Homologs in group_1106

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_11735 EHELCC_11735 100.0 Morganella morganii S2 ppsR Regulator of PEP synthase PpsR, kinase-PPPase family (combines ADP:protein kinase and phosphorylase activities)
NLDBIP_12075 NLDBIP_12075 100.0 Morganella morganii S4 ppsR Regulator of PEP synthase PpsR, kinase-PPPase family (combines ADP:protein kinase and phosphorylase activities)
LHKJJB_11935 LHKJJB_11935 100.0 Morganella morganii S3 ppsR Regulator of PEP synthase PpsR, kinase-PPPase family (combines ADP:protein kinase and phosphorylase activities)
HKOGLL_10550 HKOGLL_10550 100.0 Morganella morganii S5 ppsR Regulator of PEP synthase PpsR, kinase-PPPase family (combines ADP:protein kinase and phosphorylase activities)
F4V73_RS03470 F4V73_RS03470 96.5 Morganella psychrotolerans - pyruvate, water dikinase regulatory protein
PMI_RS06880 PMI_RS06880 72.1 Proteus mirabilis HI4320 - pyruvate, water dikinase regulatory protein

Distribution of the homologs in the orthogroup group_1106

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1106

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N3T4 4.27e-162 455 78 0 271 3 plu2629 Putative phosphoenolpyruvate synthase regulatory protein Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JPI0 8.12e-158 443 76 0 271 3 YE2177 Putative phosphoenolpyruvate synthase regulatory protein Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7MP11 5.64e-156 439 73 0 275 3 ESA_02103 Putative phosphoenolpyruvate synthase regulatory protein Cronobacter sakazakii (strain ATCC BAA-894)
B1JJ39 9.54e-156 438 75 0 271 3 YPK_1842 Putative phosphoenolpyruvate synthase regulatory protein Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66A13 9.54e-156 438 75 0 271 3 YPTB2319 Putative phosphoenolpyruvate synthase regulatory protein Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TIN3 9.54e-156 438 75 0 271 3 YPDSF_0739 Putative phosphoenolpyruvate synthase regulatory protein Yersinia pestis (strain Pestoides F)
Q1CII7 9.54e-156 438 75 0 271 3 YPN_1864 Putative phosphoenolpyruvate synthase regulatory protein Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZDY4 9.54e-156 438 75 0 271 3 YPO2410 Putative phosphoenolpyruvate synthase regulatory protein Yersinia pestis
B2K5K4 9.54e-156 438 75 0 271 3 YPTS_2394 Putative phosphoenolpyruvate synthase regulatory protein Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C752 9.54e-156 438 75 0 271 3 YPA_1754 Putative phosphoenolpyruvate synthase regulatory protein Yersinia pestis bv. Antiqua (strain Antiqua)
A7FHI3 9.54e-156 438 75 0 271 3 YpsIP31758_1736 Putative phosphoenolpyruvate synthase regulatory protein Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q6D636 3.99e-153 431 74 0 271 3 ECA1852 Putative phosphoenolpyruvate synthase regulatory protein Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B7NTS8 1.32e-152 430 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q3Z250 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Shigella sonnei (strain Ss046)
P0A8A7 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Shigella flexneri
Q0T4R2 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Shigella flexneri serotype 5b (strain 8401)
Q32FJ7 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Shigella dysenteriae serotype 1 (strain Sd197)
Q1RB92 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli (strain UTI89 / UPEC)
B1LE27 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli (strain SMS-3-5 / SECEC)
B6I8Q8 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli (strain SE11)
P0A8A4 4.96e-152 429 72 0 275 1 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli (strain K12)
B1IQ53 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8A5 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1ABP0 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli O1:K1 / APEC
A8A0P5 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli O9:H4 (strain HS)
B1XG10 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli (strain K12 / DH10B)
C4ZYG5 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli (strain K12 / MC4100 / BW2952)
B7M1B1 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli O8 (strain IAI1)
B7MVI2 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli O81 (strain ED1a)
B5YPZ1 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A8A6 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli O157:H7
B7L6H6 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli (strain 55989 / EAEC)
B7MAR4 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli O45:K1 (strain S88 / ExPEC)
B7US42 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZMH0 4.96e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli O139:H28 (strain E24377A / ETEC)
B7N541 5.13e-152 429 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0THC5 5.92e-152 428 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7LQ85 1.03e-151 428 73 0 271 3 ppsR Phosphoenolpyruvate synthase regulatory protein Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q321G0 2.23e-151 427 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Shigella boydii serotype 4 (strain Sb227)
B2U2K8 2.23e-151 427 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P67197 4.16e-151 426 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67198 4.16e-151 426 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella typhi
B4TUG5 4.16e-151 426 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella schwarzengrund (strain CVM19633)
B5BA27 4.16e-151 426 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella paratyphi A (strain AKU_12601)
C0Q632 4.16e-151 426 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella paratyphi C (strain RKS4594)
A9N171 4.16e-151 426 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PH77 4.16e-151 426 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T4P3 4.16e-151 426 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella newport (strain SL254)
B4TGI5 4.16e-151 426 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella heidelberg (strain SL476)
B5QVV3 4.16e-151 426 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella enteritidis PT4 (strain P125109)
B5FJ93 4.16e-151 426 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella dublin (strain CT_02021853)
Q57PT8 4.16e-151 426 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella choleraesuis (strain SC-B67)
B5F7E7 4.16e-151 426 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella agona (strain SL483)
A8AH93 6.24e-151 426 72 0 275 3 CKO_01727 Putative phosphoenolpyruvate synthase regulatory protein Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4W9P3 6.3e-151 426 72 0 275 3 Ent638_1744 Putative phosphoenolpyruvate synthase regulatory protein Enterobacter sp. (strain 638)
B5XQE5 7.51e-151 426 72 0 271 3 KPK_2157 Putative phosphoenolpyruvate synthase regulatory protein Klebsiella pneumoniae (strain 342)
B5RAV8 1.4e-150 425 72 0 275 3 ppsR Phosphoenolpyruvate synthase regulatory protein Salmonella gallinarum (strain 287/91 / NCTC 13346)
A6TAG8 6.64e-150 423 72 0 271 3 KPN78578_21280 Putative phosphoenolpyruvate synthase regulatory protein Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
O54458 8.51e-147 416 67 0 281 3 ydiA Putative phosphoenolpyruvate synthase regulatory protein Enterobacter agglomerans
B2VK01 5.66e-143 405 69 0 271 3 ETA_18250 Putative phosphoenolpyruvate synthase regulatory protein Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NT22 1.38e-140 399 67 0 271 3 SG1428 Putative phosphoenolpyruvate synthase regulatory protein Sodalis glossinidius (strain morsitans)
A8H5N3 1.06e-117 341 60 2 271 3 Spea_2550 Putative phosphoenolpyruvate synthase regulatory protein Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A1S7C2 9.84e-117 339 59 2 271 3 Sama_2073 Putative phosphoenolpyruvate synthase regulatory protein Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q081C1 1.68e-116 338 58 1 272 3 Sfri_2298 Putative phosphoenolpyruvate synthase regulatory protein Shewanella frigidimarina (strain NCIMB 400)
Q12MN3 1.26e-115 336 59 2 269 3 Sden_2010 Putative phosphoenolpyruvate synthase regulatory protein Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B8CLG1 4.32e-115 335 58 2 271 3 swp_1850 Putative phosphoenolpyruvate synthase regulatory protein Shewanella piezotolerans (strain WP3 / JCM 13877)
B0TPZ1 4.37e-115 335 58 1 271 3 Shal_1704 Putative phosphoenolpyruvate synthase regulatory protein Shewanella halifaxensis (strain HAW-EB4)
A1RIV6 7.15e-115 334 57 1 269 3 Sputw3181_1764 Putative phosphoenolpyruvate synthase regulatory protein Shewanella sp. (strain W3-18-1)
A4Y7N2 7.15e-115 334 57 1 269 3 Sputcn32_2244 Putative phosphoenolpyruvate synthase regulatory protein Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A9L4I0 7.47e-115 334 57 1 269 3 Sbal195_2602 Putative phosphoenolpyruvate synthase regulatory protein Shewanella baltica (strain OS195)
A6WP80 7.47e-115 334 57 1 269 3 Shew185_2482 Putative phosphoenolpyruvate synthase regulatory protein Shewanella baltica (strain OS185)
A3D5G9 7.47e-115 334 57 1 269 3 Sbal_2489 Putative phosphoenolpyruvate synthase regulatory protein Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E794 7.47e-115 334 57 1 269 3 Sbal223_1862 Putative phosphoenolpyruvate synthase regulatory protein Shewanella baltica (strain OS223)
Q0HW44 1.61e-114 333 57 1 269 3 Shewmr7_1666 Putative phosphoenolpyruvate synthase regulatory protein Shewanella sp. (strain MR-7)
Q0HJU9 1.61e-114 333 57 1 269 3 Shewmr4_1591 Putative phosphoenolpyruvate synthase regulatory protein Shewanella sp. (strain MR-4)
A0KVZ9 1.61e-114 333 57 1 269 3 Shewana3_1735 Putative phosphoenolpyruvate synthase regulatory protein Shewanella sp. (strain ANA-3)
Q8EDU8 1.77e-114 333 57 1 269 3 SO_2645 Putative phosphoenolpyruvate synthase regulatory protein Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A8FUF8 5.06e-114 332 56 1 271 3 Ssed_1870 Putative phosphoenolpyruvate synthase regulatory protein Shewanella sediminis (strain HAW-EB3)
B1KIE1 1.11e-113 331 56 2 272 3 Swoo_2716 Putative phosphoenolpyruvate synthase regulatory protein Shewanella woodyi (strain ATCC 51908 / MS32)
A3QD67 7.44e-113 329 56 2 272 3 Shew_1548 Putative phosphoenolpyruvate synthase regulatory protein Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q6LRB9 3.34e-110 323 56 1 270 3 PBPRA1750 Putative phosphoenolpyruvate synthase regulatory protein Photobacterium profundum (strain SS9)
A0KLP9 1.64e-107 315 54 1 270 3 AHA_2692 Putative phosphoenolpyruvate synthase regulatory protein Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SNV2 6.45e-106 311 53 1 270 3 ASA_2545 Putative phosphoenolpyruvate synthase regulatory protein Aeromonas salmonicida (strain A449)
B4RRY0 1e-103 306 55 2 272 3 MADE_1008595 Putative phosphoenolpyruvate synthase regulatory protein Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q15V24 3.03e-100 297 53 2 272 3 Patl_1743 Putative phosphoenolpyruvate synthase regulatory protein Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q3ICL0 8.44e-99 293 50 1 271 3 PSHAb0558 Putative phosphoenolpyruvate synthase regulatory protein Pseudoalteromonas translucida (strain TAC 125)
Q7MF05 1.86e-97 290 49 1 275 3 VVA0515 Putative phosphoenolpyruvate synthase regulatory protein Vibrio vulnificus (strain YJ016)
Q8D7Y9 1.86e-97 290 49 1 275 3 VV2_0006 Putative phosphoenolpyruvate synthase regulatory protein Vibrio vulnificus (strain CMCP6)
A7N4V5 8.28e-95 283 47 1 275 3 VIBHAR_06516 Putative phosphoenolpyruvate synthase regulatory protein Vibrio campbellii (strain ATCC BAA-1116)
Q3KFE4 2.11e-94 282 50 2 271 3 Pfl01_1769 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas fluorescens (strain Pf0-1)
Q87J80 3.65e-94 282 48 1 275 3 VPA0373 Putative phosphoenolpyruvate synthase regulatory protein Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5ZVB2 7.4e-94 281 47 2 271 3 lpg1528 Putative phosphoenolpyruvate synthase regulatory protein Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IC23 7.4e-94 281 47 2 271 3 LPC_0949 Putative phosphoenolpyruvate synthase regulatory protein Legionella pneumophila (strain Corby)
Q5WWF5 1.04e-93 281 47 2 271 3 lpl1498 Putative phosphoenolpyruvate synthase regulatory protein Legionella pneumophila (strain Lens)
Q47ZQ7 1.59e-93 280 48 1 271 3 CPS_3013 Putative phosphoenolpyruvate synthase regulatory protein Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q5X535 1.71e-93 280 47 2 271 3 lpp1485 Putative phosphoenolpyruvate synthase regulatory protein Legionella pneumophila (strain Paris)
A4VL58 6.21e-93 278 49 2 271 3 PST_2038 Putative phosphoenolpyruvate synthase regulatory protein Stutzerimonas stutzeri (strain A1501)
C3K116 6.7e-93 278 49 2 271 3 PFLU_4621 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas fluorescens (strain SBW25)
Q4ZUP0 7.15e-93 278 49 2 271 3 Psyr_2089 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas syringae pv. syringae (strain B728a)
Q9I2X0 1.83e-92 278 49 2 271 3 PA1769 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02KR0 1.83e-92 278 49 2 271 3 PA14_41680 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas aeruginosa (strain UCBPP-PA14)
B7VBB0 1.83e-92 278 49 2 271 3 PLES_35601 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas aeruginosa (strain LESB58)
B1J593 4.56e-92 276 49 2 271 3 PputW619_1599 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas putida (strain W619)
Q48JZ6 4.82e-92 276 49 2 271 3 PSPPH_2060 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1ICM7 7.21e-92 276 49 2 271 3 PSEEN1741 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas entomophila (strain L48)
A1U1U7 1.58e-91 275 49 2 269 3 Maqu_1884 Putative phosphoenolpyruvate synthase regulatory protein Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q883Q9 5.72e-91 274 49 2 271 3 PSPTO_2291 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B0KG76 5.72e-91 274 49 2 271 3 PputGB1_1592 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas putida (strain GB-1)
Q4KFJ6 7.36e-91 273 49 2 271 3 PFL_1868 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5QZ06 7.51e-91 273 48 2 272 3 IL1317 Putative phosphoenolpyruvate synthase regulatory protein Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
C3LWP9 1.02e-90 273 48 1 271 3 VCM66_A0945 Putative phosphoenolpyruvate synthase regulatory protein Vibrio cholerae serotype O1 (strain M66-2)
Q9KKW4 1.02e-90 273 48 1 271 3 VC_A0986 Putative phosphoenolpyruvate synthase regulatory protein Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F0Z4 1.02e-90 273 48 1 271 3 VC0395_0252 Putative phosphoenolpyruvate synthase regulatory protein Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B7VSY8 6.37e-90 271 46 1 273 3 VS_II1224 Putative phosphoenolpyruvate synthase regulatory protein Vibrio atlanticus (strain LGP32)
C1DHB9 7.02e-90 271 49 2 271 3 Avin_23260 Putative phosphoenolpyruvate synthase regulatory protein Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A4XU29 7.34e-90 271 47 2 271 3 Pmen_2084 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas mendocina (strain ymp)
A5W6M3 1.11e-89 270 48 2 271 3 Pput_3659 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88L54 2.18e-89 270 48 2 271 3 PP_2081 Putative phosphoenolpyruvate synthase regulatory protein Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1QVU4 1.82e-87 265 49 3 275 3 Csal_2063 Putative phosphoenolpyruvate synthase regulatory protein Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
C5CUN7 2.24e-87 265 50 2 273 3 Vapar_1815 Putative phosphoenolpyruvate synthase regulatory protein Variovorax paradoxus (strain S110)
Q6F9R8 5.65e-87 264 48 2 271 3 ACIAD2422 Putative phosphoenolpyruvate synthase regulatory protein Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0V7F2 7.66e-87 263 47 2 271 3 ABAYE1392 Putative phosphoenolpyruvate synthase regulatory protein Acinetobacter baumannii (strain AYE)
A3M6P6 7.66e-87 263 47 2 271 3 A1S_2163 Putative phosphoenolpyruvate synthase regulatory protein Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VM18 7.66e-87 263 47 2 271 3 ABSDF1578 Putative phosphoenolpyruvate synthase regulatory protein Acinetobacter baumannii (strain SDF)
B7IBB3 7.66e-87 263 47 2 271 3 AB57_2500 Putative phosphoenolpyruvate synthase regulatory protein Acinetobacter baumannii (strain AB0057)
B7H0K8 7.66e-87 263 47 2 271 3 ABBFA_001301 Putative phosphoenolpyruvate synthase regulatory protein Acinetobacter baumannii (strain AB307-0294)
Q2SK73 2.8e-86 262 46 2 271 3 HCH_02122 Putative phosphoenolpyruvate synthase regulatory protein Hahella chejuensis (strain KCTC 2396)
Q0VPM2 2.32e-85 259 47 2 271 3 ABO_1428 Putative phosphoenolpyruvate synthase regulatory protein Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0A7F4 2.39e-85 259 46 1 271 3 Mlg_1889 Putative phosphoenolpyruvate synthase regulatory protein Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q7NRS0 3.68e-84 256 46 2 271 3 CV_3710 Putative phosphoenolpyruvate synthase regulatory protein Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2L142 9.86e-83 253 45 2 269 3 BAV1750 Putative phosphoenolpyruvate synthase regulatory protein Bordetella avium (strain 197N)
Q470F3 2.41e-82 253 45 1 269 3 Reut_A1865 Putative phosphoenolpyruvate synthase regulatory protein Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q47F76 3.72e-82 251 44 2 267 3 Daro_1758 Putative phosphoenolpyruvate synthase regulatory protein Dechloromonas aromatica (strain RCB)
A6SZN5 5.02e-82 251 44 1 268 3 mma_2042 Putative phosphoenolpyruvate synthase regulatory protein Janthinobacterium sp. (strain Marseille)
A4G4T7 9.24e-82 251 42 1 279 3 HEAR1351 Putative phosphoenolpyruvate synthase regulatory protein Herminiimonas arsenicoxydans
Q9K0I1 1.36e-81 250 45 2 271 3 NMB0619 Putative phosphoenolpyruvate synthase regulatory protein Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1KSM7 1.58e-81 249 45 2 271 3 NMC0562 Putative phosphoenolpyruvate synthase regulatory protein Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JVI4 1.58e-81 249 45 2 271 3 NMA0827 Putative phosphoenolpyruvate synthase regulatory protein Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M2P6 1.58e-81 249 45 2 271 3 NMCC_0567 Putative phosphoenolpyruvate synthase regulatory protein Neisseria meningitidis serogroup C (strain 053442)
Q2SWY2 2.32e-81 249 44 1 270 3 BTH_I2043 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B4RJM3 2.91e-81 249 45 2 271 3 NGK_0333 Putative phosphoenolpyruvate synthase regulatory protein Neisseria gonorrhoeae (strain NCCP11945)
Q5FA32 2.91e-81 249 45 2 271 3 NGO0202 Putative phosphoenolpyruvate synthase regulatory protein Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
C1DCN2 1.05e-80 248 45 5 275 3 LHK_02669 Putative phosphoenolpyruvate synthase regulatory protein Laribacter hongkongensis (strain HLHK9)
Q7VYB4 1.21e-80 248 45 2 269 3 BP1435 Putative phosphoenolpyruvate synthase regulatory protein Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A9AIN0 1.7e-80 247 44 1 270 3 Bmul_1273 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia multivorans (strain ATCC 17616 / 249)
Q63T28 2.13e-80 247 43 1 270 3 BPSL2143 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia pseudomallei (strain K96243)
A3NAT0 2.13e-80 247 43 1 270 3 BURPS668_2420 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia pseudomallei (strain 668)
Q3JR45 2.13e-80 247 43 1 270 3 BURPS1710b_2566 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia pseudomallei (strain 1710b)
A3NWL4 2.13e-80 247 43 1 270 3 BURPS1106A_2476 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia pseudomallei (strain 1106a)
A1V552 2.13e-80 247 43 1 270 3 BMASAVP1_A2039 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia mallei (strain SAVP1)
Q62JE0 2.13e-80 247 43 1 270 3 BMA1539 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia mallei (strain ATCC 23344)
A2SB89 2.13e-80 247 43 1 270 3 BMA10229_A3272 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia mallei (strain NCTC 10229)
A3MKS6 2.13e-80 247 43 1 270 3 BMA10247_1311 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia mallei (strain NCTC 10247)
Q8XZH5 2.67e-80 247 42 1 271 3 RSc1420 Putative phosphoenolpyruvate synthase regulatory protein Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q21WD9 3.92e-80 246 46 2 265 3 Rfer_2190 Putative phosphoenolpyruvate synthase regulatory protein Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q7WA44 4.18e-80 246 44 2 269 3 BPP1543 Putative phosphoenolpyruvate synthase regulatory protein Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WJ78 4.18e-80 246 44 2 269 3 BB2621 Putative phosphoenolpyruvate synthase regulatory protein Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q0BE31 5.94e-80 246 43 1 270 3 Bamb_2036 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YS58 5.94e-80 246 43 1 270 3 BamMC406_1905 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia ambifaria (strain MC40-6)
Q0KA32 8.9e-80 245 43 1 266 3 H16_A2039 Putative phosphoenolpyruvate synthase regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1LNE1 9.28e-80 245 43 1 268 3 Rmet_1452 Putative phosphoenolpyruvate synthase regulatory protein Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A1WJJ2 9.46e-80 245 46 2 274 3 Veis_2049 Putative phosphoenolpyruvate synthase regulatory protein Verminephrobacter eiseniae (strain EF01-2)
B4EC82 9.48e-80 245 43 1 270 3 BceJ2315_20370 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q1BHG6 1.4e-79 244 43 1 270 3 Bcen_6074 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia orbicola (strain AU 1054)
B1JUD4 1.4e-79 244 43 1 270 3 Bcenmc03_2023 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia orbicola (strain MC0-3)
A0K8C7 1.4e-79 244 43 1 270 3 Bcen2424_2003 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia cenocepacia (strain HI2424)
A5EVB6 8.25e-79 243 43 1 269 3 DNO_0628 Putative phosphoenolpyruvate synthase regulatory protein Dichelobacter nodosus (strain VCS1703A)
B2T5H8 1.05e-78 242 43 1 267 3 Bphyt_2439 Putative phosphoenolpyruvate synthase regulatory protein Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q1QBY7 1.46e-78 242 45 2 271 3 Pcryo_1035 Putative phosphoenolpyruvate synthase regulatory protein Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FS24 1.46e-78 242 45 2 271 3 Psyc_1334 Putative phosphoenolpyruvate synthase regulatory protein Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q13XD2 1.83e-78 242 43 1 270 3 Bxeno_A2719 Putative phosphoenolpyruvate synthase regulatory protein Paraburkholderia xenovorans (strain LB400)
Q5NZS9 2.05e-78 242 45 3 273 3 AZOSEA33100 Putative phosphoenolpyruvate synthase regulatory protein Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q39F59 2.64e-78 241 42 1 270 3 Bcep18194_A5313 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A1VPX9 4.45e-78 241 46 2 265 3 Pnap_2400 Putative phosphoenolpyruvate synthase regulatory protein Polaromonas naphthalenivorans (strain CJ2)
Q128T5 8e-78 240 46 2 265 3 Bpro_3043 Putative phosphoenolpyruvate synthase regulatory protein Polaromonas sp. (strain JS666 / ATCC BAA-500)
A1K7I0 1.36e-77 240 45 3 270 3 azo2168 Putative phosphoenolpyruvate synthase regulatory protein Azoarcus sp. (strain BH72)
A1WTK1 2.45e-77 239 46 2 273 3 Hhal_0219 Putative phosphoenolpyruvate synthase regulatory protein Halorhodospira halophila (strain DSM 244 / SL1)
A2SFZ3 6.53e-77 238 44 1 271 3 Mpe_A1520 Putative phosphoenolpyruvate synthase regulatory protein Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B1XXH9 6.59e-77 238 44 2 272 3 Lcho_2834 Putative phosphoenolpyruvate synthase regulatory protein Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A4JF59 7.28e-77 238 42 1 270 3 Bcep1808_1909 Putative phosphoenolpyruvate synthase regulatory protein Burkholderia vietnamiensis (strain G4 / LMG 22486)
A1W9U6 1.69e-76 237 46 2 264 3 Ajs_2880 Putative phosphoenolpyruvate synthase regulatory protein Acidovorax sp. (strain JS42)
B9MC99 1.69e-76 237 46 2 264 3 Dtpsy_2367 Putative phosphoenolpyruvate synthase regulatory protein Acidovorax ebreus (strain TPSY)
Q5H0Q5 4.98e-76 236 43 3 272 3 XOO2212 Putative phosphoenolpyruvate synthase regulatory protein Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3P2 4.98e-76 236 43 3 272 3 XOO2080 Putative phosphoenolpyruvate synthase regulatory protein Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A1TLY4 3.76e-75 233 45 3 275 3 Aave_1381 Putative phosphoenolpyruvate synthase regulatory protein Paracidovorax citrulli (strain AAC00-1)
Q1GZ66 5.45e-75 233 45 4 271 3 Mfla_2204 Putative phosphoenolpyruvate synthase regulatory protein Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q3BTH9 1.24e-74 232 43 3 272 3 XCV2203 Putative phosphoenolpyruvate synthase regulatory protein Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PKW5 1.24e-74 232 43 3 272 3 XAC2042 Putative phosphoenolpyruvate synthase regulatory protein Xanthomonas axonopodis pv. citri (strain 306)
Q87E04 8.31e-74 230 43 3 272 3 PD_0525 Putative phosphoenolpyruvate synthase regulatory protein Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I916 8.31e-74 230 43 3 272 3 XfasM23_0549 Putative phosphoenolpyruvate synthase regulatory protein Xylella fastidiosa (strain M23)
B0RSD4 2.09e-73 229 42 3 272 3 xcc-b100_2016 Putative phosphoenolpyruvate synthase regulatory protein Xanthomonas campestris pv. campestris (strain B100)
Q4UVA7 2.09e-73 229 42 3 272 3 XC_1953 Putative phosphoenolpyruvate synthase regulatory protein Xanthomonas campestris pv. campestris (strain 8004)
B0U5U4 9.99e-73 227 42 3 272 3 Xfasm12_0594 Putative phosphoenolpyruvate synthase regulatory protein Xylella fastidiosa (strain M12)
Q8P8S4 1.2e-72 227 42 3 272 3 XCC2165 Putative phosphoenolpyruvate synthase regulatory protein Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9PDW9 2.11e-72 226 42 3 272 3 XF_1260 Putative phosphoenolpyruvate synthase regulatory protein Xylella fastidiosa (strain 9a5c)
A9BMZ9 1.08e-71 224 43 2 264 3 Daci_5065 Putative phosphoenolpyruvate synthase regulatory protein Delftia acidovorans (strain DSM 14801 / SPH-1)
B2FJE7 1.52e-71 224 41 3 272 3 Smlt2974 Putative phosphoenolpyruvate synthase regulatory protein Stenotrophomonas maltophilia (strain K279a)
B4SMR2 1.85e-71 224 41 3 272 3 Smal_2421 Putative phosphoenolpyruvate synthase regulatory protein Stenotrophomonas maltophilia (strain R551-3)
Q83WU4 5.3e-69 218 41 2 265 3 None Putative phosphoenolpyruvate synthase regulatory protein Thiocapsa roseopersicina
Q2YAC1 4.23e-67 213 40 3 274 3 Nmul_A0997 Putative phosphoenolpyruvate synthase regulatory protein Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q81ZK5 3.5e-65 208 42 2 270 3 NE2358 Putative phosphoenolpyruvate synthase regulatory protein Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0AHQ0 1.78e-62 201 40 2 272 3 Neut_0869 Putative phosphoenolpyruvate synthase regulatory protein Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q1J0R0 1.03e-57 189 40 3 266 3 Dgeo_0622 Putative phosphoenolpyruvate synthase regulatory protein Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q3SL47 1.33e-57 188 41 3 260 3 Tbd_0617 Putative phosphoenolpyruvate synthase regulatory protein Thiobacillus denitrificans (strain ATCC 25259)
Q9RTN2 1.73e-57 188 39 3 271 3 DR_1728 Putative phosphoenolpyruvate synthase regulatory protein Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q6AK68 2.46e-37 136 29 6 271 3 DP2529 Putative phosphoenolpyruvate synthase regulatory protein Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B5E9X5 1.04e-29 116 32 10 275 3 Gbem_0242 Putative pyruvate, phosphate dikinase regulatory protein Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
C6DY36 2.73e-29 115 31 10 275 3 GM21_0226 Putative pyruvate, phosphate dikinase regulatory protein Geobacter sp. (strain M21)
Q5HBX0 1.12e-26 108 30 8 273 3 Erum2050 Putative pyruvate, phosphate dikinase regulatory protein Ehrlichia ruminantium (strain Welgevonden)
Q5FFG2 1.68e-26 107 30 8 273 3 ERGA_CDS_02020 Putative pyruvate, phosphate dikinase regulatory protein Ehrlichia ruminantium (strain Gardel)
Q03SD6 5.6e-26 106 29 9 278 3 LVIS_0743 Putative pyruvate, phosphate dikinase regulatory protein Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q5PBC5 9.66e-26 105 28 11 282 3 AM316 Putative pyruvate, phosphate dikinase regulatory protein Anaplasma marginale (strain St. Maries)
Q4FNS3 1.09e-25 105 29 10 285 3 SAR11_0343 Putative pyruvate, phosphate dikinase regulatory protein Pelagibacter ubique (strain HTCC1062)
B9KHZ9 2.3e-25 105 28 11 282 3 AMF_235 Putative pyruvate, phosphate dikinase regulatory protein Anaplasma marginale (strain Florida)
B9LZ47 2.48e-25 104 29 11 273 3 Geob_0410 Putative pyruvate, phosphate dikinase regulatory protein Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q3YSP8 3.2e-25 104 28 9 272 3 Ecaj_0207 Putative pyruvate, phosphate dikinase regulatory protein Ehrlichia canis (strain Jake)
A7GSZ1 4.38e-25 103 27 8 284 3 Bcer98_3022 Putative pyruvate, phosphate dikinase regulatory protein Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q2GFU3 4.64e-25 103 28 9 274 3 ECH_0895 Putative pyruvate, phosphate dikinase regulatory protein Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q39Q78 5.17e-25 103 31 11 283 3 Gmet_3384 Putative pyruvate, phosphate dikinase regulatory protein Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q5FJT2 5.73e-25 103 27 8 287 3 LBA1206 Putative pyruvate, phosphate dikinase regulatory protein Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8GVP6 5.91e-25 107 28 9 289 2 PDRP1 Probable pyruvate, phosphate dikinase regulatory protein, chloroplastic Oryza sativa subsp. japonica
A2YM35 5.91e-25 107 28 9 289 3 PDRP1 Probable pyruvate, phosphate dikinase regulatory protein, chloroplastic Oryza sativa subsp. indica
Q5GS03 1.25e-24 102 27 6 268 3 Wbm0633 Putative pyruvate, phosphate dikinase regulatory protein Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q2N6J9 1.41e-24 102 28 10 274 3 ELI_13000 Putative pyruvate, phosphate dikinase regulatory protein Erythrobacter litoralis (strain HTCC2594)
B8CXH4 1.57e-24 102 30 7 279 3 Hore_12430 Putative pyruvate, phosphate dikinase regulatory protein Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q6HDM4 1.8e-24 102 26 7 283 3 BT9727_4034 Putative pyruvate, phosphate dikinase regulatory protein Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634P4 1.8e-24 102 26 7 283 3 BCE33L4044 Putative pyruvate, phosphate dikinase regulatory protein Bacillus cereus (strain ZK / E33L)
B7HPJ5 1.8e-24 102 26 7 283 3 BCAH187_A4429 Putative pyruvate, phosphate dikinase regulatory protein Bacillus cereus (strain AH187)
Q730P0 1.8e-24 102 26 7 283 3 BCE_4376 Putative pyruvate, phosphate dikinase regulatory protein Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JN21 1.8e-24 102 26 7 283 3 BCAH820_4318 Putative pyruvate, phosphate dikinase regulatory protein Bacillus cereus (strain AH820)
Q81LU1 1.8e-24 102 26 7 283 3 BA_4520 Putative pyruvate, phosphate dikinase regulatory protein Bacillus anthracis
A0RIR7 1.8e-24 102 26 7 283 3 BALH_3887 Putative pyruvate, phosphate dikinase regulatory protein Bacillus thuringiensis (strain Al Hakam)
C3LKX5 1.8e-24 102 26 7 283 3 BAMEG_4558 Putative pyruvate, phosphate dikinase regulatory protein Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P8K2 1.8e-24 102 26 7 283 3 BAA_4540 Putative pyruvate, phosphate dikinase regulatory protein Bacillus anthracis (strain A0248)
B7IYE7 2.31e-24 102 26 7 283 3 BCG9842_B0823 Putative pyruvate, phosphate dikinase regulatory protein Bacillus cereus (strain G9842)
C1ESJ0 2.59e-24 102 26 7 283 3 BCA_4407 Putative pyruvate, phosphate dikinase regulatory protein Bacillus cereus (strain 03BB102)
A8YVN2 2.77e-24 102 28 10 292 3 lhv_1306 Putative pyruvate, phosphate dikinase regulatory protein Lactobacillus helveticus (strain DPC 4571)
Q2GC57 2.94e-24 102 28 9 274 3 Saro_0117 Putative pyruvate, phosphate dikinase regulatory protein Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q831T1 3.39e-24 101 31 9 280 3 EF_2419 Putative pyruvate, phosphate dikinase regulatory protein 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q038S5 3.76e-24 101 28 8 276 3 LSEI_1522 Putative pyruvate, phosphate dikinase regulatory protein Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEL8 3.76e-24 101 28 8 276 3 LCABL_17380 Putative pyruvate, phosphate dikinase regulatory protein Lacticaseibacillus casei (strain BL23)
B7HCS0 6.16e-24 100 26 7 283 3 BCB4264_A4413 Putative pyruvate, phosphate dikinase regulatory protein Bacillus cereus (strain B4264)
Q03F57 1.24e-23 100 28 11 285 3 PEPE_1110 Putative pyruvate, phosphate dikinase regulatory protein Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q4A0R6 1.59e-23 99 30 11 276 3 SSP0181 Putative pyruvate, phosphate dikinase regulatory protein 1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2GJC2 1.76e-23 100 28 10 278 3 APH_0961 Putative pyruvate, phosphate dikinase regulatory protein Anaplasma phagocytophilum (strain HZ)
Q812T2 1.86e-23 99 26 7 283 3 BC_4293 Putative pyruvate, phosphate dikinase regulatory protein Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
C0R2U3 2.55e-23 99 28 7 272 3 WRi_004470 Putative pyruvate, phosphate dikinase regulatory protein Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q73I41 2.55e-23 99 28 7 272 3 WD_0341 Putative pyruvate, phosphate dikinase regulatory protein Wolbachia pipientis wMel
A9VHS3 3.1e-23 99 26 7 283 3 BcerKBAB4_4147 Putative pyruvate, phosphate dikinase regulatory protein Bacillus mycoides (strain KBAB4)
Q67RX3 3.83e-23 99 28 11 289 3 STH585 Putative pyruvate, phosphate dikinase regulatory protein Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8CR12 4.34e-23 98 29 9 270 3 SE_2159 Putative pyruvate, phosphate dikinase regulatory protein 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL18 4.34e-23 98 29 9 270 3 SERP2169 Putative pyruvate, phosphate dikinase regulatory protein 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q3AEY1 5.32e-23 98 28 10 275 3 CHY_0442 Putative pyruvate, phosphate dikinase regulatory protein Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A5G9G7 9.25e-23 97 28 10 273 3 Gura_4292 Putative pyruvate, phosphate dikinase regulatory protein Geotalea uraniireducens (strain Rf4)
A8AWF1 1.32e-22 97 28 8 268 3 SGO_0812 Putative pyruvate, phosphate dikinase regulatory protein Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q195N6 1.47e-22 99 29 9 286 1 PDRP1 Pyruvate, phosphate dikinase regulatory protein, chloroplastic Zea mays
Q2GE82 2.08e-22 97 30 7 233 3 NSE_0324 Putative pyruvate, phosphate dikinase regulatory protein Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q74G02 2.26e-22 96 30 11 284 3 GSU0450 Putative pyruvate, phosphate dikinase regulatory protein Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
O49562 2.43e-22 99 27 11 292 1 RP1 Pyruvate, phosphate dikinase regulatory protein 1, chloroplastic Arabidopsis thaliana
Q0AKD8 8.31e-22 95 29 12 284 3 Mmar10_2974 Putative pyruvate, phosphate dikinase regulatory protein Maricaulis maris (strain MCS10)
Q9AC59 1.1e-21 95 29 9 282 3 CC_0001 Putative pyruvate, phosphate dikinase regulatory protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A0AIQ8 1.11e-21 95 28 9 278 3 lwe1472 Putative pyruvate, phosphate dikinase regulatory protein 1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A3CMR4 1.55e-21 94 28 8 272 3 SSA_1055 Putative pyruvate, phosphate dikinase regulatory protein Streptococcus sanguinis (strain SK36)
B0K714 1.58e-21 94 29 12 278 3 Teth514_1350 Putative pyruvate, phosphate dikinase regulatory protein Thermoanaerobacter sp. (strain X514)
B0KA48 1.58e-21 94 29 12 278 3 Teth39_1359 Putative pyruvate, phosphate dikinase regulatory protein Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q4L9C4 1.7e-21 94 29 11 277 3 SH0442 Putative pyruvate, phosphate dikinase regulatory protein 1 Staphylococcus haemolyticus (strain JCSC1435)
P67195 1.71e-21 94 28 9 278 3 lmo1457 Putative pyruvate, phosphate dikinase regulatory protein 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71ZL3 1.71e-21 94 28 9 278 3 LMOf2365_1476 Putative pyruvate, phosphate dikinase regulatory protein 1 Listeria monocytogenes serotype 4b (strain F2365)
P67196 1.71e-21 94 28 9 278 3 lin1494 Putative pyruvate, phosphate dikinase regulatory protein 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A8EX71 2e-21 94 27 7 275 3 A1E_00005 Putative pyruvate, phosphate dikinase regulatory protein Rickettsia canadensis (strain McKiel)
Q24SX2 2.35e-21 94 29 9 280 3 DSY3081 Putative pyruvate, phosphate dikinase regulatory protein Desulfitobacterium hafniense (strain Y51)
Q4UNK5 2.45e-21 94 28 6 267 3 RF_0001 Putative pyruvate, phosphate dikinase regulatory protein Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A8F0B8 2.63e-21 94 27 6 267 3 RMA_0001 Putative pyruvate, phosphate dikinase regulatory protein Rickettsia massiliae (strain Mtu5)
B8FUI8 2.71e-21 94 30 10 280 3 Dhaf_4252 Putative pyruvate, phosphate dikinase regulatory protein Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B9JXT9 2.88e-21 94 29 9 278 3 Avi_0001 Putative pyruvate, phosphate dikinase regulatory protein Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A5VA69 3.15e-21 94 27 8 271 3 Swit_2832 Putative pyruvate, phosphate dikinase regulatory protein Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q181Z6 3.28e-21 94 26 7 276 3 CD630_24110 Putative pyruvate, phosphate dikinase regulatory protein Clostridioides difficile (strain 630)
Q5KX17 3.8e-21 93 29 11 282 3 GK2484 Putative pyruvate, phosphate dikinase regulatory protein Geobacillus kaustophilus (strain HTA426)
Q836T1 3.91e-21 93 30 11 279 3 EF_1026 Putative pyruvate, phosphate dikinase regulatory protein 1 Enterococcus faecalis (strain ATCC 700802 / V583)
A4IR12 4.47e-21 93 29 11 279 3 GTNG_2421 Putative pyruvate, phosphate dikinase regulatory protein Geobacillus thermodenitrificans (strain NG80-2)
Q9KD46 6.13e-21 92 28 8 275 3 BH1373 Putative pyruvate, phosphate dikinase regulatory protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9MAC9 7.85e-21 94 28 9 291 1 RP2 Pyruvate, phosphate dikinase regulatory protein 2 Arabidopsis thaliana
A6TSJ2 9.75e-21 92 26 9 279 3 Amet_3020 Putative pyruvate, phosphate dikinase regulatory protein Alkaliphilus metalliredigens (strain QYMF)
A1UQU4 9.78e-21 92 28 10 276 3 BARBAKC583_0008 Putative pyruvate, phosphate dikinase regulatory protein Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q88VR4 1.11e-20 92 28 9 280 3 lp_1974 Putative pyruvate, phosphate dikinase regulatory protein Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
C3KWG3 1.17e-20 92 26 9 285 3 CLJ_B3950 Putative pyruvate, phosphate dikinase regulatory protein Clostridium botulinum (strain 657 / Type Ba4)
Q0AWT8 1.22e-20 92 26 9 273 3 Swol_1513 Putative pyruvate, phosphate dikinase regulatory protein 2 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A9IKX8 1.25e-20 92 29 12 284 3 BT_0001 Putative pyruvate, phosphate dikinase regulatory protein Bartonella tribocorum (strain CIP 105476 / IBS 506)
B2V110 1.28e-20 92 27 9 283 3 CLH_3298 Putative pyruvate, phosphate dikinase regulatory protein Clostridium botulinum (strain Alaska E43 / Type E3)
A8MG75 1.54e-20 92 25 6 268 3 Clos_1257 Putative pyruvate, phosphate dikinase regulatory protein Alkaliphilus oremlandii (strain OhILAs)
Q8UJC7 1.65e-20 91 29 11 282 3 Atu0001 Putative pyruvate, phosphate dikinase regulatory protein Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8RB44 1.66e-20 91 27 11 279 3 TTE0980 Putative pyruvate, phosphate dikinase regulatory protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A6M327 1.69e-20 91 26 8 281 3 Cbei_4901 Putative pyruvate, phosphate dikinase regulatory protein Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q5WHD3 1.93e-20 91 26 9 279 3 ABC1687 Putative pyruvate, phosphate dikinase regulatory protein Shouchella clausii (strain KSM-K16)
Q0SWW1 1.96e-20 91 28 10 277 3 CPR_0076 Putative pyruvate, phosphate dikinase regulatory protein Clostridium perfringens (strain SM101 / Type A)
Q04A15 2e-20 91 27 10 297 3 LBUL_1174 Putative pyruvate, phosphate dikinase regulatory protein Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
B9DVG9 2.03e-20 91 28 11 284 3 SUB1520 Putative pyruvate, phosphate dikinase regulatory protein Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B2TR90 2.06e-20 91 28 10 282 3 CLL_A3504 Putative pyruvate, phosphate dikinase regulatory protein Clostridium botulinum (strain Eklund 17B / Type B)
Q1G9W1 2.4e-20 91 27 10 297 3 Ldb1256 Putative pyruvate, phosphate dikinase regulatory protein Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q92JR6 2.5e-20 91 27 7 275 3 RC0001 Putative pyruvate, phosphate dikinase regulatory protein Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q2VYH2 2.56e-20 92 29 8 273 3 amb4549 Putative pyruvate, phosphate dikinase regulatory protein Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
C4K0B5 2.96e-20 91 27 9 273 3 RPR_00005 Putative pyruvate, phosphate dikinase regulatory protein Rickettsia peacockii (strain Rustic)
Q3A1T0 2.96e-20 90 26 9 282 3 Pcar_2438 Putative pyruvate, phosphate dikinase regulatory protein Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A8GQC2 2.97e-20 91 27 7 275 3 A1G_00005 Putative pyruvate, phosphate dikinase regulatory protein Rickettsia rickettsii (strain Sheila Smith)
B0BVQ7 2.97e-20 91 27 7 275 3 RrIowa_0001 Putative pyruvate, phosphate dikinase regulatory protein Rickettsia rickettsii (strain Iowa)
B1KU80 3.3e-20 90 26 8 285 3 CLK_3095 Putative pyruvate, phosphate dikinase regulatory protein Clostridium botulinum (strain Loch Maree / Type A3)
A7GJK7 3.3e-20 90 26 8 285 3 CLI_3856 Putative pyruvate, phosphate dikinase regulatory protein Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IHN7 3.3e-20 90 26 8 285 3 CLD_0863 Putative pyruvate, phosphate dikinase regulatory protein Clostridium botulinum (strain Okra / Type B1)
C1FNL3 3.3e-20 90 26 8 285 3 CLM_4116 Putative pyruvate, phosphate dikinase regulatory protein Clostridium botulinum (strain Kyoto / Type A2)
A5I7Y4 3.3e-20 90 26 8 285 3 CBO3611 Putative pyruvate, phosphate dikinase regulatory protein Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZF4 3.3e-20 90 26 8 285 3 CLB_3704 Putative pyruvate, phosphate dikinase regulatory protein Clostridium botulinum (strain ATCC 19397 / Type A)
B1HTI4 4.41e-20 90 27 10 276 3 Bsph_3704 Putative pyruvate, phosphate dikinase regulatory protein Lysinibacillus sphaericus (strain C3-41)
A8GLR3 4.68e-20 90 27 6 267 3 A1C_00005 Putative pyruvate, phosphate dikinase regulatory protein Rickettsia akari (strain Hartford)
Q8XI79 4.95e-20 90 27 10 277 3 CPE2242 Putative pyruvate, phosphate dikinase regulatory protein Clostridium perfringens (strain 13 / Type A)
A1AT85 5.35e-20 90 27 9 281 3 Ppro_2958 Putative pyruvate, phosphate dikinase regulatory protein Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q68Y01 6.96e-20 90 26 7 275 3 RT0001 Putative pyruvate, phosphate dikinase regulatory protein Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q74IY4 7.18e-20 90 27 9 284 3 LJ_1326 Putative pyruvate, phosphate dikinase regulatory protein Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
C3PM29 7.78e-20 90 27 7 275 3 RAF_ORF0001 Putative pyruvate, phosphate dikinase regulatory protein Rickettsia africae (strain ESF-5)
B3CPU1 7.81e-20 90 28 8 272 3 WP0486 Putative pyruvate, phosphate dikinase regulatory protein Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q9ZEE1 9.53e-20 89 26 7 275 3 RP001 Putative pyruvate, phosphate dikinase regulatory protein Rickettsia prowazekii (strain Madrid E)
Q1RKN2 9.62e-20 89 27 6 267 3 RBE_0001 Putative pyruvate, phosphate dikinase regulatory protein Rickettsia bellii (strain RML369-C)
Q1GP75 1.52e-19 89 26 11 278 3 Sala_2842 Putative pyruvate, phosphate dikinase regulatory protein Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q6G5B1 4.07e-19 88 27 9 281 3 BH00010 Putative pyruvate, phosphate dikinase regulatory protein Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q1WU26 5.17e-19 87 35 8 200 3 LSL_0699 Putative pyruvate, phosphate dikinase regulatory protein Ligilactobacillus salivarius (strain UCC118)
Q38WI8 6.14e-19 87 28 8 270 3 LCA_1143 Putative pyruvate, phosphate dikinase regulatory protein 2 Latilactobacillus sakei subsp. sakei (strain 23K)
C5D4S1 8.29e-19 87 29 8 272 3 GWCH70_2417 Putative pyruvate, phosphate dikinase regulatory protein Geobacillus sp. (strain WCH70)
B6JAK6 1.11e-18 87 25 11 286 3 OCA5_c01460 Putative pyruvate, phosphate dikinase regulatory protein Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A8GUB7 1.55e-18 86 26 6 267 3 A1I_00005 Putative pyruvate, phosphate dikinase regulatory protein Rickettsia bellii (strain OSU 85-389)
Q38XA8 1.59e-18 86 31 11 283 3 LCA_0872 Putative pyruvate, phosphate dikinase regulatory protein 1 Latilactobacillus sakei subsp. sakei (strain 23K)
Q042X7 1.65e-18 86 27 10 284 3 LGAS_1123 Putative pyruvate, phosphate dikinase regulatory protein Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q0B016 1.74e-18 86 26 6 275 3 Swol_0347 Putative pyruvate, phosphate dikinase regulatory protein 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q2RN86 2.98e-18 85 27 7 275 3 Rru_A3615 Putative pyruvate, phosphate dikinase regulatory protein Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q0C6A8 3.69e-18 85 27 9 282 3 HNE_0001 Putative pyruvate, phosphate dikinase regulatory protein Hyphomonas neptunium (strain ATCC 15444)
Q2J354 4.45e-18 85 27 9 278 3 RPB_0395 Putative pyruvate, phosphate dikinase regulatory protein Rhodopseudomonas palustris (strain HaA2)
Q6A651 4.92e-18 85 26 10 277 3 PPA2049 Putative pyruvate, phosphate dikinase regulatory protein Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q6MNY2 1.22e-17 84 27 11 281 3 Bd1093 Putative pyruvate, phosphate dikinase regulatory protein Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q899P8 1.3e-17 84 25 9 285 3 CTC_00122 Putative pyruvate, phosphate dikinase regulatory protein Clostridium tetani (strain Massachusetts / E88)
Q0BWA1 1.35e-17 84 34 3 154 3 GbCGDNIH1_0003 Putative pyruvate, phosphate dikinase regulatory protein Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
P54470 1.35e-17 83 25 7 274 1 yqfL Putative pyruvate, phosphate dikinase regulatory protein Bacillus subtilis (strain 168)
Q07UP5 1.35e-17 84 26 8 279 3 RPE_0380 Putative pyruvate, phosphate dikinase regulatory protein Rhodopseudomonas palustris (strain BisA53)
Q3SWH1 1.43e-17 84 27 12 283 3 Nwi_0102 Putative pyruvate, phosphate dikinase regulatory protein Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q6ANH6 1.43e-17 84 25 11 274 3 DP1369 Putative pyruvate, phosphate dikinase regulatory protein Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q6G1B4 2.05e-17 83 28 12 286 3 BQ00010 Putative pyruvate, phosphate dikinase regulatory protein Bartonella quintana (strain Toulouse)
B3E5Z6 2.07e-17 83 28 10 276 3 Glov_0997 Putative pyruvate, phosphate dikinase regulatory protein Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q98DY5 2.26e-17 83 27 11 282 3 mlr4488 Putative pyruvate, phosphate dikinase regulatory protein Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B3Q8B1 2.78e-17 83 27 9 278 3 Rpal_0300 Putative pyruvate, phosphate dikinase regulatory protein Rhodopseudomonas palustris (strain TIE-1)
Q6ND11 2.78e-17 83 27 9 278 3 RPA0298 Putative pyruvate, phosphate dikinase regulatory protein Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8EPY4 3.06e-17 82 28 11 274 3 OB1946 Putative pyruvate, phosphate dikinase regulatory protein Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q65H78 3.13e-17 82 25 9 275 3 BLi02715 Putative pyruvate, phosphate dikinase regulatory protein Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q89WP1 3.75e-17 82 26 9 270 3 blr0637 Putative pyruvate, phosphate dikinase regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A7Z6T8 3.75e-17 82 26 7 275 3 RBAM_023540 Putative pyruvate, phosphate dikinase regulatory protein Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q2RKV3 3.83e-17 82 27 10 273 3 Moth_0606 Putative pyruvate, phosphate dikinase regulatory protein Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q13E25 7.24e-17 82 27 9 278 3 RPD_0426 Putative pyruvate, phosphate dikinase regulatory protein Rhodopseudomonas palustris (strain BisB5)
B9LB15 9.76e-17 81 28 10 275 3 Chy400_3210 Putative pyruvate, phosphate dikinase regulatory protein Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WG10 9.76e-17 81 28 10 275 3 Caur_2965 Putative pyruvate, phosphate dikinase regulatory protein Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q92AE2 1.36e-16 80 29 11 284 3 lin1980 Putative pyruvate, phosphate dikinase regulatory protein 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0AJX1 1.55e-16 80 29 12 281 3 lwe1885 Putative pyruvate, phosphate dikinase regulatory protein 2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A4YJT8 1.7e-16 80 27 9 270 3 BRADO0199 Putative pyruvate, phosphate dikinase regulatory protein Bradyrhizobium sp. (strain ORS 278)
Q1QRY4 1.94e-16 80 25 9 272 3 Nham_0112 Putative pyruvate, phosphate dikinase regulatory protein Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q8DY22 2.25e-16 80 25 10 283 3 SAG1671 Putative pyruvate, phosphate dikinase regulatory protein Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZL8 2.25e-16 80 25 10 283 3 SAK_1683 Putative pyruvate, phosphate dikinase regulatory protein Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8E3P1 2.32e-16 80 25 10 283 3 gbs1715 Putative pyruvate, phosphate dikinase regulatory protein Streptococcus agalactiae serotype III (strain NEM316)
A9G8M9 2.36e-16 80 27 8 270 3 sce5851 Putative pyruvate, phosphate dikinase regulatory protein Sorangium cellulosum (strain So ce56)
Q2KEA1 2.46e-16 80 28 10 280 3 RHE_CH00001 Putative pyruvate, phosphate dikinase regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q71YF0 4.45e-16 79 28 10 282 3 LMOf2365_1895 Putative pyruvate, phosphate dikinase regulatory protein 2 Listeria monocytogenes serotype 4b (strain F2365)
Q8Y634 4.87e-16 79 28 10 282 3 lmo1866 Putative pyruvate, phosphate dikinase regulatory protein 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q49Y06 5.33e-16 79 26 9 283 3 SSP1193 Putative pyruvate, phosphate dikinase regulatory protein 2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A5E8G4 6.07e-16 79 26 9 270 3 BBta_0161 Putative pyruvate, phosphate dikinase regulatory protein Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A5G1D6 7.94e-16 79 34 4 170 3 Acry_2476 Putative pyruvate, phosphate dikinase regulatory protein Acidiphilium cryptum (strain JF-5)
B5ZV51 1.01e-15 78 28 12 284 3 Rleg2_3935 Putative pyruvate, phosphate dikinase regulatory protein Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q11CM6 1.02e-15 78 27 7 243 3 Meso_3478 Putative pyruvate, phosphate dikinase regulatory protein Chelativorans sp. (strain BNC1)
Q1MNF6 1.11e-15 78 28 12 284 3 RL0001 Putative pyruvate, phosphate dikinase regulatory protein Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B3PVT2 1.26e-15 78 28 10 280 3 RHECIAT_CH0000002 Putative pyruvate, phosphate dikinase regulatory protein Rhizobium etli (strain CIAT 652)
Q21CL7 2.89e-15 77 24 8 279 3 RPC_0294 Putative pyruvate, phosphate dikinase regulatory protein Rhodopseudomonas palustris (strain BisB18)
A6UEF3 8.42e-15 75 27 9 279 3 Smed_3209 Putative pyruvate, phosphate dikinase regulatory protein Sinorhizobium medicae (strain WSM419)
Q92TF2 1.85e-14 75 28 9 278 3 R00001 Putative pyruvate, phosphate dikinase regulatory protein Rhizobium meliloti (strain 1021)
Q8CSD7 1.98e-14 75 25 9 282 3 SE_1250 Putative pyruvate, phosphate dikinase regulatory protein 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNY5 1.98e-14 75 25 9 282 3 SERP1129 Putative pyruvate, phosphate dikinase regulatory protein 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L6R3 2.7e-14 74 23 9 279 3 SH1353 Putative pyruvate, phosphate dikinase regulatory protein 2 Staphylococcus haemolyticus (strain JCSC1435)
A8Z4A3 2.79e-14 74 25 10 285 3 USA300HOU_1565 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain USA300 / TCH1516)
A6QHA6 2.79e-14 74 25 10 285 3 NWMN_1466 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain Newman)
Q5HFJ7 2.79e-14 74 25 10 285 3 SACOL1620 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain COL)
Q2FY10 2.79e-14 74 25 10 285 3 SAOUHSC_01664 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGG0 2.79e-14 74 25 10 285 3 SAUSA300_1523 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain USA300)
B9DNM2 4.24e-14 73 26 10 282 3 Sca_1185 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus carnosus (strain TM300)
P67201 1.29e-13 72 25 10 285 3 MW1515 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain MW2)
Q6G903 1.29e-13 72 25 10 285 3 SAS1501 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain MSSA476)
Q6GGD6 1.29e-13 72 25 10 285 3 SAR1640 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain MRSA252)
P67200 1.29e-13 72 25 10 285 3 SA1392 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain N315)
P67199 1.29e-13 72 25 10 285 3 SAV1563 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YT16 1.29e-13 72 25 10 285 3 SAB1435c Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IT91 1.29e-13 72 25 10 285 3 SaurJH9_1621 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain JH9)
A6U235 1.29e-13 72 25 10 285 3 SaurJH1_1655 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain JH1)
A7X2W0 1.29e-13 72 25 10 285 3 SAHV_1550 Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus (strain Mu3 / ATCC 700698)
C0RFV5 4.6e-13 71 33 3 151 3 BMEA_A2129 Putative pyruvate, phosphate dikinase regulatory protein Brucella melitensis biotype 2 (strain ATCC 23457)
P67194 4.78e-13 71 33 3 151 3 BS1330_I2061 Putative pyruvate, phosphate dikinase regulatory protein Brucella suis biovar 1 (strain 1330)
A5VT25 4.78e-13 71 33 3 151 3 BOV_1987 Putative pyruvate, phosphate dikinase regulatory protein Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P67193 4.78e-13 71 33 3 151 3 BMEI2060 Putative pyruvate, phosphate dikinase regulatory protein Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M9F0 4.78e-13 71 33 3 151 3 BCAN_A2113 Putative pyruvate, phosphate dikinase regulatory protein Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57AJ1 4.78e-13 71 33 3 151 3 BruAb1_2042 Putative pyruvate, phosphate dikinase regulatory protein Brucella abortus biovar 1 (strain 9-941)
Q2YR06 4.78e-13 71 33 3 151 3 BAB1_2068 Putative pyruvate, phosphate dikinase regulatory protein Brucella abortus (strain 2308)
C3MB71 5.09e-13 70 27 10 281 3 NGR_c33500 Putative pyruvate, phosphate dikinase regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
O05337 1.42e-12 69 25 11 285 3 None Putative pyruvate, phosphate dikinase regulatory protein Staphylococcus aureus
A6WX71 2.91e-11 65 40 3 99 3 Oant_0853 Putative pyruvate, phosphate dikinase regulatory protein Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_05855
Feature type CDS
Gene ppsR
Product Regulator of PEP synthase PpsR, kinase-PPPase family (combines ADP:protein kinase and phosphorylase activities)
Location 177581 - 178444 (strand: 1)
Length 864 (nucleotides) / 287 (amino acids)
In genomic island -

Contig

Accession contig_5
Length 181448 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1106
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03618 Kinase/pyrophosphorylase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1806 Signal transduction mechanisms (T) T Regulator of PEP synthase PpsR, kinase-PPPase family (combines ADP:protein kinase and phosphorylase activities)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K09773 [pyruvate, water dikinase]-phosphate phosphotransferase / [pyruvate, water dikinase] kinase [EC:2.7.4.28 2.7.11.33] - -

Protein Sequence

MSITTGSSSDTQNKETRSVFFISDGTAITAEVLGHAVLSQFPIDIIAYTLPFVATVERALEIRQKIDTIFETTGLRPLVFYSIICQDVREAITGSQGCCQDIVQTLVAPIQKEIQMDPQPIFNRTHGLSKRNLSQYDARIAAIDFALAHDDGVSLRNMDQAQVILLGVSRCGKTPTSLYLAMQFGIQAANYPFTADDMDNLQLPAALKPYNNKLFGLTIDPERLAAIREERRENSRYASIRQCRMELAEVEALYRKHKISYLNTTNYSVEEISTKIIDSLGLNRRMF

Flanking regions ( +/- flanking 50bp)

CCGTTGCTCCGGATTATCGATTCAGCAAAAAACATAGGAAAATAAATAACATGTCTATCACAACCGGCTCATCTTCTGATACACAAAATAAAGAAACACGGAGTGTCTTCTTTATTTCTGACGGAACGGCAATTACGGCGGAAGTATTAGGTCATGCTGTATTGTCACAATTCCCTATTGATATTATCGCTTACACCCTGCCGTTCGTGGCAACTGTCGAGCGCGCGCTGGAAATCAGACAAAAAATCGATACCATTTTTGAAACCACCGGGTTACGCCCTCTGGTGTTCTACTCCATTATCTGTCAGGACGTGCGCGAAGCCATCACCGGCAGTCAGGGCTGCTGCCAGGACATAGTGCAAACCCTGGTCGCGCCGATTCAGAAAGAGATTCAGATGGATCCGCAGCCGATATTCAACCGGACCCACGGCTTATCCAAGCGCAATCTGAGCCAGTATGATGCCCGTATCGCAGCCATTGATTTCGCACTGGCACATGATGACGGTGTCTCCCTGCGCAATATGGATCAGGCGCAGGTTATTCTGCTCGGCGTTTCCCGCTGCGGTAAAACCCCGACCAGCCTGTATCTGGCCATGCAGTTCGGTATCCAGGCCGCCAACTATCCGTTCACCGCAGATGATATGGATAACCTGCAGCTGCCTGCGGCCCTGAAGCCGTATAATAATAAGTTATTCGGTCTGACCATTGACCCCGAGCGTCTGGCTGCTATCCGCGAAGAGCGCCGTGAAAACAGCCGCTACGCCTCAATCCGTCAGTGCCGGATGGAGCTGGCAGAGGTGGAAGCGCTGTACCGCAAACACAAAATCAGCTACCTCAATACCACCAACTATTCGGTGGAAGAGATATCGACAAAAATCATCGATTCTCTGGGATTAAACCGCCGTATGTTCTGACAGCGGAAACGGTTAAGTGGATCACATTCCCCCGGTGATCCACTTTCTGC