWY2 0.000298 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6M0 0.000298 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O9:H4 (strain HS)
B1X9Y2 0.000298 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / DH10B)
C4ZZ35 0.000298 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / MC4100 / BW2952)
B7UMM1 0.000298 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q329U3 0.000321 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Shigella dysenteriae serotype 1 (strain Sd197)
B6I4A0 0.000321 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SE11)
B7M5B2 0.000321 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O8 (strain IAI1)
B5YY14 0.000321 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAW1 0.000321 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7
B7L8A6 0.000321 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain 55989 / EAEC)
A7ZTW7 0.000321 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O139:H28 (strain E24377A / ETEC)
B7LUJ5 0.000323 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
O34701 0.000328 45 21 3 161 3 yoaU Uncharacterized HTH-type transcriptional regulator YoaU Bacillus subtilis (strain 168)
P0ACR4 0.000329 45 20 2 187 1 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli (strain K12)
P0ACR5 0.000329 45 20 2 187 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACR6 0.000329 45 20 2 187 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O157:H7
B7NU32 0.000364 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7NF72 0.000381 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B2TU26 0.000417 45 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P72131 0.000425 45 38 0 76 1 ptxR HTH-type transcriptional regulator PtxR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q05840 0.000518 44 31 0 76 3 clcR HTH-type transcriptional regulator ClcR Pseudomonas putida
Q57083 0.000543 44 27 1 131 1 perR HTH-type transcriptional regulator PerR Escherichia coli (strain K12)
Q1R6S1 0.00067 44 22 4 170 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain UTI89 / UPEC)
Q8FDH0 0.00067 44 22 4 170 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P52662 0.001 43 21 2 174 3 pecT HTH-type transcriptional regulator PecT Dickeya dadantii (strain 3937)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_06465
Feature type CDS
Gene nhaR
Product transcriptional activator NhaR
Location 131992 - 132921 (strand: -1)
Length 930 (nucleotides) / 309 (amino acids)

Contig

Accession contig_6
Length 178871 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1133
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03717 LysR family transcriptional regulator, transcriptional activator of nhaA - -

Protein Sequence

MRVSHLNYNHLYYFWHVCKEGSVVGAAEALYLTPQTITGQIKALEERLDGKLFKRQGRGLVPSELGQLVFRYADKMFMLSQEMLDIVTYSRESNLLFDVGVADALSKRLVSKVLETAVMEHEQIHLRCFESTHEMLLEQLSQHKLDMILSDCPVDSTQQEGLFSVKLGECSMSFYCRQPAPQKPFPECLEERRLLVPGRRSMLGRQLLTWIRNKNLEVEILGEFDDAALMKAFGMYHNAIFVAPSLYTKGIFADSDVVELGTVDTIKEEYYVIFAERMIQHPAVQRVCNKDFSALFSGSQSAADAGLPD

Flanking regions ( +/- flanking 50bp)

ATTTCCGAGTTAATCATCAAAAAAAGATAAGGTATGTACCGGGAAAAACTATGCGAGTCTCCCATTTAAACTACAATCACCTCTATTATTTCTGGCACGTCTGCAAAGAAGGTTCGGTGGTGGGGGCGGCAGAAGCGCTCTATCTCACCCCGCAAACCATTACCGGCCAAATCAAGGCGCTGGAAGAGCGTCTGGACGGTAAGCTGTTCAAACGTCAGGGACGCGGCCTGGTGCCGTCAGAGCTGGGTCAGCTGGTGTTCCGCTATGCGGACAAAATGTTTATGCTGAGCCAGGAAATGCTGGATATTGTCACTTACAGCCGCGAATCCAATCTGTTGTTTGATGTCGGGGTTGCGGACGCACTGTCAAAACGTCTGGTCAGCAAAGTGCTGGAAACGGCGGTGATGGAGCATGAGCAAATCCATCTGCGCTGTTTTGAATCCACTCACGAAATGCTGCTGGAGCAGCTCAGCCAGCACAAACTGGATATGATCCTCTCTGACTGCCCGGTGGATTCCACCCAGCAGGAAGGGCTGTTTTCCGTGAAGCTCGGAGAGTGCAGTATGAGTTTCTACTGCCGCCAGCCCGCGCCGCAGAAGCCGTTCCCGGAATGCCTGGAAGAGCGCCGTCTGCTGGTGCCCGGCCGCCGCTCGATGCTCGGTCGTCAGTTGCTGACCTGGATCCGCAATAAAAACCTGGAGGTGGAAATCCTGGGTGAATTTGATGATGCGGCACTGATGAAAGCATTCGGGATGTATCACAATGCGATTTTTGTGGCGCCGTCGCTCTACACCAAAGGCATTTTTGCGGACAGTGATGTTGTCGAGCTGGGAACGGTGGATACCATCAAAGAAGAGTATTATGTGATTTTTGCCGAGCGTATGATCCAGCATCCGGCGGTTCAGCGGGTGTGTAACAAGGATTTCTCTGCGTTGTTCAGCGGTTCACAGTCGGCTGCGGATGCCGGTTTACCGGACTGAGGCAGAAAAAGGACATAAAAAAACCGGCATCAGCCGGTTTTTTTATGTCT