Homologs in group_2709

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_12380 EHELCC_12380 100.0 Morganella morganii S2 qseC quorum sensing histidine kinase QseC
NLDBIP_12720 NLDBIP_12720 100.0 Morganella morganii S4 qseC quorum sensing histidine kinase QseC
LHKJJB_12580 LHKJJB_12580 100.0 Morganella morganii S3 qseC quorum sensing histidine kinase QseC
HKOGLL_11195 HKOGLL_11195 100.0 Morganella morganii S5 qseC quorum sensing histidine kinase QseC
F4V73_RS05670 F4V73_RS05670 80.6 Morganella psychrotolerans qseC quorum sensing histidine kinase QseC

Distribution of the homologs in the orthogroup group_2709

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2709

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8X524 9.65e-141 413 50 1 444 2 qseC Sensor protein QseC Escherichia coli O157:H7
P40719 1.16e-140 413 50 1 444 1 qseC Sensor protein QseC Escherichia coli (strain K12)
Q8Z3P2 1.02e-137 405 52 1 444 3 qseC Sensor protein QseC Salmonella typhi
Q8ZLZ9 8.49e-137 403 52 1 444 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45336 2.26e-113 343 40 1 441 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8GP19 4.09e-40 152 31 5 313 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q9HV31 9.64e-31 127 27 12 442 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P30844 1.48e-28 119 31 9 288 1 basS Sensor protein BasS Escherichia coli (strain K12)
P36557 1.01e-26 113 30 7 273 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q70FG9 1.95e-26 112 32 7 291 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
O69729 8.34e-26 112 30 10 342 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8FK37 8.11e-25 110 29 12 338 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P77485 9.35e-25 109 28 12 338 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q8XBY4 4.69e-24 107 28 12 338 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q9ZHD4 2.15e-22 102 24 16 477 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q49ZT9 3.78e-22 102 26 4 261 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P30847 3.12e-19 93 30 7 269 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
P08401 4.36e-18 89 27 9 332 1 creC Sensor protein CreC Escherichia coli (strain K12)
A0QR01 5.4e-18 89 27 3 210 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A1TEL6 1.72e-16 85 28 5 252 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q55932 3.17e-16 84 32 10 226 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1B3X9 7.43e-16 83 28 4 240 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 7.43e-16 83 28 4 240 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
A3Q5L8 8.82e-16 83 28 4 240 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q47457 9.19e-16 82 28 11 308 3 pcoS Probable sensor protein PcoS Escherichia coli
Q02541 2.33e-15 81 26 5 227 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
P9WGK5 2.47e-15 81 30 3 210 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 2.47e-15 81 30 3 210 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 2.47e-15 81 30 3 210 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGL1 2.61e-15 81 28 5 240 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 2.61e-15 81 28 5 240 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 2.61e-15 81 28 5 240 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q8DXQ8 2.61e-15 80 29 6 202 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
A8Z553 2.65e-15 81 31 5 207 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 2.65e-15 81 31 5 207 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 2.65e-15 81 31 5 207 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 2.65e-15 81 31 5 207 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 2.65e-15 81 31 5 207 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
P54883 2.69e-15 81 30 4 212 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q8E3C7 2.99e-15 80 29 6 202 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
Q7A3X0 4.23e-15 80 31 5 207 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 4.23e-15 80 31 5 207 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 4.23e-15 80 31 5 207 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 4.23e-15 80 31 5 207 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 4.23e-15 80 31 5 207 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
P45608 4.54e-15 80 30 4 197 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
Q8NV46 4.94e-15 80 31 5 207 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 4.94e-15 80 31 5 207 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
I1WSZ3 6.4e-15 80 28 7 266 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
P9WGK7 6.9e-15 80 29 11 283 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 6.9e-15 80 29 11 283 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 6.9e-15 80 29 11 283 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P76339 6.94e-15 80 28 3 228 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
Q6GE72 8.1e-15 79 31 5 205 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
Q1XD95 9.08e-15 80 26 8 290 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
A1KHB8 1.04e-14 79 28 5 240 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 1.04e-14 79 28 5 240 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q44007 1.13e-14 79 27 7 303 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P20169 1.99e-14 79 31 11 242 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O34206 2.22e-14 79 28 5 232 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
Q2YZ23 2.48e-14 78 30 5 207 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5HPC4 3.06e-14 78 25 11 304 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A0QBR0 3.14e-14 78 26 4 240 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
Q742C0 3.82e-14 77 26 4 240 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8CSL7 4.27e-14 77 25 11 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P35164 5.21e-14 77 27 5 216 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
A0PWB3 5.77e-14 77 27 5 240 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
P0DMK6 5.79e-14 77 27 7 266 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
Q49XM6 6.51e-14 77 24 10 314 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8DPL8 7.01e-14 77 28 6 204 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 7.01e-14 77 28 6 204 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A0R3I7 8.01e-14 77 27 6 252 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q08408 1.34e-13 76 23 4 220 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
O34638 1.75e-13 75 25 5 236 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
P08400 1.94e-13 75 29 4 197 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
Q8KIY1 2.49e-13 75 27 7 240 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
P45609 3.36e-13 74 29 4 197 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q45614 3.44e-13 75 27 9 229 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
P51392 3.72e-13 75 27 10 292 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q9Z5G7 4.07e-13 74 26 4 227 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
P23545 5.4e-13 74 25 4 227 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
O33071 5.61e-13 73 28 11 280 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
Q6GGZ4 8.54e-13 73 26 9 249 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q7A0W5 8.85e-13 73 26 9 249 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 8.85e-13 73 26 9 249 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 8.85e-13 73 26 9 249 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 8.85e-13 73 26 9 249 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 8.85e-13 73 26 9 249 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 8.85e-13 73 26 9 249 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 8.85e-13 73 26 9 249 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q2YY04 9.59e-13 73 26 9 249 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5A2P0 1.45e-12 72 27 8 232 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
Q54SP4 1.83e-12 73 26 10 260 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q8CRA8 2.09e-12 72 25 6 216 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P18392 2.11e-12 72 25 17 446 1 rstB Sensor protein RstB Escherichia coli (strain K12)
Q07737 2.61e-12 72 26 8 278 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8DN03 2.73e-12 72 24 11 336 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 2.73e-12 72 24 11 336 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q4L6C5 3.69e-12 71 25 10 266 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
Q4L8M0 4e-12 71 20 7 288 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q5HLN1 5.19e-12 71 25 6 216 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9RQQ9 6.21e-12 71 27 4 208 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P39664 6.63e-12 70 30 9 263 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A0A0H3GPN8 6.83e-12 70 25 4 236 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
A0A4P7TSF2 7.02e-12 70 25 10 286 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 7.02e-12 70 25 10 286 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 7.02e-12 70 25 10 286 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
P0AE82 7.62e-12 70 26 6 240 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 7.62e-12 70 26 6 240 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 7.62e-12 70 26 6 240 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
E0X9C7 7.79e-12 71 27 7 233 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 1.9e-06 54 28 10 220 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P08982 8.24e-12 70 24 10 288 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 8.24e-12 70 24 10 288 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P41406 8.39e-12 70 24 9 286 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
P42245 1.43e-11 68 27 7 216 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
Q08430 1.5e-11 69 26 9 227 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
P72292 1.66e-11 69 26 7 210 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
B1WYT4 2.21e-11 68 28 6 210 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
B7K3M6 2.63e-11 68 27 5 210 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
A5W4E3 3.61e-11 69 27 7 232 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 1.88e-06 54 28 10 220 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P96368 3.69e-11 68 29 8 294 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q4LAJ8 5.47e-11 68 25 7 215 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
P33639 6.13e-11 68 27 7 221 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7BWI3 7.27e-11 67 26 5 215 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q04943 7.31e-11 67 28 7 247 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9RDT3 8.72e-11 67 25 7 215 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q6GKS6 1.06e-10 67 25 7 215 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
A6QD58 1.15e-10 67 25 7 215 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q7A215 1.17e-10 67 25 7 215 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 1.17e-10 67 25 7 215 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 1.17e-10 67 25 7 215 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 1.17e-10 67 25 7 215 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 1.17e-10 67 25 7 215 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 1.17e-10 67 25 7 215 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 1.17e-10 67 25 7 215 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 1.17e-10 67 25 7 215 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 1.17e-10 67 25 7 215 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 1.17e-10 67 25 7 215 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 1.17e-10 67 25 7 215 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 1.17e-10 67 25 7 215 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
P71380 1.18e-10 66 25 9 241 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q04804 1.38e-10 66 29 6 242 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P16497 1.56e-10 67 25 5 202 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
T2KMF4 1.69e-10 67 22 4 231 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P94608 7.98e-10 64 27 8 225 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q06067 8.67e-10 64 24 5 204 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
B2J946 1.07e-09 63 24 4 221 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q8CU87 1.61e-09 63 25 7 215 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 1.61e-09 63 25 7 215 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q55630 2.19e-09 62 23 6 257 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B7KFU0 2.62e-09 62 27 6 211 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
P0A4I8 2.86e-09 62 28 6 242 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 2.86e-09 62 28 6 242 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P23621 3.2e-09 62 27 6 226 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4A159 3.7e-09 62 24 7 215 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P0A4I6 4.19e-09 62 26 8 224 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 4.19e-09 62 26 8 224 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q47745 5.17e-09 61 24 12 307 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
O32193 5.26e-09 61 20 7 301 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
B0JK50 6.66e-09 61 26 7 215 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q03228 7.69e-09 61 29 8 218 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9HZ47 7.98e-09 61 28 10 232 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O34989 1.02e-08 61 21 15 360 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
A2C884 1.22e-08 60 28 8 241 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q82EB2 1.59e-08 60 29 9 228 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P9WGK9 1.76e-08 60 26 8 226 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9KLK7 1.89e-08 60 28 7 203 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P9WGK8 1.95e-08 60 26 8 226 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 1.95e-08 60 26 8 226 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q2JWK9 2.15e-08 59 25 6 239 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
P23837 2.23e-08 59 26 14 300 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
P21865 2.27e-08 60 27 8 222 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q83RR1 2.27e-08 59 26 14 300 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
Q8FIB8 2.35e-08 59 26 14 300 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7V6P7 2.88e-08 58 27 7 241 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q9ZEP3 3.11e-08 59 30 11 237 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7A5H7 3.16e-08 59 26 8 232 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 3.16e-08 59 26 8 232 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q0IBF4 3.36e-08 58 28 6 215 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
Q8NWF3 3.45e-08 59 26 8 232 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 3.45e-08 59 26 8 232 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 3.45e-08 59 26 8 232 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 3.45e-08 59 26 8 232 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9L523 3.57e-08 59 26 8 232 1 srrB Sensor protein SrrB Staphylococcus aureus
Q9CCJ1 3.59e-08 59 22 7 283 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
Q6GGK7 4.07e-08 59 26 8 232 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q9P896 6.06e-08 58 24 8 221 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O25917 6.78e-08 58 25 9 223 3 crdS Sensor histidine kinase CrdS Helicobacter pylori (strain ATCC 700392 / 26695)
Q8YR50 7.17e-08 58 38 2 93 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P0C5S6 7.53e-08 58 25 7 204 3 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio harveyi
A7MRY4 7.6e-08 58 25 7 204 1 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio campbellii (strain ATCC BAA-1116)
P52101 8.35e-08 58 25 10 271 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q03069 8.42e-08 57 23 7 222 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
Q8X739 8.43e-08 58 25 14 300 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
Q8XA47 9.7e-08 57 25 10 271 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
Q3M8A7 9.86e-08 57 38 2 93 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q5AHA0 1.17e-07 58 25 5 217 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8Z7H3 1.43e-07 57 24 12 293 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
P0DM80 1.47e-07 57 24 12 293 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 1.47e-07 57 24 12 293 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 1.47e-07 57 24 12 293 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 1.47e-07 57 24 12 293 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 1.47e-07 57 24 12 293 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 1.47e-07 57 24 12 293 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
Q52969 1.51e-07 57 25 5 221 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
A7HD43 1.74e-07 56 27 9 244 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
P74111 1.91e-07 57 24 6 226 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A0QTK3 1.99e-07 57 24 6 233 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P37739 2.36e-07 57 26 5 215 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
Q9I0I2 3.18e-07 56 26 10 275 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O31661 3.37e-07 56 26 6 212 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q9M7M1 3.8e-07 56 26 8 234 2 ETR1 Ethylene receptor Prunus persica
A2BRQ6 5.74e-07 55 23 5 202 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
Q95PI2 6.21e-07 55 23 6 211 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q9KM66 6.39e-07 55 27 8 223 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P49333 6.52e-07 55 24 6 229 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q31AE8 7.1e-07 54 24 5 202 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
Q9HUI3 7.29e-07 55 26 7 210 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3AYV8 7.88e-07 54 24 5 213 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
Q93CB7 8.04e-07 55 26 13 295 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P0A2D9 8.13e-07 54 29 10 215 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 8.13e-07 54 29 10 215 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
Q7V113 1.01e-06 54 23 5 202 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q4L482 1.27e-06 53 22 9 285 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
O49230 1.32e-06 54 25 5 214 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q7U871 1.61e-06 53 25 5 213 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
A8G5E7 1.64e-06 53 23 5 202 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
P06218 1.67e-06 53 29 11 215 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
P94414 1.7e-06 53 22 6 243 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
Q8CTI3 1.85e-06 53 22 7 235 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 1.85e-06 53 22 7 235 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q06904 2.28e-06 53 27 8 232 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A3PDI2 2.59e-06 53 22 5 202 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
P9WGL2 2.83e-06 53 28 6 217 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WGL3 2.98e-06 53 28 6 217 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9F8D7 3.42e-06 53 23 5 222 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P28788 3.62e-06 52 29 10 210 3 ntrB Sensory histidine kinase/phosphatase NtrB Proteus hauseri
P37894 3.91e-06 53 24 8 224 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q2JKD9 4.52e-06 52 25 8 243 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
P33113 5.11e-06 52 22 12 301 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
E5KK10 5.23e-06 52 26 8 203 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
P54302 5.46e-06 52 23 8 221 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
A7N6S2 5.56e-06 52 22 9 236 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
P0DMC5 6.17e-06 52 23 7 229 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC6 6.62e-06 52 23 7 229 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q9HWR3 7.46e-06 52 29 9 210 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P58662 8.36e-06 52 22 6 218 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0C0F6 1.04e-05 51 24 7 248 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0C0F7 1.16e-05 51 24 7 248 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P0AFB7 1.26e-05 50 27 10 216 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 1.26e-05 50 27 10 216 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 1.26e-05 50 27 10 216 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
A9M715 1.47e-05 51 24 7 239 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
B0CI82 1.56e-05 51 24 7 239 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8FZ86 1.58e-05 51 24 7 239 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
O24972 1.7e-05 50 18 5 256 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
Q8DMC5 1.78e-05 50 27 11 243 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q56128 1.82e-05 50 22 7 229 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P48027 1.85e-05 50 23 5 222 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q57BR6 1.99e-05 50 23 7 239 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 1.99e-05 50 23 7 239 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 1.99e-05 50 23 7 239 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q8YIM6 2.06e-05 50 23 7 239 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2T0V9 2.13e-05 50 24 7 203 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2YSS1 2.73e-05 49 23 5 191 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
A8Z182 2.75e-05 49 23 5 191 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 2.75e-05 49 23 5 191 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 2.75e-05 49 23 5 191 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2G0D9 2.75e-05 49 23 5 191 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 2.75e-05 49 23 5 191 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q8NXR5 3.23e-05 49 23 5 191 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 3.23e-05 49 23 5 191 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
Q3S4A7 3.77e-05 50 24 9 244 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q9KHI5 3.99e-05 49 23 5 214 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9SXL4 4.27e-05 50 27 4 141 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q49VK4 4.28e-05 48 24 6 191 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8DKG0 4.42e-05 49 27 8 206 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P09431 4.69e-05 48 24 7 214 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q54U87 5.02e-05 49 25 10 231 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q3J6C1 5.56e-05 48 26 12 268 1 regB Sensor histidine kinase RegB Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P30855 5.87e-05 49 23 6 201 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
P0C0Z0 6.92e-05 48 26 12 268 3 regB Sensor histidine kinase RegB Cereibacter sphaeroides
Q8X614 0.000108 48 26 11 229 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q9LCC2 0.000128 48 23 6 200 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P58402 0.000174 47 23 6 201 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q8THF6 0.00018 47 23 2 172 1 msmS Methyl sulfide methyltransferase-associated sensor Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P14377 0.000193 47 25 9 226 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
P73276 0.000265 47 25 7 226 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P40330 0.000281 47 24 7 231 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P26762 0.000299 47 24 7 231 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9I4F8 0.000309 46 29 9 246 3 phoQ Two-component sensor PhoQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q54YZ9 0.000384 47 22 6 206 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P18540 0.000396 46 26 8 202 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_05210
Feature type CDS
Gene qseC
Product quorum sensing histidine kinase QseC
Location 48693 - 50039 (strand: 1)
Length 1347 (nucleotides) / 448 (amino acids)
In genomic island -

Contig

Accession contig_5
Length 181448 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2709
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
PF08521 Two-component sensor kinase N-terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07645 two-component system, OmpR family, sensor histidine kinase QseC [EC:2.7.13.3] Two-component system
Quorum sensing
-

Protein Sequence

MKTYSLRLRLGGLLLLLTLLTWGVASMFAWMQTTKSINELFDTQQMAFAKRLSVLPSGLEFPPSAIQKTKKMLSANRGKQDDDAFAFAIFSPSGERVLDDGENGRKIPFSDKKNGFRDGSLTDDNDRWRFVQLPSADGRYIIVVGQEWEYREDMGLTIITAQAIPWLVALPLMLLLFLWLLTRALTPLRLLARQLQRRNPAELTPLAPPVLPKEVSPMLDALNGLFLRIRDLRERESRFTSDAAHELRSPLAALKVQTEVMQIAGDDPATREHVTANLITGIDRATRLVDQLLTLSRLESQSHPQECTELRWSAIINDAIAQTAPDAAVHQVSVIPDLAAPELTVRGEQLLLTVMLRNLLHNAIRYGKTGGTVQLTLTPQQLVIEDDGPGVSDAILARLGERFYRPPGQEKTGSGLGLSIVKRIAELHHMTIQFRRSPQGGFIAEIRW

Flanking regions ( +/- flanking 50bp)

CGGATTTATCAAAACTATTCACGGTGTCGGTTATGTCGCGGGAAAAAATGATGAAGACGTATAGTCTGCGCCTGCGGCTGGGCGGATTATTGCTGCTGCTCACCCTGCTGACCTGGGGTGTCGCCAGTATGTTCGCCTGGATGCAGACCACAAAATCCATCAATGAATTATTCGATACACAACAAATGGCCTTTGCCAAACGTCTGTCAGTTTTGCCGTCCGGGCTCGAGTTCCCGCCGTCTGCGATACAGAAAACCAAAAAAATGCTCTCCGCCAACCGGGGAAAGCAGGATGACGATGCATTCGCTTTTGCTATTTTCAGTCCGTCGGGCGAGCGGGTGCTGGATGACGGCGAAAACGGCCGGAAAATTCCGTTCTCAGACAAGAAAAACGGGTTCCGGGACGGCTCGCTGACGGATGATAACGACCGCTGGCGCTTTGTGCAGCTGCCTTCCGCCGATGGCCGCTACATCATCGTGGTCGGCCAGGAGTGGGAATACCGCGAGGATATGGGGCTGACCATTATCACCGCTCAGGCGATCCCGTGGCTGGTGGCACTGCCGCTGATGCTGCTTCTGTTCCTGTGGCTGCTGACCCGCGCACTGACTCCGCTGCGCCTGCTGGCACGGCAGTTACAGCGCCGTAACCCGGCTGAGCTGACGCCGCTGGCCCCGCCGGTGCTGCCGAAAGAAGTCAGCCCGATGCTGGACGCCCTGAACGGATTATTTCTGCGTATCCGCGATCTGCGCGAACGGGAAAGCCGTTTTACCTCTGATGCCGCCCATGAACTGCGCAGCCCGCTGGCCGCACTGAAAGTACAGACTGAAGTGATGCAGATTGCCGGGGATGACCCCGCCACCCGTGAACACGTGACCGCGAATCTGATCACCGGGATTGACCGCGCCACCCGCCTGGTGGATCAGTTACTGACCCTCTCACGGCTGGAATCACAGTCTCACCCGCAGGAATGTACAGAGCTGCGCTGGTCAGCCATTATTAATGATGCCATTGCACAAACAGCTCCGGATGCGGCTGTACATCAGGTCAGTGTGATACCTGACCTCGCCGCGCCTGAACTGACGGTCCGCGGCGAACAGCTGCTGCTGACCGTCATGCTGCGCAATCTGCTGCATAATGCTATCCGCTACGGCAAAACCGGCGGCACCGTTCAGTTAACGCTGACACCGCAGCAGTTAGTGATTGAGGATGATGGCCCGGGCGTCAGTGATGCGATACTGGCCCGGCTGGGAGAACGTTTTTACCGGCCGCCGGGACAGGAAAAAACCGGCAGCGGTCTGGGATTGTCTATCGTGAAACGAATTGCGGAACTGCATCATATGACCATACAGTTCCGCCGCAGCCCGCAGGGCGGGTTTATCGCTGAAATCAGGTGGTGAGCGGTTTTTCCGCTCCCTCTGCCGCCTGTTCCATCGCCTCTTCTATCGCT