Homologs in group_3166

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_01085 EHELCC_01085 100.0 Morganella morganii S2 ehuA ABC-type polar amino acid transport system, ATPase component
NLDBIP_02375 NLDBIP_02375 100.0 Morganella morganii S4 ehuA ABC-type polar amino acid transport system, ATPase component
LHKJJB_03890 LHKJJB_03890 100.0 Morganella morganii S3 ehuA ABC-type polar amino acid transport system, ATPase component
HKOGLL_03155 HKOGLL_03155 100.0 Morganella morganii S5 ehuA ABC-type polar amino acid transport system, ATPase component

Distribution of the homologs in the orthogroup group_3166

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3166

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P27675 2.53e-101 297 58 0 240 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
O34677 1.23e-99 293 58 0 240 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
P54537 4.97e-99 291 60 0 240 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
P37774 3.92e-92 274 55 1 245 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
O34900 6.38e-91 271 54 2 242 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
P39456 6.73e-89 266 54 1 244 1 tcyC L-cystine import ATP-binding protein TcyC Bacillus subtilis (strain 168)
P10346 3.61e-88 263 55 0 239 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q8NQU4 1.73e-87 262 53 1 250 1 argV Arginine transport ATP-binding protein ArgV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q52815 1.77e-86 260 51 0 239 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P48243 2.64e-86 259 52 0 240 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8RQL7 2.2e-85 256 52 0 240 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P35116 2.71e-85 257 53 2 247 3 nocP Nopaline permease ATP-binding protein P Agrobacterium fabrum (strain C58 / ATCC 33970)
P55662 3.08e-85 256 54 3 251 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P45769 3.59e-85 256 51 0 240 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
P45022 8.6e-85 255 54 2 242 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q52666 6.47e-84 253 50 0 239 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0A2V2 1.26e-83 253 50 2 248 2 occP Octopine permease ATP-binding protein P Rhizobium radiobacter
P0A2V3 1.26e-83 253 50 2 248 3 occP Octopine permease ATP-binding protein P Agrobacterium tumefaciens (strain Ach5)
P02915 1.86e-82 249 54 2 248 1 hisP Histidine/lysine/arginine/ornithine transport ATP-binding protein HisP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A1VZQ5 4.77e-82 248 49 2 241 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q0P9X7 6.41e-82 248 49 2 241 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P0AAG3 9.19e-81 244 53 0 240 3 gltL Glutamate/aspartate import ATP-binding protein GltL Escherichia coli (strain K12)
P0AAG4 9.19e-81 244 53 0 240 3 gltL Glutamate/aspartate import ATP-binding protein GltL Escherichia coli O157:H7
O30506 2.58e-80 244 51 2 247 3 aotP Arginine/ornithine transport ATP-binding protein AotP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P72297 3.34e-80 244 50 2 248 3 occP Octopine permease ATP-binding protein P Rhizobium meliloti
P07109 1.23e-79 242 53 2 248 1 hisP Histidine/lysine/arginine/ornithine transport ATP-binding protein HisP Escherichia coli (strain K12)
P54954 1.36e-79 242 50 1 242 1 yxeO Probable amino-acid import ATP-binding protein YxeO Bacillus subtilis (strain 168)
Q9HZS1 2.1e-76 234 51 3 249 3 hisP Histidine transport ATP-binding protein HisP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8FV85 3.46e-65 209 43 3 238 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 3.46e-65 209 43 3 238 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 3.46e-65 209 43 3 238 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 3.46e-65 209 43 3 238 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
P45092 6.5e-65 204 43 3 242 3 artP Arginine transport ATP-binding protein ArtP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AAF9 3.71e-64 202 45 2 240 3 artP Arginine transport ATP-binding protein ArtP Shigella flexneri
P0AAF6 3.71e-64 202 45 2 240 1 artP Arginine transport ATP-binding protein ArtP Escherichia coli (strain K12)
P0AAF7 3.71e-64 202 45 2 240 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF8 3.71e-64 202 45 2 240 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O157:H7
Q0AU85 1.04e-63 205 43 4 246 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q63H29 4.64e-63 203 43 4 243 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q73F11 7.7e-63 202 43 4 243 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8NSN2 1.19e-62 202 43 3 233 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q81VM2 1.23e-62 202 43 4 243 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q1BR30 1.89e-62 203 49 3 228 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
A0B344 1.89e-62 203 49 3 228 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
Q39AT4 4.79e-62 202 48 3 228 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q81IZ6 5.62e-62 200 42 4 243 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q7VV72 9.03e-62 200 43 4 243 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 9.03e-62 200 43 4 243 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 9.03e-62 200 43 4 243 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q6NJ07 2.16e-61 199 43 3 230 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q1M8E0 2.41e-61 199 46 3 238 3 metN Methionine import ATP-binding protein MetN Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q0B6I6 1.39e-60 198 46 4 240 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q8ELA5 1.67e-60 196 43 4 246 3 metN4 Methionine import ATP-binding protein MetN 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5NFU5 2.94e-60 196 43 5 242 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q0BMC9 3.17e-60 196 43 5 242 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 3.17e-60 196 43 5 242 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q7N8M2 7.64e-60 195 42 4 243 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q4JTG9 7.78e-60 195 43 3 228 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q2KVK2 1.1e-59 195 43 4 243 3 metN Methionine import ATP-binding protein MetN Bordetella avium (strain 197N)
Q14H97 1.22e-59 194 42 5 242 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
Q5WKL3 1.24e-59 194 44 4 230 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q98DA2 1.72e-59 194 45 3 241 3 metN Methionine import ATP-binding protein MetN Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q97KD5 1.89e-59 193 43 3 231 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q832Y6 3.66e-59 193 41 4 242 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q2K284 5.34e-59 193 45 3 241 3 metN Methionine import ATP-binding protein MetN Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2RWA3 6.18e-59 192 46 3 232 3 metN Methionine import ATP-binding protein MetN Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q0SFW6 7.98e-59 192 45 3 223 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q6AE21 8.24e-59 192 43 4 244 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q6N798 2.06e-58 192 42 4 241 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q5E715 6.88e-58 190 42 4 246 3 metN Methionine import ATP-binding protein MetN Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8FRX8 7.39e-58 190 42 3 229 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q1LQF6 9.3e-58 189 42 4 246 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q2NRN5 9.66e-58 189 41 4 246 3 metN Methionine import ATP-binding protein MetN Sodalis glossinidius (strain morsitans)
P44785 1.02e-57 189 42 4 242 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QMH4 1.17e-57 189 42 4 242 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q5KVK2 1.22e-57 189 42 3 235 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q8DFC3 1.23e-57 189 42 4 246 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
Q7MN25 1.4e-57 189 42 4 246 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
Q6A6X6 1.56e-57 189 43 6 243 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q6D1C4 2.52e-57 188 41 4 246 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q81IN8 3.88e-57 187 40 4 246 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6HP89 5.91e-57 187 40 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81ZF5 6.24e-57 187 40 4 246 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q667L9 7.01e-57 187 41 5 246 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q65M34 7.42e-57 187 42 3 228 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q38WL5 8.28e-57 187 43 3 226 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q87RS1 8.55e-57 187 42 5 246 1 metN Methionine import ATP-binding protein MetN Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6FAN3 1.04e-56 187 43 4 237 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q88UV2 1.06e-56 187 41 4 243 3 metN2 Methionine import ATP-binding protein MetN 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8EPK1 1.06e-56 186 40 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q65VG9 1.23e-56 186 42 4 242 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q827Y0 1.32e-56 186 42 5 248 3 metN Methionine import ATP-binding protein MetN Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q0I5E9 1.38e-56 186 42 6 243 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q49W48 1.97e-56 186 40 4 242 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q895C4 2.1e-56 185 43 3 230 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q24QI5 2.51e-56 186 41 4 246 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q73EL7 2.7e-56 186 39 4 246 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q63GR8 2.76e-56 186 39 4 246 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q3A9G5 5.04e-56 185 39 4 245 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q74IV9 5.28e-56 185 40 3 246 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q13LD8 9.62e-56 185 44 4 239 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q1CFH7 1.11e-55 184 40 5 246 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 1.11e-55 184 40 5 246 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 1.11e-55 184 40 5 246 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q5WVL8 1.13e-55 184 43 3 231 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q9CK97 1.21e-55 184 44 3 222 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q53I83 1.38e-55 184 43 4 239 3 metN Methionine import ATP-binding protein MetN Streptomyces griseus
O32169 1.49e-55 184 40 4 245 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q5ZUG5 1.61e-55 184 43 3 231 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8G5P8 1.94e-55 185 44 3 223 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q4KK46 3.35e-55 184 42 3 235 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3JHC9 7.24e-55 183 46 3 227 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain 1710b)
Q63NI4 7.4e-55 183 46 3 227 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain K96243)
Q7VM95 7.59e-55 182 41 6 243 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q62B84 7.97e-55 183 46 3 227 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia mallei (strain ATCC 23344)
Q32JQ8 8.6e-55 182 39 4 246 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q12B04 8.61e-55 182 40 4 246 3 metN Methionine import ATP-binding protein MetN Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q13VD7 8.64e-55 182 40 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
P30750 8.88e-55 182 39 4 246 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q5PID0 8.98e-55 182 39 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9L1C3 9.09e-55 182 41 5 248 3 metN Methionine import ATP-binding protein MetN Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q48PU6 1.01e-54 181 41 5 243 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q21BU8 1.07e-54 182 41 5 246 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q0TLD2 1.16e-54 181 39 4 246 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3Z5F8 1.19e-54 181 39 4 246 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 1.19e-54 181 39 4 246 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 1.19e-54 181 39 4 246 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 1.19e-54 181 39 4 246 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
Q9HT70 1.23e-54 181 43 2 216 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 1.23e-54 181 43 2 216 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q831K6 1.25e-54 181 40 4 244 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q325U1 1.38e-54 181 39 4 246 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
Q02ME3 1.39e-54 182 42 4 239 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q4L4R9 1.46e-54 181 41 4 242 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q9A502 1.46e-54 181 42 4 240 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q89LP2 1.57e-54 181 41 3 230 3 metN Methionine import ATP-binding protein MetN Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6F9P2 2.08e-54 181 42 5 246 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q57T09 2.14e-54 181 39 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella choleraesuis (strain SC-B67)
Q8Z990 2.21e-54 181 39 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhi
Q8ZRM9 2.34e-54 181 39 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q83MC5 2.49e-54 181 39 4 246 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 2.49e-54 181 39 4 246 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
Q39IE7 2.61e-54 181 41 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q6G2E2 4.06e-54 180 40 4 244 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q88RL5 4.16e-54 180 44 4 219 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q18C09 4.57e-54 179 40 3 226 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q4ZZR8 4.89e-54 179 41 5 243 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q46Y69 4.98e-54 180 41 4 246 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q5X484 5.19e-54 179 42 3 231 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
Q8RFN2 5.69e-54 179 38 4 242 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q3KK97 6.13e-54 179 41 5 243 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain Pf0-1)
Q87AL9 7.05e-54 179 40 4 242 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q4KKK8 7.36e-54 179 41 5 243 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9ZJ34 7.9e-54 179 38 4 239 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain J99 / ATCC 700824)
Q8NY21 8.69e-54 179 38 3 236 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 8.69e-54 179 38 3 236 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q5YRD1 9.38e-54 179 45 3 227 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q1IGZ0 1.01e-53 179 41 5 243 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q7A7E3 1.08e-53 179 37 3 237 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 1.08e-53 179 37 3 237 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q65F80 1.09e-53 179 40 4 245 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q6LN52 1.22e-53 179 41 4 246 3 metN Methionine import ATP-binding protein MetN Photobacterium profundum (strain SS9)
Q87UN4 1.32e-53 178 45 4 212 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8YA75 1.42e-53 178 40 5 242 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8NXH5 1.66e-53 178 44 3 219 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q6GB18 1.66e-53 178 44 3 219 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q5HHK4 1.66e-53 178 44 3 219 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q2FZZ2 1.66e-53 178 44 3 219 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FII2 1.66e-53 178 44 3 219 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
Q87UV4 1.76e-53 179 42 3 230 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q92EZ6 1.78e-53 178 39 5 242 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q724C0 1.8e-53 178 40 5 242 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q2YWP2 2.05e-53 178 44 3 219 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8P4S7 2.07e-53 178 41 5 243 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQD2 2.07e-53 178 41 5 243 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain 8004)
Q3KJS6 2.31e-53 179 42 3 230 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q5HQQ9 2.44e-53 178 40 4 242 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9I1C8 2.51e-53 179 41 4 239 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0BH79 2.55e-53 178 41 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
O26096 2.69e-53 177 38 4 239 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain ATCC 700392 / 26695)
Q5HIL5 2.77e-53 178 38 3 236 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 2.77e-53 178 38 3 236 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 2.77e-53 178 38 3 236 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q7A6M2 2.8e-53 178 44 3 219 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q99VG8 2.8e-53 178 44 3 219 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8CQS7 2.87e-53 177 39 4 246 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRU5 2.87e-53 177 39 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GIH9 2.96e-53 177 43 3 219 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
Q6GJL2 3.06e-53 177 37 3 237 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q6D201 4.02e-53 177 41 6 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1CR30 4.66e-53 177 38 4 239 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain HPAG1)
Q47RE8 5.32e-53 176 43 5 233 3 metN Methionine import ATP-binding protein MetN Thermobifida fusca (strain YX)
Q17VE0 6.23e-53 176 38 4 239 3 metN Methionine import ATP-binding protein MetN Helicobacter acinonychis (strain Sheeba)
Q043Y8 6.27e-53 177 39 3 246 3 metN Methionine import ATP-binding protein MetN Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q1QVQ7 7.55e-53 177 40 4 246 3 metN Methionine import ATP-binding protein MetN Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q0KDG3 7.63e-53 177 40 4 246 3 metN Methionine import ATP-binding protein MetN Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q63S19 8.77e-53 176 40 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 8.77e-53 176 40 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 8.77e-53 176 40 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
Q8CTB2 9.54e-53 176 40 4 242 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P56344 9.6e-53 173 39 4 239 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q48PN3 1.07e-52 177 41 3 230 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1BY14 1.18e-52 176 41 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 1.18e-52 176 41 4 246 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
Q3J1N0 1.2e-52 176 41 3 234 3 metN Methionine import ATP-binding protein MetN Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q7UC29 1.29e-52 177 42 3 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q2YVT7 1.33e-52 176 37 3 237 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KTJ5 1.41e-52 176 39 4 246 3 metN Methionine import ATP-binding protein MetN Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8U6M1 2.07e-52 176 43 3 232 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q04DA7 2.44e-52 176 39 4 247 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q1IGN4 2.88e-52 176 42 3 223 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas entomophila (strain L48)
Q8FFB3 3e-52 176 41 3 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P16676 3.31e-52 176 41 3 242 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q6N9W0 3.38e-52 176 41 3 234 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8XBJ8 3.64e-52 176 41 3 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q8PGE8 4.14e-52 174 39 4 243 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q89UD2 4.25e-52 175 39 4 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q21XK2 6.01e-52 174 40 3 229 3 metN Methionine import ATP-binding protein MetN Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q2SY12 6.39e-52 174 39 4 246 3 metN Methionine import ATP-binding protein MetN Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8E8K8 6.48e-52 174 40 4 243 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q03Z27 8.16e-52 174 42 4 232 3 metN Methionine import ATP-binding protein MetN Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q9RYZ3 8.31e-52 171 39 6 247 3 pstB Phosphate import ATP-binding protein PstB Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q8D0W8 9.59e-52 174 41 3 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q3BNZ3 1.12e-51 173 39 4 243 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q88RB3 1.15e-51 174 41 3 223 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q72Y96 1.27e-51 173 40 4 245 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q668K6 1.55e-51 174 41 3 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q5HAV5 1.67e-51 171 40 6 243 3 pstB Phosphate import ATP-binding protein PstB Ehrlichia ruminantium (strain Welgevonden)
Q5FFT1 1.67e-51 171 40 6 243 3 pstB Phosphate import ATP-binding protein PstB Ehrlichia ruminantium (strain Gardel)
Q2K8C8 1.71e-51 173 43 3 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8ELQ6 1.95e-51 173 38 4 245 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q2P7S3 2.05e-51 173 39 4 243 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q631Y4 2.15e-51 173 40 4 245 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ZK / E33L)
Q81XL3 2.22e-51 173 40 4 245 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus anthracis
P74548 2.73e-51 173 39 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5H503 2.8e-51 172 39 4 243 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q6HBS0 3.06e-51 172 40 4 245 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8U7G2 3.32e-51 173 42 5 246 3 metN Methionine import ATP-binding protein MetN Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4ZZK0 3.4e-51 173 40 3 230 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. syringae (strain B728a)
Q9PF03 3.69e-51 172 40 5 242 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain 9a5c)
Q1DDP4 3.79e-51 172 43 4 216 3 metN Methionine import ATP-binding protein MetN Myxococcus xanthus (strain DK1622)
Q9K789 3.83e-51 172 39 4 245 3 metN Methionine import ATP-binding protein MetN Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q1WVG9 3.91e-51 172 40 4 229 3 metN Methionine import ATP-binding protein MetN Ligilactobacillus salivarius (strain UCC118)
Q92LX3 3.97e-51 172 40 5 241 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q1B677 4.36e-51 172 41 3 231 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q5WJP0 5.28e-51 172 42 3 223 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q815Y7 5.4e-51 172 39 4 245 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8DRF9 5.51e-51 172 39 4 242 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q03P57 5.64e-51 172 41 3 223 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q88WA5 6.17e-51 172 40 4 225 3 metN1 Methionine import ATP-binding protein MetN 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q14Q07 7.6e-51 172 41 4 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q5PCG9 8.29e-51 171 41 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ENU2 8.41e-51 171 37 4 246 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8Z8R5 9.43e-51 171 41 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q5YZY9 1.03e-50 171 40 3 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q88AS5 1.21e-50 171 41 5 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8ZR89 1.33e-50 171 41 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q578K3 1.34e-50 171 41 3 236 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 1.34e-50 171 41 3 236 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q83F44 1.63e-50 171 41 4 241 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q6D3Q6 1.66e-50 171 42 3 223 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q03ZQ0 1.79e-50 171 40 3 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q8DIA0 1.8e-50 170 39 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q7N6Z2 2.27e-50 171 39 3 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8E3S0 2.77e-50 171 39 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype III (strain NEM316)
Q4KBU0 2.92e-50 169 41 4 240 3 metN3 Methionine import ATP-binding protein MetN 3 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q92VJ2 2.98e-50 171 40 4 242 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q57S53 3.2e-50 170 41 4 231 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q5FA19 3.5e-50 170 39 2 236 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q134N9 3.68e-50 171 41 3 234 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q88CL2 3.72e-50 169 41 6 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q93DX8 3.74e-50 167 38 5 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
A3DDF6 4.11e-50 170 39 3 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8DY54 4.2e-50 170 39 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZP8 4.2e-50 170 39 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P40860 5.11e-50 170 40 3 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9I6L0 5.77e-50 169 40 5 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8Z4V6 5.86e-50 170 40 3 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q12XW6 8.01e-50 166 39 5 245 3 pstB Phosphate import ATP-binding protein PstB Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q7NWX3 8.83e-50 169 40 3 236 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q03A07 8.93e-50 169 39 5 234 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q97T09 1.06e-49 169 39 4 242 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8Y0X3 1.45e-49 168 40 5 247 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q07LR5 1.57e-49 169 40 3 234 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisA53)
Q5HV18 1.81e-49 168 36 5 255 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni (strain RM1221)
Q0PAB6 1.81e-49 168 36 5 255 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9JUX4 1.81e-49 168 37 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q0SFY5 1.92e-49 168 38 4 235 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodococcus jostii (strain RHA1)
D8KFN1 2.25e-49 168 38 7 259 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain NZ9000)
P0CI33 2.25e-49 168 38 7 259 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain MG1363)
Q8FVV5 2.46e-49 168 41 3 236 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q834B4 2.75e-49 165 39 7 249 3 pstB1 Phosphate import ATP-binding protein PstB 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q9JZW0 2.95e-49 168 37 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q82WT5 3.09e-49 168 39 4 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8F6Z1 3.31e-49 167 40 5 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 3.31e-49 167 40 5 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8P2K6 3.33e-49 167 38 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q9KFL0 3.33e-49 164 39 5 236 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q4W575 5.03e-49 167 39 2 236 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 5.03e-49 167 39 2 236 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q6F9A8 5.98e-49 167 38 4 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A0PY57 6.21e-49 167 36 3 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q92WJ0 6.25e-49 167 41 3 233 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q67SV5 7.57e-49 166 41 4 217 3 metN Methionine import ATP-binding protein MetN Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8Y4L8 8.75e-49 166 38 5 245 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8YCG3 9.89e-49 166 41 3 236 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q71X09 1.22e-48 166 38 5 245 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
Q5FKL2 1.32e-48 166 38 4 236 3 metN Methionine import ATP-binding protein MetN Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q9CIN4 1.62e-48 166 38 7 259 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. lactis (strain IL1403)
Q8GEH7 1.62e-48 165 41 3 213 3 metN Methionine import ATP-binding protein MetN Erwinia pyrifoliae (strain DSM 12162 / Ep1/96)
Q032A0 1.88e-48 166 38 7 259 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain SK11)
Q8Z0H0 1.94e-48 165 38 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7NIW1 1.95e-48 165 38 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9K876 2.4e-48 166 39 4 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5LS19 2.5e-48 163 39 6 238 3 pstB Phosphate import ATP-binding protein PstB Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5XDS8 2.51e-48 165 38 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1JNE0 2.8e-48 165 38 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 2.8e-48 165 38 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q6F0V4 3.11e-48 165 39 4 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q65T42 3.31e-48 165 39 4 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q2SSS4 3.99e-48 165 37 4 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q928L8 4e-48 164 38 5 245 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q609Q1 4.36e-48 164 39 6 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1IMC7 4.48e-48 162 39 5 247 3 pstB Phosphate import ATP-binding protein PstB Koribacter versatilis (strain Ellin345)
Q48V78 5.03e-48 164 38 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 5.03e-48 164 38 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q7VI92 5.05e-48 164 37 4 240 3 metN Methionine import ATP-binding protein MetN Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q1J0N0 5.07e-48 161 39 6 237 3 pstB Phosphate import ATP-binding protein PstB Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q9MUN1 5.88e-48 164 37 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q3J376 6.12e-48 162 38 6 247 3 pstB Phosphate import ATP-binding protein PstB Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q6MU19 6.32e-48 164 37 4 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q04B25 6.46e-48 164 40 4 237 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAN9 6.81e-48 164 40 4 237 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P14788 7.85e-48 164 38 3 239 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q93DA2 8.5e-48 164 39 4 228 3 metN Methionine import ATP-binding protein MetN Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9S4Z0 1.02e-47 162 43 5 221 3 metN Methionine import ATP-binding protein MetN Salmonella enteritidis
P0CZ31 1.02e-47 164 38 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ30 1.02e-47 164 38 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q0I3Y9 1.17e-47 164 37 3 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q7CHF8 1.32e-47 163 39 4 233 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis
Q1C970 1.32e-47 163 39 4 233 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q66CQ3 1.32e-47 163 39 4 233 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CG91 1.32e-47 163 39 4 233 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q2LVM2 1.37e-47 159 42 6 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Syntrophus aciditrophicus (strain SB)
Q2NHW1 1.52e-47 160 38 6 249 3 pstB Phosphate import ATP-binding protein PstB Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q1GH74 1.55e-47 160 39 6 238 3 pstB Phosphate import ATP-binding protein PstB Ruegeria sp. (strain TM1040)
Q1J8E4 1.61e-47 163 38 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JII9 1.67e-47 163 38 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q81GU1 1.83e-47 163 37 5 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q7NZI7 1.87e-47 160 39 4 245 3 pstB Phosphate import ATP-binding protein PstB Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q58418 2e-47 160 40 7 246 3 pstB Phosphate import ATP-binding protein PstB Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q63TY1 2.03e-47 163 38 6 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q2KVN7 2.19e-47 160 39 5 246 3 pstB Phosphate import ATP-binding protein PstB Bordetella avium (strain 197N)
Q7M9G3 2.49e-47 160 40 6 245 3 pstB Phosphate import ATP-binding protein PstB Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q5WET8 2.57e-47 160 39 7 239 3 pstB1 Phosphate import ATP-binding protein PstB 1 Shouchella clausii (strain KSM-K16)
Q62K82 2.76e-47 162 38 6 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q8PC11 3.35e-47 162 38 5 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9TKX3 3.39e-47 162 37 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
O31339 4.88e-47 162 37 5 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q65HC0 4.88e-47 159 39 7 247 3 pstB1 Phosphate import ATP-binding protein PstB 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q9CM47 5.23e-47 167 39 6 230 3 macB Macrolide export ATP-binding/permease protein MacB Pasteurella multocida (strain Pm70)
Q0SVB6 5.9e-47 159 39 7 246 3 pstB Phosphate import ATP-binding protein PstB Clostridium perfringens (strain SM101 / Type A)
Q8XMP8 5.9e-47 159 39 7 246 3 pstB Phosphate import ATP-binding protein PstB Clostridium perfringens (strain 13 / Type A)
Q0TTG6 5.9e-47 159 39 7 246 3 pstB Phosphate import ATP-binding protein PstB Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q74KF8 5.96e-47 159 38 7 247 3 pstB2 Phosphate import ATP-binding protein PstB 2 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q7VZ66 7.39e-47 159 38 5 246 3 pstB Phosphate import ATP-binding protein PstB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W8Q6 8.14e-47 159 38 5 246 3 pstB Phosphate import ATP-binding protein PstB Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WMC3 8.14e-47 159 38 5 246 3 pstB Phosphate import ATP-binding protein PstB Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q72D46 9.2e-47 158 40 9 249 3 pstB Phosphate import ATP-binding protein PstB Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q7M816 9.21e-47 160 39 4 223 3 metN Methionine import ATP-binding protein MetN Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q49XI8 9.51e-47 159 37 6 245 3 pstB Phosphate import ATP-binding protein PstB Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P9WQM1 9.64e-47 161 38 3 239 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 9.64e-47 161 38 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 9.64e-47 161 38 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P46342 1.01e-46 158 38 7 245 3 pstB1 Phosphate import ATP-binding protein PstB 1 Bacillus subtilis (strain 168)
Q73XU8 1.11e-46 161 38 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q97IE0 1.22e-46 158 38 7 249 3 pstB Phosphate import ATP-binding protein PstB Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q64SM5 1.27e-46 158 39 7 239 3 pstB Phosphate import ATP-binding protein PstB Bacteroides fragilis (strain YCH46)
Q5LBQ4 1.27e-46 158 39 7 239 3 pstB Phosphate import ATP-binding protein PstB Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q5WDP1 1.27e-46 160 36 4 245 3 metN3 Methionine import ATP-binding protein MetN 3 Shouchella clausii (strain KSM-K16)
Q92XW1 1.3e-46 160 37 3 241 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q9HY19 1.56e-46 161 38 5 242 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8YYE2 1.57e-46 158 40 7 252 3 pstB2 Phosphate import ATP-binding protein PstB 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P63372 1.64e-46 157 38 6 243 3 pstB3 Phosphate import ATP-binding protein PstB 3 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P63371 1.64e-46 157 38 6 243 3 pstB3 Phosphate import ATP-binding protein PstB 3 Streptococcus agalactiae serotype III (strain NEM316)
Q8XZP8 1.68e-46 161 38 5 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q02R79 1.72e-46 160 38 5 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9G4F5 1.73e-46 160 39 4 243 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q3M4H5 1.75e-46 158 40 7 252 3 pstB5 Phosphate import ATP-binding protein PstB 5 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q38YC1 2.01e-46 157 38 7 247 3 pstB2 Phosphate import ATP-binding protein PstB 2 Latilactobacillus sakei subsp. sakei (strain 23K)
Q166A0 2.1e-46 158 37 6 247 3 pstB Phosphate import ATP-binding protein PstB Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q2YXY2 2.16e-46 158 37 6 245 3 pstB Phosphate import ATP-binding protein PstB Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GH21 2.26e-46 158 37 6 245 3 pstB Phosphate import ATP-binding protein PstB Staphylococcus aureus (strain MRSA252)
Q8DU24 2.36e-46 157 38 7 247 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P69880 2.49e-46 158 37 6 245 3 pstB Phosphate import ATP-binding protein PstB Staphylococcus aureus (strain MW2)
Q6G9H4 2.49e-46 158 37 6 245 3 pstB Phosphate import ATP-binding protein PstB Staphylococcus aureus (strain MSSA476)
P69879 2.49e-46 158 37 6 245 3 pstB Phosphate import ATP-binding protein PstB Staphylococcus aureus (strain N315)
P69878 2.49e-46 158 37 6 245 3 pstB Phosphate import ATP-binding protein PstB Staphylococcus aureus (strain Mu50 / ATCC 700699)
P69881 2.49e-46 158 37 6 245 3 pstB Phosphate import ATP-binding protein PstB Staphylococcus aureus (strain COL)
Q2FYQ0 2.49e-46 158 37 6 245 3 pstB Phosphate import ATP-binding protein PstB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH51 2.49e-46 158 37 6 245 3 pstB Phosphate import ATP-binding protein PstB Staphylococcus aureus (strain USA300)
Q5M5Z2 2.71e-46 160 38 5 230 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q87DT9 3.03e-46 160 36 4 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q1D320 3.19e-46 157 38 6 246 3 pstB Phosphate import ATP-binding protein PstB Myxococcus xanthus (strain DK1622)
Q895Y0 3.2e-46 157 36 7 247 3 pstB Phosphate import ATP-binding protein PstB Clostridium tetani (strain Massachusetts / E88)
Q74E68 3.22e-46 157 40 8 245 3 pstB Phosphate import ATP-binding protein PstB Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q221H2 3.22e-46 157 39 4 245 3 pstB Phosphate import ATP-binding protein PstB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q2RM86 3.26e-46 157 38 6 247 3 pstB Phosphate import ATP-binding protein PstB Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2RWU0 3.5e-46 157 38 6 245 3 pstB Phosphate import ATP-binding protein PstB Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
O31711 4.25e-46 156 40 5 220 1 yknY Uncharacterized ABC transporter ATP-binding protein YknY Bacillus subtilis (strain 168)
Q3AAA4 4.89e-46 156 40 7 248 3 pstB Phosphate import ATP-binding protein PstB Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q7WGW1 4.96e-46 159 38 4 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9X196 5.12e-46 160 37 3 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8R9I2 6.11e-46 156 38 7 248 3 pstB2 Phosphate import ATP-binding protein PstB 2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8E9I8 6.38e-46 156 39 7 246 3 pstB2 Phosphate import ATP-binding protein PstB 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q2W7J9 6.42e-46 156 39 7 247 3 pstB2 Phosphate import ATP-binding protein PstB 2 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q8TUR7 7.32e-46 156 38 6 247 3 pstB Phosphate import ATP-binding protein PstB Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q3JYY5 7.5e-46 156 38 6 243 3 pstB3 Phosphate import ATP-binding protein PstB 3 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q9CP06 7.78e-46 159 36 4 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
D4GP38 7.94e-46 159 38 5 242 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q11NG0 8.91e-46 155 35 6 246 3 pstB Phosphate import ATP-binding protein PstB Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q9KIF7 9.81e-46 160 41 4 238 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q1MCN6 1e-45 159 36 3 237 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
O27764 1.03e-45 155 38 6 248 3 pstB Phosphate import ATP-binding protein PstB Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P63374 1.09e-45 155 37 9 248 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P63373 1.09e-45 155 37 9 248 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q82TL6 1.1e-45 159 37 4 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q3A6U0 1.14e-45 155 38 7 247 3 pstB Phosphate import ATP-binding protein PstB Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q5M1F6 1.15e-45 158 37 4 230 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain CNRZ 1066)
Q8PNN4 1.4e-45 158 38 5 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q9HS13 1.45e-45 156 38 7 247 3 pstB1 Phosphate import ATP-binding protein PstB 1 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q72GX5 1.52e-45 155 38 7 247 3 pstB Phosphate import ATP-binding protein PstB Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q8D653 1.53e-45 158 38 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
P63363 1.57e-45 155 38 6 247 3 pstB1 Phosphate import ATP-binding protein PstB 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71WT3 1.57e-45 155 38 6 247 3 pstB1 Phosphate import ATP-binding protein PstB 1 Listeria monocytogenes serotype 4b (strain F2365)
P63364 1.57e-45 155 38 6 247 3 pstB1 Phosphate import ATP-binding protein PstB 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5FM17 1.8e-45 155 36 6 247 3 pstB2 Phosphate import ATP-binding protein PstB 2 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q50966 1.85e-45 158 39 4 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q5LT65 1.95e-45 157 38 4 231 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q7NX01 1.97e-45 158 38 4 241 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q04F14 1.99e-45 157 40 4 212 3 metN1 Methionine import ATP-binding protein MetN 1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q88YN5 2.13e-45 155 37 5 235 3 phnC Phosphonates import ATP-binding protein PhnC Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q7W9U5 2.16e-45 157 38 4 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q5SLN1 2.29e-45 155 38 7 247 3 pstB Phosphate import ATP-binding protein PstB Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q6NBT1 2.33e-45 157 36 4 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
O34979 2.35e-45 154 39 7 226 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
Q81GC1 2.46e-45 157 36 3 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6D5H7 2.66e-45 157 36 4 244 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1QE80 2.66e-45 159 37 3 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q04G50 2.69e-45 158 38 5 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q8RGC8 2.7e-45 158 36 3 238 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9PQU3 2.94e-45 157 40 6 233 3 pstB Phosphate import ATP-binding protein PstB Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q39S52 3.13e-45 154 36 4 245 3 pstB Phosphate import ATP-binding protein PstB Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q6AM16 3.36e-45 155 40 7 238 3 pstB Phosphate import ATP-binding protein PstB Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q663R5 3.65e-45 154 37 4 245 3 pstB2 Phosphate import ATP-binding protein PstB 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CCI2 3.65e-45 154 37 4 245 3 pstB2 Phosphate import ATP-binding protein PstB 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8Z9T1 3.65e-45 154 37 4 245 3 pstB2 Phosphate import ATP-binding protein PstB 2 Yersinia pestis
Q1C0A2 3.65e-45 154 37 4 245 3 pstB2 Phosphate import ATP-binding protein PstB 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q03AH0 3.88e-45 157 36 3 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q7NQN5 4.09e-45 157 37 5 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2S081 4.12e-45 154 37 5 245 3 pstB Phosphate import ATP-binding protein PstB Salinibacter ruber (strain DSM 13855 / M31)
P63368 4.67e-45 154 36 8 250 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P63367 4.67e-45 154 36 8 250 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus agalactiae serotype III (strain NEM316)
Q3K199 4.67e-45 154 36 8 250 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1MLW4 4.86e-45 154 38 6 237 3 pstB1 Phosphate import ATP-binding protein PstB 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q5E3B8 4.88e-45 154 39 7 248 3 pstB2 Phosphate import ATP-binding protein PstB 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8CUY0 5.15e-45 154 36 5 239 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q032D0 5.41e-45 154 39 4 233 3 phnC Phosphonates import ATP-binding protein PhnC Lactococcus lactis subsp. cremoris (strain SK11)
Q9PDN2 5.64e-45 156 36 4 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q609Z8 5.8e-45 154 38 7 238 3 pstB Phosphate import ATP-binding protein PstB Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
O85818 5.88e-45 157 35 3 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q7NNG3 5.93e-45 154 37 6 249 3 pstB2 Phosphate import ATP-binding protein PstB 2 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9PHQ1 6.15e-45 153 39 7 243 3 pstB Phosphate import ATP-binding protein PstB Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5HVF4 7.31e-45 153 39 7 243 3 pstB Phosphate import ATP-binding protein PstB Campylobacter jejuni (strain RM1221)
Q3SVB5 8.31e-45 154 37 4 245 3 pstB Phosphate import ATP-binding protein PstB Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q13CR0 8.35e-45 154 37 5 244 3 pstB Phosphate import ATP-binding protein PstB Rhodopseudomonas palustris (strain BisB5)
A1TXH7 9.09e-45 156 39 4 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q9YG51 9.35e-45 153 36 7 249 3 pstB Phosphate import ATP-binding protein PstB Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q7VZE5 9.4e-45 156 37 4 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7N8B9 9.76e-45 156 37 3 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q67JX4 9.81e-45 154 41 4 208 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q2IGQ6 1.12e-44 153 40 8 246 3 pstB Phosphate import ATP-binding protein PstB Anaeromyxobacter dehalogenans (strain 2CP-C)
Q30YR3 1.14e-44 153 39 8 246 3 pstB Phosphate import ATP-binding protein PstB Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q4FLF6 1.16e-44 153 38 6 247 3 pstB Phosphate import ATP-binding protein PstB Pelagibacter ubique (strain HTCC1062)
Q4FL37 1.16e-44 155 37 5 240 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q2YKZ7 1.17e-44 155 36 4 238 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 1.17e-44 155 36 4 238 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q21JQ9 1.2e-44 152 41 5 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8FVT0 1.23e-44 155 36 4 238 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q4FQD1 1.3e-44 153 37 5 245 3 pstB Phosphate import ATP-binding protein PstB Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q64Z80 1.36e-44 152 39 4 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain YCH46)
Q6CYN3 1.45e-44 153 37 4 245 3 pstB2 Phosphate import ATP-binding protein PstB 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2K4V4 1.48e-44 156 35 4 240 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5LI72 1.52e-44 151 39 4 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q6ME20 1.52e-44 155 38 4 244 3 metN Methionine import ATP-binding protein MetN Protochlamydia amoebophila (strain UWE25)
O34392 1.54e-44 152 39 5 209 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q9CIQ6 1.57e-44 152 39 4 233 3 phnC Phosphonates import ATP-binding protein PhnC Lactococcus lactis subsp. lactis (strain IL1403)
Q8PVF6 1.58e-44 153 36 6 247 3 pstB Phosphate import ATP-binding protein PstB Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q1QQH1 1.59e-44 153 37 4 245 3 pstB Phosphate import ATP-binding protein PstB Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q8UH62 1.6e-44 155 37 3 240 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_00460
Feature type CDS
Gene ehuA
Product ABC-type polar amino acid transport system, ATPase component
Location 69315 - 70037 (strand: 1)
Length 723 (nucleotides) / 240 (amino acids)
In genomic island -

Contig

Accession contig_1
Length 309072 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3166
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1126 Amino acid transport and metabolism (E) E ABC-type polar amino acid transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02028 polar amino acid transport system ATP-binding protein [EC:7.4.2.1] - -

Protein Sequence

MIHVNNLQKKFGNTHVLRGISCDIRPQEVVCVIGPSGSGKSTFLRCLNALERPDSGEIVVNGTDVCDPKTDLNKMREHTGMVFQRFNLFPHMTVLDNITMAPLMVSGLKKADALLKAERLLEKVGLPDKIDAWPESLSGGQQQRVAIARALAMDPTVLLFDEPTSALDPELVGEVLNVMKALAHEGMTMVIVTHEMNFAREVADRVFFIDQGIIQESGTPEQIFNHPQNPRTAAFLSRVL

Flanking regions ( +/- flanking 50bp)

ATTCCTGCTGGCGCAGCTGGTTCAATACACCGAAAGAAGGTTGAGCAGAAGTGATTCACGTTAATAATTTACAGAAAAAATTCGGCAATACTCATGTGCTGCGCGGTATCAGCTGTGATATCCGTCCGCAGGAAGTTGTCTGTGTGATAGGGCCGTCCGGCTCCGGAAAAAGTACCTTTCTGCGCTGCCTGAATGCCCTGGAACGCCCGGATTCCGGTGAGATTGTGGTAAACGGCACCGATGTGTGTGATCCGAAAACAGATCTGAACAAAATGCGCGAACATACCGGTATGGTATTCCAGCGCTTCAATCTGTTTCCGCATATGACGGTGCTGGATAACATTACCATGGCGCCACTGATGGTGTCCGGGCTGAAAAAAGCCGATGCGCTGCTTAAAGCGGAACGGTTACTGGAAAAAGTCGGGCTGCCGGATAAAATTGATGCCTGGCCGGAGAGTTTATCCGGCGGTCAGCAGCAGCGCGTGGCCATTGCCCGTGCCCTGGCGATGGATCCGACGGTGCTGCTGTTCGATGAACCGACTTCTGCGCTCGATCCGGAGCTGGTCGGTGAAGTACTGAATGTGATGAAAGCGCTGGCCCATGAGGGTATGACAATGGTGATTGTGACCCATGAGATGAATTTTGCCCGCGAAGTGGCAGACCGCGTCTTTTTTATCGACCAGGGGATCATCCAGGAGTCCGGCACACCGGAGCAGATATTTAATCACCCGCAAAACCCGCGTACCGCCGCGTTTCTCAGCCGCGTGCTGTAGTTTTCGCTGCAGTGAATAGTGACTAAGGACAGAGACAAAACGTCTCTGTC