Homologs in group_3212

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_03235 EHELCC_03235 100.0 Morganella morganii S2 rhtB Threonine/homoserine/homoserine lactone efflux protein
NLDBIP_00225 NLDBIP_00225 100.0 Morganella morganii S4 rhtB Threonine/homoserine/homoserine lactone efflux protein
LHKJJB_01810 LHKJJB_01810 100.0 Morganella morganii S3 rhtB Threonine/homoserine/homoserine lactone efflux protein
HKOGLL_01850 HKOGLL_01850 100.0 Morganella morganii S5 rhtB Threonine/homoserine/homoserine lactone efflux protein

Distribution of the homologs in the orthogroup group_3212

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3212

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AG38 1.03e-08 56 29 1 124 1 rhtC Threonine efflux protein Escherichia coli (strain K12)
P0AG39 1.03e-08 56 29 1 124 3 rhtC Threonine efflux protein Escherichia coli O157:H7
Q9L6N7 1.11e-06 50 27 2 126 3 rhtC Threonine efflux protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z3B3 1.11e-06 50 27 2 126 3 rhtC Threonine efflux protein Salmonella typhi
Q1RAZ2 3.86e-06 49 25 1 115 3 leuE Leucine efflux protein Escherichia coli (strain UTI89 / UPEC)
Q8FGV4 3.86e-06 49 25 1 115 3 leuE Leucine efflux protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TH31 3.86e-06 49 25 1 115 3 leuE Leucine efflux protein Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ABX2 3.86e-06 49 25 1 115 3 leuE Leucine efflux protein Escherichia coli O1:K1 / APEC
Q32FT6 4.64e-06 48 23 1 141 3 leuE Leucine efflux protein Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z2D8 4.73e-06 48 23 1 141 3 leuE Leucine efflux protein Shigella sonnei (strain Ss046)
A7ZMR9 4.73e-06 48 23 1 141 3 leuE Leucine efflux protein Escherichia coli O139:H28 (strain E24377A / ETEC)
P76249 5.26e-06 48 25 1 115 1 leuE Leucine efflux protein Escherichia coli (strain K12)
A8A0Z3 5.26e-06 48 25 1 115 3 leuE Leucine efflux protein Escherichia coli O9:H4 (strain HS)
Q8XDS6 8.19e-06 48 23 1 141 3 leuE Leucine efflux protein Escherichia coli O157:H7
Q9KVK7 8.26e-06 48 24 5 204 3 VC_0136 Uncharacterized membrane protein VC_0136 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0AG37 1.62e-05 47 26 5 212 3 rhtB Homoserine/homoserine lactone efflux protein Shigella flexneri
P0AG34 1.62e-05 47 26 5 212 1 rhtB Homoserine/homoserine lactone efflux protein Escherichia coli (strain K12)
P0AG35 1.62e-05 47 26 5 212 3 rhtB Homoserine/homoserine lactone efflux protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AG36 1.62e-05 47 26 5 212 3 rhtB Homoserine/homoserine lactone efflux protein Escherichia coli O157:H7
P38102 2.89e-05 47 23 2 119 3 PA4757 Uncharacterized membrane protein PA4757 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A8AHJ0 4.19e-05 46 25 1 115 3 leuE Leucine efflux protein Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q321T8 5.37e-05 45 25 1 112 5 leuE Putative leucine efflux protein Shigella boydii serotype 4 (strain Sb227)
Q7CQP8 0.00036 43 23 2 144 3 leuE Leucine efflux protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XEV9 0.00036 43 23 2 144 3 leuE Leucine efflux protein Salmonella typhi
Q5PHF4 0.00036 43 23 2 144 3 leuE Leucine efflux protein Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57Q25 0.00036 43 23 2 144 3 leuE Leucine efflux protein Salmonella choleraesuis (strain SC-B67)
Q9L6N6 0.000719 42 25 6 199 3 rhtB Homoserine/homoserine lactone efflux protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_02765
Feature type CDS
Gene rhtB
Product Threonine/homoserine/homoserine lactone efflux protein
Location 249654 - 250289 (strand: -1)
Length 636 (nucleotides) / 211 (amino acids)
In genomic island -

Contig

Accession contig_2
Length 292399 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3212
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF01810 LysE type translocator

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1280 Amino acid transport and metabolism (E) E Threonine/homoserine/homoserine lactone efflux protein

Protein Sequence

MTGNLQGILGLVITSSVLIAIPGPSILFLVGQALSAGKKNALKGVAGNTIGMYSIAVLLSFGIGAVLMSSPQILMIIRLIGAFVLLLIGWQYVRASRISMAMDVPADKGHQSFFADIIVGAANPKSVIMFGTIVPGFTGEIPPEMSATTVLLLMSLIPIALGIVIDIIWVYTAHAVKSASFFRGNSLRWFNLCGGILMILMALLLAVASVI

Flanking regions ( +/- flanking 50bp)

ATCAGGGATCAGTTGCTGCGGGCCACAGACTATTTTACCGGTCAGGGGTCATGACCGGTAATTTACAGGGTATTCTGGGGCTGGTGATCACCAGCTCCGTGCTGATTGCCATTCCGGGGCCGAGTATTTTGTTTCTGGTCGGCCAGGCGTTATCTGCCGGGAAGAAAAATGCCCTGAAAGGCGTTGCCGGGAATACCATCGGTATGTACAGCATCGCGGTATTGCTTTCTTTCGGAATTGGCGCGGTGCTGATGTCTTCTCCGCAGATCCTGATGATTATCCGTCTGATCGGGGCATTCGTCCTGTTGCTGATTGGCTGGCAGTATGTCCGGGCATCCCGGATCAGTATGGCGATGGATGTTCCGGCTGACAAAGGCCATCAGTCATTTTTTGCTGATATTATTGTCGGGGCTGCGAACCCGAAATCTGTGATTATGTTCGGTACGATTGTCCCCGGATTTACCGGTGAAATTCCGCCGGAGATGTCCGCTACCACTGTGTTGCTGCTGATGTCGCTGATCCCGATAGCCCTGGGCATTGTTATCGATATTATCTGGGTTTATACCGCACATGCTGTTAAATCCGCGTCATTTTTCCGGGGGAACAGTCTGCGCTGGTTTAATCTGTGCGGCGGTATCCTGATGATCCTTATGGCATTACTGCTGGCGGTGGCATCGGTGATTTAATCCTCACCGGTAACCGGCGTATACACCAGTAACCGGTTGGATTTATCGAT