Homologs in group_746

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_07215 EHELCC_07215 100.0 Morganella morganii S2 nit1 deaminated glutathione amidase
NLDBIP_07540 NLDBIP_07540 100.0 Morganella morganii S4 nit1 deaminated glutathione amidase
LHKJJB_07075 LHKJJB_07075 100.0 Morganella morganii S3 nit1 deaminated glutathione amidase
HKOGLL_03855 HKOGLL_03855 100.0 Morganella morganii S5 nit1 deaminated glutathione amidase
F4V73_RS11615 F4V73_RS11615 93.7 Morganella psychrotolerans nit1 deaminated glutathione amidase
PMI_RS18095 PMI_RS18095 79.3 Proteus mirabilis HI4320 - carbon-nitrogen hydrolase family protein

Distribution of the homologs in the orthogroup group_746

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_746

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0DP68 1.25e-144 410 68 2 286 1 nit1 Deaminated glutathione amidase Yersinia enterocolitica
Q557J5 1.23e-57 189 37 6 273 3 nit1-1 Deaminated glutathione amidase Dictyostelium discoideum
P0DP66 5.3e-52 174 37 6 274 1 nit1 Deaminated glutathione amidase Synechocystis sp. (strain PCC 6803 / GT-S)
P55175 5.3e-52 174 37 6 274 3 sll0601 Deaminated glutathione amidase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q94JV5 2.42e-51 173 36 8 271 1 NLP2 Deaminated glutathione amidase, chloroplastic/cytosolic Arabidopsis thaliana
O76463 4.44e-47 166 34 4 266 1 nft-1 Nitrilase and fragile histidine triad fusion protein NitFhit Caenorhabditis elegans
Q8VDK1 6.79e-43 152 35 8 271 1 Nit1 Deaminated glutathione amidase Mus musculus
Q7TQ94 8.39e-43 152 35 8 271 2 Nit1 Deaminated glutathione amidase Rattus norvegicus
Q54JM9 3.84e-42 150 30 6 265 3 nit2 Nitrilase homolog 2 Dictyostelium discoideum
Q86X76 8.58e-42 149 38 4 210 1 NIT1 Deaminated glutathione amidase Homo sapiens
O76464 1.81e-41 151 32 6 274 1 NitFhit Nitrilase and fragile histidine triad fusion protein NitFhit Drosophila melanogaster
P47016 2.74e-41 147 32 7 266 1 NIT2 Deaminated glutathione amidase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q32LH4 6.86e-41 147 33 5 268 2 NIT1 Deaminated glutathione amidase Bos taurus
P49954 2.82e-40 144 30 8 276 1 NIT3 Omega-amidase NIT3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O94660 3.06e-39 141 34 11 281 3 nit2 Probable hydrolase nit2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q10166 3.72e-38 139 31 10 271 3 SPAC26A3.11 Hydrolase C26A3.11 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9NQR4 9.07e-38 137 30 7 272 1 NIT2 Omega-amidase NIT2 Homo sapiens
Q497B0 1.27e-37 137 30 8 275 1 Nit2 Omega-amidase NIT2 Rattus norvegicus
Q9JHW2 2.31e-36 134 29 7 272 1 Nit2 Omega-amidase NIT2 Mus musculus
Q8RUF8 5.01e-35 132 31 5 270 1 NLP3 Omega-amidase, chloroplastic Arabidopsis thaliana
Q28IE5 8.79e-35 129 29 7 272 2 nit2 Omega-amidase NIT2 Xenopus tropicalis
Q6INI7 1.8e-34 129 29 7 272 2 nit2b Omega-amidase NIT2-B Xenopus laevis
Q4VBV9 3.13e-34 128 27 7 272 2 nit2 Omega-amidase NIT2 Danio rerio
Q5R4L6 3.15e-34 128 29 9 275 3 NIT2 Omega-amidase NIT2 Pongo abelii
Q6IR61 2.02e-33 126 30 10 270 2 nit2a Omega-amidase NIT2-A Xenopus laevis
Q2T9R6 1.1e-32 124 27 6 271 2 NIT2 Omega-amidase NIT2 Bos taurus
O59829 6.07e-25 103 26 9 275 3 SPCC965.09 Probable nitrilase C965.09 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q93NG1 4.46e-24 101 28 8 259 1 None 2-oxoglutaramate amidase Paenarthrobacter nicotinovorans
P0DP64 7.26e-21 90 32 4 167 5 ybeM Putative protein YbeM Escherichia coli (strain K12)
A0A140NCB4 2.07e-20 91 32 4 167 1 ybeM Deaminated glutathione amidase Escherichia coli (strain B / BL21-DE3)
P58054 2.07e-20 91 32 4 167 3 ybeM Deaminated glutathione amidase Escherichia coli O157:H7
O31664 4.12e-17 82 25 5 251 1 mtnU 2-oxoglutaramate amidase Bacillus subtilis (strain 168)
P55177 5.78e-16 79 27 6 204 3 None Hydrolase in agr operon Staphylococcus aureus
P0DP65 7.79e-16 78 27 5 201 1 yafV Omega-amidase YafV Staphylococcus aureus (strain 04-02981)
P9WJ01 1.36e-14 75 27 10 276 1 Rv0480c Hydrolase Rv0480c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJ00 1.36e-14 75 27 10 276 3 MT0498 Hydrolase MT0498 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P55178 2.18e-14 74 28 6 201 3 None Hydrolase in agr operon (Fragment) Staphylococcus lugdunensis
Q5NHL7 1.67e-13 72 29 10 221 1 ctu Citrullinase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q42965 3.61e-10 63 25 8 253 2 NIT4A Bifunctional nitrilase/nitrile hydratase NIT4A Nicotiana tabacum
P46011 3.94e-10 63 28 6 164 1 NIT4 Bifunctional nitrilase/nitrile hydratase NIT4 Arabidopsis thaliana
P54608 7.08e-10 62 30 4 150 3 yhcX Probable hydrolase YhcX Bacillus subtilis (strain 168)
Q42966 8.22e-10 62 25 9 252 2 NIT4B Bifunctional nitrilase/nitrile hydratase NIT4B Nicotiana tabacum
Q75SP7 1.07e-09 61 26 10 268 1 ramA (R)-stereoselective amidase Pseudomonas sp.
Q9UYV8 1.13e-09 61 24 8 236 1 PYRAB13990 Nitrilase Pyrococcus abyssi (strain GE5 / Orsay)
P32961 1.15e-09 61 25 5 164 1 NIT1 Nitrilase 1 Arabidopsis thaliana
Q44185 1.52e-09 61 24 9 269 1 None N-carbamoyl-D-amino acid hydrolase Rhizobium radiobacter
P32962 1.76e-09 61 25 5 166 1 NIT2 Nitrilase 2 Arabidopsis thaliana
P60327 1.77e-09 60 24 9 266 1 None N-carbamoyl-D-amino acid hydrolase Agrobacterium sp. (strain KNK712)
Q6H849 6.77e-09 59 29 6 164 2 NIT4 Bifunctional nitrilase/nitrile hydratase NIT4 Oryza sativa subsp. japonica
Q5QGZ8 1.41e-08 58 24 9 253 1 NIT4A Bifunctional nitrilase/nitrile hydratase NIT4A Lupinus angustifolius
Q3LRV4 2.26e-08 57 24 8 253 1 NIT4B Bifunctional nitrilase/nitrile hydratase NIT4B Lupinus angustifolius
Q5S260 4.44e-08 57 25 8 240 1 None N-carbamoyl-D-amino acid hydrolase Ensifer adhaerens
B2USC5 4.91e-08 57 23 7 218 3 amiE Aliphatic amidase Helicobacter pylori (strain Shi470)
Q9ZME1 4.91e-08 57 23 7 218 3 amiE Aliphatic amidase Helicobacter pylori (strain J99 / ATCC 700824)
O25067 5.74e-08 56 24 7 218 1 amiE Aliphatic amidase Helicobacter pylori (strain ATCC 700392 / 26695)
B5ZA60 5.74e-08 56 24 7 218 3 amiE Aliphatic amidase Helicobacter pylori (strain G27)
Q1CUK9 6.01e-08 56 24 7 218 3 amiE Aliphatic amidase Helicobacter pylori (strain HPAG1)
B6JKM3 6.01e-08 56 24 7 218 3 amiE Aliphatic amidase Helicobacter pylori (strain P12)
Q89H51 1.42e-07 55 25 6 227 3 amiF Formamidase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q887D9 1.59e-07 55 25 6 227 3 amiF Formamidase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q17YA2 2.36e-07 54 22 7 218 3 amiE Aliphatic amidase Helicobacter acinonychis (strain Sheeba)
P46010 3.23e-07 54 25 4 152 1 NIT3 Nitrilase 3 Arabidopsis thaliana
Q4ZXA2 4.12e-07 53 24 6 227 3 amiF Formamidase Pseudomonas syringae pv. syringae (strain B728a)
P0DP67 7.58e-07 52 25 13 259 3 yafV Omega-amidase YafV Yersinia enterocolitica
A4Z3G9 9.18e-07 53 24 6 227 3 amiF Formamidase Bradyrhizobium sp. (strain ORS 278)
P55176 1.49e-06 52 31 4 132 3 None Hydrolase in pqqF 5'region Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q8VYF5 2.13e-06 51 24 12 299 1 CPA N-carbamoylputrescine amidase Arabidopsis thaliana
Q5RBM6 4.8e-06 50 26 5 166 2 UPB1 Beta-ureidopropionase Pongo abelii
Q9XGI9 5.49e-06 50 24 9 254 2 CPA N-carbamoylputrescine amidase Solanum lycopersicum
Q9UBR1 6.65e-06 50 26 5 166 1 UPB1 Beta-ureidopropionase Homo sapiens
Q8VC97 9.97e-06 50 25 4 164 1 Upb1 Beta-ureidopropionase Mus musculus
Q3HVN1 1.18e-05 49 24 9 254 2 CPA N-carbamoylputrescine amidase Solanum tuberosum
B9K1J4 1.39e-05 49 24 5 200 3 amiF Formamidase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q03248 2.58e-05 48 24 4 164 1 Upb1 Beta-ureidopropionase Rattus norvegicus
Q47679 6.94e-05 47 32 3 106 3 yafV Omega-amidase YafV Escherichia coli (strain K12)
A0A140NDS5 9.23e-05 46 30 2 106 1 yafV Omega-amidase YafV Escherichia coli (strain B / BL21-DE3)
Q5Z1U0 0.000101 47 21 10 259 3 amiE Aliphatic amidase Nocardia farcinica (strain IFM 10152)
Q39T32 0.000112 47 24 4 199 3 lnt Apolipoprotein N-acyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q9QZ25 0.000118 47 25 4 108 2 Vnn3 Vascular non-inflammatory molecule 3 Mus musculus
A9C011 0.000194 45 22 11 257 3 amiE Aliphatic amidase Delftia acidovorans (strain DSM 14801 / SPH-1)
P61035 0.000206 46 25 7 202 3 lnt Apolipoprotein N-acyltransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8YYI9 0.000493 45 27 6 162 3 lnt Apolipoprotein N-acyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q01360 0.000648 44 23 8 211 1 amiE Aliphatic amidase Rhodococcus erythropolis
A5W2C0 0.000706 44 23 8 221 3 amiE Aliphatic amidase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_03320
Feature type CDS
Gene nit1
Product deaminated glutathione amidase
Location 62781 - 63638 (strand: -1)
Length 858 (nucleotides) / 285 (amino acids)

Contig

Accession contig_3
Length 210665 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_746
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00795 Carbon-nitrogen hydrolase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0388 Energy production and conversion (C) C Omega-amidase YafV/Nit2, hydrolyzes alpha-ketoglutaramate

Protein Sequence

MKNANVALLQLCSGTNIKHNLAQIEQQIKQLPDNIKLVMTPENALIFASGNTYQKYAEVQGEGPLQSAVADMARRYGVWILVGSMPMISREDPARITSSSLLFDDKGEIKARYDKIHMFDVNIDDEQGSYNESKIFQRGEHITVVDTPVGRLGMTICYDLRFPGLFQALREQGAEIISVPAAFTRLTGKSHWEPLLRARAIENQCIILAPAQVGVHGTRRTWGHTMAVDGWGKVMKKNTDAVAAIGVDIRPDSLTSMREQIRVVKHNRFRPQLTSLIEKNTTGKE

Flanking regions ( +/- flanking 50bp)

GAAGAGCCGAAGATAGATGAAGTTTTGCGTCAGTTAAAGGAGACCCGGGAATGAAAAACGCAAATGTGGCTTTATTGCAGCTGTGCAGCGGCACAAATATTAAACACAATTTGGCGCAAATCGAACAACAGATCAAACAACTGCCTGATAATATCAAACTGGTGATGACACCGGAAAATGCGCTGATTTTTGCATCAGGCAACACTTATCAGAAGTACGCGGAAGTGCAGGGCGAAGGCCCGCTGCAGTCAGCGGTGGCTGATATGGCGCGCCGCTACGGGGTGTGGATCCTGGTCGGCTCGATGCCGATGATCAGCCGTGAAGATCCGGCGCGTATCACCAGCAGCAGTCTGCTGTTTGATGATAAAGGGGAAATCAAAGCCCGTTACGACAAAATTCACATGTTTGACGTGAATATCGATGATGAACAGGGTTCATACAATGAATCGAAAATTTTCCAGCGCGGCGAGCACATCACCGTGGTGGATACCCCGGTGGGTCGTCTCGGTATGACCATCTGTTATGATCTGCGTTTCCCGGGACTGTTCCAGGCACTGCGTGAGCAGGGCGCGGAGATTATCTCTGTTCCGGCGGCCTTTACCCGGCTGACCGGTAAATCTCACTGGGAGCCGTTGCTGCGCGCCCGTGCGATTGAAAACCAGTGCATTATCCTGGCACCGGCACAGGTCGGTGTACACGGCACCCGCCGCACATGGGGACACACCATGGCTGTTGACGGCTGGGGCAAAGTGATGAAGAAAAATACGGATGCGGTGGCCGCCATCGGTGTGGATATCCGTCCGGACAGCTTAACCTCAATGCGTGAGCAGATCCGCGTGGTGAAACATAACCGTTTCCGCCCGCAGCTGACCTCACTGATTGAGAAAAACACCACAGGTAAAGAGTAAATTATGAGTTTTTCAACTGTCAGCAATCATCTGCTGACCGCCCATGATCT