Homologs in group_1133

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06465 FBDBKF_06465 96.1 Morganella morganii S1 nhaR transcriptional activator NhaR
EHELCC_09510 EHELCC_09510 96.1 Morganella morganii S2 nhaR transcriptional activator NhaR
NLDBIP_09890 NLDBIP_09890 96.1 Morganella morganii S4 nhaR transcriptional activator NhaR
LHKJJB_07865 LHKJJB_07865 96.1 Morganella morganii S3 nhaR transcriptional activator NhaR
HKOGLL_07415 HKOGLL_07415 96.1 Morganella morganii S5 nhaR transcriptional activator NhaR
PMI_RS00060 PMI_RS00060 88.3 Proteus mirabilis HI4320 nhaR transcriptional activator NhaR

Distribution of the homologs in the orthogroup group_1133

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1133

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9G3 0.0 508 79 0 297 3 nhaR Transcriptional activator protein NhaR Shigella flexneri
P0A9G2 0.0 508 79 0 297 1 nhaR Transcriptional activator protein NhaR Escherichia coli (strain K12)
P52692 5.62e-149 422 68 1 295 3 nhaR Transcriptional activator protein NhaR Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0A4T7 4.52e-11 66 25 6 245 3 pcaQ HTH-type transcriptional regulator PcaQ Rhizobium radiobacter
P0A4T6 4.52e-11 66 25 6 245 3 pcaQ HTH-type transcriptional regulator PcaQ Agrobacterium fabrum (strain C58 / ATCC 33970)
Q47005 7.15e-09 59 27 5 174 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
P48271 6.22e-08 56 38 1 84 3 rbcR Probable RuBisCO transcriptional regulator Cyanophora paradoxa
O32186 1.31e-07 55 26 0 142 3 yusT Uncharacterized HTH-type transcriptional regulator YusT Bacillus subtilis (strain 168)
P77744 3.53e-07 54 23 2 178 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
P27111 4.26e-07 53 24 2 158 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
Q08597 6.31e-07 53 25 2 144 3 nac Nitrogen assimilation regulatory protein nac Klebsiella aerogenes
P25544 7.48e-07 53 25 3 163 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
P52659 1.01e-06 53 30 3 144 3 abaB HTH-type transcriptional regulator AbaB Streptomyces antibioticus
O34685 1.01e-06 52 24 0 145 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
Q85G62 1.29e-06 52 35 0 74 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
A1JI47 1.44e-06 52 24 2 169 3 hdfR HTH-type transcriptional regulator HdfR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B5FN59 1.98e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella dublin (strain CT_02021853)
B4SYF7 2.01e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella newport (strain SL254)
B4TNR5 2.05e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella schwarzengrund (strain CVM19633)
P0A2Q0 2.11e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q1 2.11e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhi
B5BIR0 2.11e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain AKU_12601)
C0Q2U0 2.11e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi C (strain RKS4594)
A9MXD5 2.11e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJZ0 2.11e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TAZ8 2.11e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella heidelberg (strain SL476)
B5EZ22 2.11e-06 52 25 3 161 3 hdfR HTH-type transcriptional regulator HdfR Salmonella agona (strain SL483)
P14145 5.22e-06 50 28 4 171 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
A0T0G2 5.58e-06 50 24 3 152 3 rbcR Probable RuBisCO transcriptional regulator Phaeodactylum tricornutum (strain CCAP 1055/1)
Q44311 5.67e-06 50 26 1 136 3 soxR HTH-type transcriptional regulator SoxR Arthrobacter sp. (strain TE1826)
Q8X4M5 7.3e-06 50 23 4 184 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
Q6B936 8.38e-06 50 32 0 82 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
A0T0V5 9.45e-06 50 25 3 149 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
A7Z5E4 1.73e-05 49 21 1 177 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P52665 1.93e-05 47 25 2 144 3 budR HTH-type transcriptional regulator BudR (Fragment) Klebsiella aerogenes
Q3MCB5 2.94e-05 48 35 0 74 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YQ82 3.33e-05 48 35 0 74 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P20668 3.76e-05 48 23 4 168 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
Q1XDT2 4.17e-05 48 33 0 74 3 rbcR Probable RuBisCO transcriptional regulator Neopyropia yezoensis
Q81VJ1 4.19e-05 48 24 1 144 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
Q63H01 4.27e-05 48 24 1 144 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ZK / E33L)
Q73EY2 4.27e-05 48 24 1 144 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 10987 / NRS 248)
P51205 5.18e-05 47 33 0 74 3 rbcR Probable RuBisCO transcriptional regulator Porphyra purpurea
P94501 5.28e-05 47 32 0 77 1 gltR HTH-type transcriptional regulator GltR Bacillus subtilis (strain 168)
P73123 5.53e-05 47 33 0 74 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P77746 5.81e-05 47 20 5 182 2 ybdO Uncharacterized HTH-type transcriptional regulator YbdO Escherichia coli (strain K12)
P0A4T3 6.67e-05 47 19 1 149 1 occR Octopine catabolism/uptake operon regulatory protein OccR Rhizobium radiobacter
P0A4T4 6.67e-05 47 19 1 149 1 occR Octopine catabolism/uptake operon regulatory protein OccR Agrobacterium tumefaciens (strain Ach5)
Q6HPH4 7.1e-05 47 24 1 144 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
P07774 8.52e-05 47 23 0 142 1 catM HTH-type transcriptional regulator CatM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q81IX0 9.75e-05 47 24 1 144 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q46M57 0.000102 47 32 0 80 1 tfdR HTH-type transcriptional regulator TdfR Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46M54 0.000109 46 32 0 80 1 tfdS HTH-type transcriptional regulator TfdS Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B1JQ39 0.00011 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G51 0.00011 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRF4 0.00011 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis (strain Pestoides F)
Q1CNN4 0.00011 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8E7 0.00011 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAA7 0.00011 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis
B2JZG4 0.00011 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBT5 0.00011 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD20 0.00011 46 23 2 166 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A0R8S0 0.000121 46 24 1 144 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis (strain Al Hakam)
P49518 0.000124 46 22 2 141 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
P71025 0.000152 46 22 2 159 3 czcR HTH-type transcriptional regulator CzcR Bacillus subtilis (strain 168)
O78432 0.000173 46 32 0 74 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
A2CI69 0.000193 46 28 0 74 3 rbcR Probable RuBisCO transcriptional regulator Chlorokybus atmophyticus
P39592 0.000233 45 31 1 90 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
P52661 0.000236 45 23 3 182 1 gbpR HTH-type transcriptional regulator GbpR Azospirillum brasilense
P96725 0.000292 45 27 2 124 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
P0ACR4 0.00035 45 21 2 187 1 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli (strain K12)
P0ACR5 0.00035 45 21 2 187 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACR6 0.00035 45 21 2 187 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O157:H7
P72131 0.000519 44 38 0 76 1 ptxR HTH-type transcriptional regulator PtxR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q05840 0.000552 44 31 0 76 3 clcR HTH-type transcriptional regulator ClcR Pseudomonas putida
B7LUJ5 0.000656 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NF72 0.000668 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NU32 0.000674 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q3YVK2 0.000725 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Shigella sonnei (strain Ss046)
P0A8S0 0.000725 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri
Q0SYV7 0.000725 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri serotype 5b (strain 8401)
Q31UM0 0.000725 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 4 (strain Sb227)
B1LLU0 0.000725 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SMS-3-5 / SECEC)
P0A8R9 0.000725 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12)
B1IWY2 0.000725 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6M0 0.000725 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O9:H4 (strain HS)
B1X9Y2 0.000725 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / DH10B)
C4ZZ35 0.000725 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / MC4100 / BW2952)
B7UMM1 0.000725 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q329U3 0.000738 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Shigella dysenteriae serotype 1 (strain Sd197)
B6I4A0 0.000738 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SE11)
B7M5B2 0.000738 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O8 (strain IAI1)
B5YY14 0.000738 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAW1 0.000738 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7
B7L8A6 0.000738 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain 55989 / EAEC)
A7ZTW7 0.000738 44 22 3 161 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O139:H28 (strain E24377A / ETEC)
P55181 0.000763 44 23 6 220 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
P0DV33 0.000781 44 25 4 171 1 admX HTH-type transcriptional regulator AdmX Serratia plymuthica
Q1R4H3 0.000853 43 22 5 162 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain UTI89 / UPEC)
P59369 0.000853 43 22 5 162 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAV4 0.000853 43 22 5 162 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N260 0.000853 43 22 5 162 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O81 (strain ED1a)
B7MGH6 0.000853 43 22 5 162 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O45:K1 (strain S88 / ExPEC)
O34701 0.001 43 21 3 161 3 yoaU Uncharacterized HTH-type transcriptional regulator YoaU Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15460
Feature type CDS
Gene nhaR
Product transcriptional activator NhaR
Location 80662 - 81591 (strand: 1)
Length 930 (nucleotides) / 309 (amino acids)

Contig

Accession term accessions NZ_VXKB01000005 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1133
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03717 LysR family transcriptional regulator, transcriptional activator of nhaA - -

Protein Sequence

MRVSHLNYNHLYYFWHVCKEGSVVGAAEALYLTPQTITGQIKALEERLDGKLFKRQGRGLVPSELGQLVFRYADKMFMLSQEMLDIVTYSRESNLLFDVGVADALSKRLVSKVLETAVVEQEQIHLRCFESTHEMLLEQLSQHKLDMILSDCPVDSTQQEGLFSVKLGECSMSFFCRQPAPQKPFPACLEERRLLVPGRRSMLGRQLLTWIRNKNLEVEILGEFDDAALMKAFGMYHNAIFVAPSLYTNGIFADSDIVELGTVDTIKEEYYVIFAERMIQHPAVQRVCNKDFSALFSGSQSVETGVLLD

Flanking regions ( +/- flanking 50bp)

ATTTCCGAGTTAACCATCATAAAAAGATAAGGTACGTGTCGGGAAAAACTATGCGCGTCTCCCATTTAAACTACAATCACCTCTATTATTTCTGGCATGTCTGCAAAGAAGGCTCTGTGGTGGGGGCGGCAGAAGCCCTTTACCTGACACCGCAGACAATCACCGGACAAATCAAAGCGCTGGAAGAGCGTCTGGATGGCAAACTGTTTAAACGACAGGGCCGGGGACTCGTCCCGTCAGAGCTGGGGCAGTTGGTGTTCCGCTATGCGGATAAAATGTTTATGCTGAGCCAGGAAATGCTGGATATTGTCACCTACAGCCGGGAATCTAATCTGTTGTTTGATGTTGGCGTCGCTGATGCTCTGTCAAAACGACTGGTCAGTAAAGTTCTGGAAACGGCGGTTGTGGAGCAGGAACAAATTCATCTGCGCTGCTTTGAATCTACCCATGAAATGCTGCTCGAACAGCTCAGCCAGCATAAACTGGATATGATTTTGTCTGATTGTCCGGTGGATTCCACTCAGCAGGAAGGGTTATTTTCAGTCAAGCTGGGTGAATGCAGTATGAGCTTTTTCTGCCGTCAGCCCGCACCACAGAAGCCTTTTCCCGCCTGTCTGGAAGAGCGCCGCCTGCTGGTACCCGGCAGGCGTTCCATGCTGGGGCGTCAGTTGCTGACATGGATACGCAATAAAAATCTGGAAGTGGAAATTTTGGGCGAGTTTGATGATGCCGCGCTGATGAAAGCCTTCGGCATGTATCACAATGCCATTTTTGTGGCGCCATCACTCTATACCAACGGAATTTTTGCTGACAGTGACATTGTGGAACTGGGCACGGTGGATACCATCAAAGAAGAGTATTACGTGATTTTTGCAGAGCGGATGATCCAACACCCGGCAGTTCAGCGGGTCTGTAATAAGGATTTCTCTGCACTGTTCAGCGGTTCACAGTCTGTTGAGACGGGTGTTTTGCTCGATTAGACAAAAAAAAGACATAAAAAAACCGGCAAAAGCCGGTTTTTTTATGTCTG