Homologs in group_2644

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_06700 EHELCC_06700 100.0 Morganella morganii S2 xerD Site-specific recombinase XerD
NLDBIP_07025 NLDBIP_07025 100.0 Morganella morganii S4 xerD Site-specific recombinase XerD
LHKJJB_06560 LHKJJB_06560 100.0 Morganella morganii S3 xerD Site-specific recombinase XerD
HKOGLL_04370 HKOGLL_04370 100.0 Morganella morganii S5 xerD Site-specific recombinase XerD
PMI_RS12610 PMI_RS12610 100.0 Proteus mirabilis HI4320 - site-specific integrase

Distribution of the homologs in the orthogroup group_2644

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2644

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8KRZ2 5.77e-51 179 32 6 320 3 xerC Putative tyrosine recombinase XerC Pseudomonas syringae
Q9F771 7.39e-44 159 32 7 307 3 xerC Putative tyrosine recombinase XerC Pseudomonas aeruginosa
C4ZGY6 5.89e-10 63 26 8 246 3 EUBREC_2677 Tyrosine recombinase EUBREC_2677 Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q7ZAK0 9.51e-10 62 25 14 317 3 xerC Tyrosine recombinase XerC Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8TZV9 1.28e-09 62 26 5 165 3 xerA Tyrosine recombinase XerA Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q7ZAM5 5.28e-09 60 25 12 293 3 xerC Tyrosine recombinase XerC Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B7GGC7 8.09e-09 59 25 7 256 3 xerC Tyrosine recombinase XerC Anoxybacillus flavithermus (strain DSM 21510 / WK1)
O59490 6.22e-08 57 24 4 165 3 xerA Tyrosine recombinase XerA Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O26979 8.87e-08 56 28 7 156 3 xerA Tyrosine recombinase XerA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A8FD78 1.39e-07 55 22 11 296 3 xerC Tyrosine recombinase XerC Bacillus pumilus (strain SAFR-032)
B7GQE1 1.45e-07 56 27 5 170 3 xerC Tyrosine recombinase XerC Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q980D9 1.5e-07 55 25 10 304 1 xerA Tyrosine recombinase XerA Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
B3DQV1 1.59e-07 56 27 5 170 3 xerC Tyrosine recombinase XerC Bifidobacterium longum (strain DJO10A)
Q04A03 7.44e-07 53 22 11 244 3 xerC Tyrosine recombinase XerC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9V2 7.44e-07 53 22 11 244 3 xerC Tyrosine recombinase XerC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q5JHA3 9.96e-07 53 24 5 166 3 xerA Tyrosine recombinase XerA Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9V1P5 1.56e-06 52 21 4 165 1 xerA Tyrosine recombinase XerA Pyrococcus abyssi (strain GE5 / Orsay)
B5YFZ8 2.71e-06 52 25 6 166 3 xerC Tyrosine recombinase XerC Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q48733 3.92e-06 51 22 11 244 3 xerC Tyrosine recombinase XerC Lactobacillus leichmannii
C3LPX0 5.38e-06 51 23 6 159 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain M66-2)
Q9KVL4 5.38e-06 51 23 6 159 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4I4 5.38e-06 51 23 6 159 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B6YWN8 5.47e-06 50 23 4 142 3 xerA Tyrosine recombinase XerA Thermococcus onnurineus (strain NA1)
Q0PA27 8.91e-06 50 25 6 154 1 xerH Tyrosine recombinase XerH Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A0LEB8 1.13e-05 50 27 6 161 3 xerC Tyrosine recombinase XerC Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q71Y59 1.24e-05 50 21 12 312 3 xerD Tyrosine recombinase XerD Listeria monocytogenes serotype 4b (strain F2365)
A8F7B4 1.27e-05 50 26 5 155 3 Tlet_1492 Tyrosine recombinase Tlet_1492 Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q7ZAM3 1.5e-05 49 28 8 159 3 xerD Tyrosine recombinase XerD Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P67631 1.52e-05 49 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain N315)
P67630 1.52e-05 49 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X1M7 1.52e-05 49 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Mu3 / ATCC 700698)
A5ISD6 1.55e-05 49 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain JH9)
A6U170 1.55e-05 49 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain JH1)
Q7NVH1 1.64e-05 49 27 7 154 3 xerC Tyrosine recombinase XerC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9KJF6 1.85e-05 49 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus
Q2LT92 1.9e-05 49 27 5 159 3 xerC Tyrosine recombinase XerC Syntrophus aciditrophicus (strain SB)
Q73NE4 2.02e-05 49 29 9 171 3 xerC Tyrosine recombinase XerC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q9K068 2.29e-05 49 26 7 157 3 xerD Tyrosine recombinase XerD Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A8Z3T2 3.43e-05 48 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain USA300 / TCH1516)
A6QGF2 3.43e-05 48 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Newman)
Q5HGI0 3.43e-05 48 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain COL)
Q2FZ30 3.43e-05 48 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHI6 3.43e-05 48 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain USA300)
Q8NWZ8 3.52e-05 48 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MW2)
Q6G9W1 3.52e-05 48 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MSSA476)
Q6GHI3 3.58e-05 48 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MRSA252)
Q2YXL6 4.25e-05 48 26 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q039E1 5.99e-05 47 23 10 265 3 xerC Tyrosine recombinase XerC Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEA7 5.99e-05 47 23 10 265 3 xerC Tyrosine recombinase XerC Lacticaseibacillus casei (strain BL23)
Q9JV76 6.04e-05 47 25 6 154 3 xerD Tyrosine recombinase XerD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JW14 9.83e-05 47 24 15 269 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9B1E0 0.000101 47 27 7 154 3 xerC Tyrosine recombinase XerC Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q92A53 0.000117 47 21 12 312 3 xerD Tyrosine recombinase XerD Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P55639 0.000152 47 27 6 169 3 NGR_a01810 Putative integrase/recombinase y4rF Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A3CN22 0.000159 47 24 4 150 3 xerS Tyrosine recombinase XerS Streptococcus sanguinis (strain SK36)
Q0VM16 0.000181 46 25 7 160 3 xerC Tyrosine recombinase XerC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
P0ADH9 0.000188 45 27 6 154 3 fimE Type 1 fimbriae regulatory protein FimE Shigella flexneri
P0ADH7 0.000188 45 27 6 154 3 fimE Type 1 fimbriae regulatory protein FimE Escherichia coli (strain K12)
P0ADH8 0.000188 45 27 6 154 3 fimE Type 1 fimbriae regulatory protein FimE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A9M1G2 0.000205 46 26 8 172 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup C (strain 053442)
A1KS31 0.000213 46 26 8 172 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
C1CRN6 0.000223 46 24 4 152 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain Taiwan19F-14)
C1CEC5 0.000223 46 24 4 152 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain JJA)
Q7ZAK7 0.000223 46 24 4 152 1 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IPW6 0.000223 46 24 4 152 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain CGSP14)
Q04KF1 0.000223 46 24 4 152 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C1CKQ9 0.000227 46 24 4 152 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain P1031)
B5E4Q4 0.000233 46 24 4 152 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae serotype 19F (strain G54)
B8ZQ39 0.000246 46 24 4 152 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1C7D0 0.000246 46 24 4 152 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain 70585)
B1IBW3 0.000281 46 24 4 152 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain Hungary19A-6)
B4U2Z3 0.000291 46 26 4 150 3 xerS Tyrosine recombinase XerS Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
A7NFG3 0.000298 45 24 14 282 3 xerC Tyrosine recombinase XerC Roseiflexus castenholzii (strain DSM 13941 / HLO8)
C0MFD9 0.000299 45 26 4 153 3 xerS Tyrosine recombinase XerS Streptococcus equi subsp. zooepidemicus (strain H70)
Q02E82 0.000306 45 28 9 157 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V5H1 0.000306 45 28 9 157 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain LESB58)
Q8Y5V0 0.00031 45 21 12 312 3 xerD Tyrosine recombinase XerD Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
C0MBC3 0.000363 45 26 4 153 3 xerS Tyrosine recombinase XerS Streptococcus equi subsp. equi (strain 4047)
Q51566 0.000407 45 28 9 157 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9JXV6 0.000435 45 26 7 169 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q97QP2 0.00047 45 24 4 152 1 xerS Tyrosine recombinase XerS Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q7ZAJ4 0.000471 45 25 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPU0 0.000471 45 25 4 150 3 xerC Tyrosine recombinase XerC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B4RNW5 0.000495 45 26 8 172 3 xerC Tyrosine recombinase XerC Neisseria gonorrhoeae (strain NCCP11945)
Q5FAI3 0.000495 45 26 8 172 3 xerC Tyrosine recombinase XerC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q7ZAM8 0.000496 45 23 4 155 3 xerC Tyrosine recombinase XerC Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RY9 0.000496 45 23 4 155 3 xerC Tyrosine recombinase XerC Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8NNZ9 0.0005 45 24 5 164 3 xerC Tyrosine recombinase XerC Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A8AXA5 0.000528 45 24 4 150 3 xerS Tyrosine recombinase XerS Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
C1DJ58 0.000575 45 24 6 157 3 xerC Tyrosine recombinase XerC Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
P55459 0.000585 43 27 7 162 3 NGR_a03610 Putative integrase/recombinase y4gC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B8DG54 0.000588 45 21 10 271 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4a (strain HCC23)
B9DUD2 0.000683 45 25 4 153 3 xerS Tyrosine recombinase XerS Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q9KPE9 0.000715 44 25 5 161 3 xerD Tyrosine recombinase XerD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8RA66 0.000878 44 20 12 331 3 xerC Tyrosine recombinase XerC Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_03835
Feature type CDS
Gene xerD
Product Site-specific recombinase XerD
Location 171075 - 172145 (strand: -1)
Length 1071 (nucleotides) / 356 (amino acids)
In genomic island -

Contig

Accession contig_3
Length 210665 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2644
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00589 Phage integrase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4974 Replication, recombination and repair (L) L Site-specific recombinase XerD

Protein Sequence

MKDNHSSDEHQQKVDVWEQMLSNYFYNKVLRPDTEKTYRKMVRLFLRYCGVCENALPLPDEVTHEHVLRWRRNELNIQKVRERTWNTKTRHMQSLYNYWIKKGIVSLKENPFSETQIEPGEKQKKVYTQSQLRTIYRILEQFQQQENMLPPDQAHFQACAVYPTRFWFAVLETLRLTAIRFNQLINLHIGDLDFEECTITLRSESSKNHREYQIAFVQPLRCLLAPLVEEMRCHGADKNDILFDVHRLYHKRLSRSETPLSQTIRSFFRRLSKECGFHVSPHRFRHTLATTLMKHPERNMQLTKQMLGHRSLSSTMEYIALDAYSTVRILENELGEFLTMGLGGELTRLASKRQRM

Flanking regions ( +/- flanking 50bp)

AGGAATCATTGTTTATTCGTATTGTCGGAAGTTAAAAGCAGGAGGTGTTTATGAAAGATAATCACAGTTCTGATGAACATCAGCAGAAAGTGGATGTATGGGAGCAAATGCTGAGTAATTACTTTTACAATAAAGTATTACGGCCGGATACGGAGAAAACATACCGTAAGATGGTACGTCTTTTTCTGCGTTATTGCGGAGTTTGTGAAAATGCGTTACCGCTACCGGATGAAGTGACACATGAGCATGTGCTGAGATGGCGAAGAAATGAGCTGAATATTCAGAAAGTCCGGGAACGGACATGGAACACAAAAACCAGGCATATGCAGTCTCTGTATAATTATTGGATCAAAAAAGGGATTGTTTCACTTAAAGAAAACCCGTTCTCAGAAACACAAATTGAACCGGGTGAAAAACAGAAAAAAGTCTATACACAATCACAACTGAGAACGATTTATCGTATTCTGGAACAATTTCAGCAACAGGAAAATATGCTGCCACCTGATCAGGCTCACTTTCAGGCATGTGCGGTTTATCCCACTCGATTCTGGTTTGCTGTGCTGGAAACGCTGAGGCTGACGGCTATTCGTTTTAACCAGCTGATTAACCTGCATATTGGCGATCTGGATTTTGAGGAGTGTACGATCACATTGCGCAGTGAAAGCAGTAAAAATCACCGGGAATATCAGATTGCTTTTGTTCAGCCACTACGTTGTTTACTGGCGCCCTTGGTTGAGGAAATGCGTTGTCACGGGGCGGATAAAAACGATATTTTGTTTGATGTTCATCGTCTTTATCATAAACGACTATCCCGCTCTGAAACTCCACTCAGTCAGACGATACGTTCTTTTTTCCGTCGTTTATCAAAGGAATGTGGATTTCATGTCAGTCCCCATCGTTTCAGACATACACTGGCGACGACATTAATGAAACATCCTGAACGTAATATGCAATTGACGAAACAGATGTTAGGACACCGTAGTCTCTCTTCAACTATGGAATATATTGCTCTGGATGCATACAGTACAGTCAGGATCTTGGAGAATGAGTTAGGTGAGTTTTTAACAATGGGATTAGGTGGTGAACTTACAAGGCTAGCATCAAAAAGACAGAGGATGTGATATAAATAAAAAACATTTACACAAAGTTGACTATTTTATCAACTTTGTGT