Homologs in group_2208

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16895 FBDBKF_16895 93.6 Morganella morganii S1 fre NAD(P)H-flavin reductase
EHELCC_19535 EHELCC_19535 93.6 Morganella morganii S2 fre NAD(P)H-flavin reductase
NLDBIP_16905 NLDBIP_16905 93.6 Morganella morganii S4 fre NAD(P)H-flavin reductase
LHKJJB_16565 LHKJJB_16565 93.6 Morganella morganii S3 fre NAD(P)H-flavin reductase
HKOGLL_17530 HKOGLL_17530 93.6 Morganella morganii S5 fre NAD(P)H-flavin reductase
PMI_RS17630 PMI_RS17630 70.0 Proteus mirabilis HI4320 fre NAD(P)H-flavin reductase

Distribution of the homologs in the orthogroup group_2208

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2208

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P43129 3.87e-128 364 72 0 233 3 fre NAD(P)H-flavin reductase Photorhabdus luminescens
Q9L6L9 1.89e-126 360 70 0 233 1 fre NAD(P)H-flavin reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEN1 2.58e-121 347 68 0 233 1 fre NAD(P)H-flavin reductase Escherichia coli (strain K12)
P0AEN2 2.58e-121 347 68 0 233 3 fre NAD(P)H-flavin reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEN3 2.58e-121 347 68 0 233 3 fre NAD(P)H-flavin reductase Escherichia coli O157:H7
P43126 1.06e-79 241 51 3 235 3 fre NAD(P)H-flavin reductase Aliivibrio fischeri
P43127 1.37e-77 236 48 2 236 1 fre NAD(P)H-flavin reductase Vibrio harveyi
P29237 1.23e-58 188 37 3 232 3 luxG Probable flavin reductase Photobacterium leiognathi
P24273 1.9e-54 177 40 2 224 3 luxG Probable flavin reductase Aliivibrio fischeri
P43128 1.36e-49 162 49 2 163 3 fre NAD(P)H-flavin reductase (Fragment) Vibrio orientalis
P16447 1.95e-49 164 37 2 232 3 luxG Probable flavin reductase Vibrio harveyi
P68641 2.61e-32 122 31 6 231 3 ascD CDP-6-deoxy-L-threo-D-glycero-4-hexulose-3-dehydrase reductase Yersinia pestis
Q66DP5 3.97e-32 122 30 6 231 1 ascD CDP-6-deoxy-L-threo-D-glycero-4-hexulose-3-dehydrase reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q52126 4.67e-24 100 29 3 226 1 ndoR Naphthalene 1,2-dioxygenase system ferredoxin--NAD(P)(+), reductase component Pseudomonas putida
Q7WTJ2 7.85e-24 100 30 3 215 1 mphP Phenol hydroxylase P5 protein Acinetobacter pittii (strain PHEA-2)
P26395 1.3e-23 99 31 6 227 4 rfbI Protein RfbI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P19734 1.72e-23 99 29 3 215 1 dmpP Phenol 2-monooxygenase, reductase component DmpP Pseudomonas sp. (strain CF600)
O52378 1.19e-21 94 31 1 201 1 nagAa Naphthalene 1,2-dioxygenase/salicylate 5-hydroxylase systems, ferredoxin--NAD(P)(+), reductase component Ralstonia sp.
Q45692 4.56e-20 90 30 1 211 1 dntAa 2,4-dinitrotoluene dioxygenase system ferredoxin--NAD(+), reductase component Burkholderia sp. (strain RASC)
P0DPQ8 1.7e-18 85 29 7 225 1 gcoB Aromatic O-demethylase, reductase subunit Amycolatopsis sp. (strain ATCC 39116 / 75iv2)
Q3C1E0 2.44e-18 85 28 3 199 1 tphA1I Terephthalate 1,2-dioxygenase, reductase component 1 Comamonas sp.
Q3C1D2 8.87e-18 84 27 2 196 1 tphA1II Terephthalate 1,2-dioxygenase, reductase component 2 Comamonas sp.
Q768T4 1.76e-16 80 26 5 231 1 prmB Propane 2-monooxygenase, reductase component Gordonia sp. (strain TY-5)
A7IPX7 6.74e-14 72 25 1 225 1 xamoF Alkene monooxygenase system, ferredoxin--NAD(+) reductase component Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
E9RFT0 9.51e-13 69 25 5 235 1 mimB Propane 2-monooxygenase, reductase component Mycolicibacterium goodii
P21394 1.63e-12 69 25 4 179 1 xylA Xylene/toluene monooxygenase electron transfer component XylA Pseudomonas putida
A0QTU9 4.78e-12 67 25 5 232 1 mimB Propane 2-monooxygenase, reductase component Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
O85675 5.29e-12 67 23 4 227 1 antC Anthranilate 1,2-dioxygenase electron transfer component Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q0SJK8 8.86e-12 67 25 5 232 1 prmB Propane 2-monooxygenase, reductase component Rhodococcus jostii (strain RHA1)
P22868 3.91e-11 65 26 2 184 1 mmoC Methane monooxygenase component C Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A9FRJ0 8.48e-10 60 28 3 193 1 sce5135 Ferredoxin--NADP reductase B Sorangium cellulosum (strain So ce56)
Q9LCJ4 2.68e-09 59 23 8 231 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F (Fragment) Pseudoalteromonas haloplanktis
Q8GI14 5.86e-08 55 23 7 239 1 carAd Ferredoxin--NAD(P)(+) reductase CarAd Pseudomonas resinovorans
Q51603 1.06e-07 55 25 7 232 1 cbdC 2-halobenzoate 1,2-dioxygenase electron transfer component Burkholderia cepacia
Q9K0M8 1.25e-07 55 27 6 172 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1KSH3 1.29e-07 55 27 6 172 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JVQ3 1.29e-07 55 27 6 172 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M2A6 1.29e-07 55 27 6 172 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria meningitidis serogroup C (strain 053442)
Q9LCI9 2.16e-07 53 25 5 161 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F (Fragment) Moritella marina
Q5QYQ8 4.38e-07 53 25 6 177 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A6T526 6.28e-07 52 24 4 155 1 nqrF Na(+)-translocating NADH-quinone reductase subunit F Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q54NC1 7.38e-07 52 26 8 178 3 cyb5r1 NADH-cytochrome b5 reductase 1 Dictyostelium discoideum
Q03304 1.57e-06 51 21 4 226 1 tmoF Toluene-4-monooxygenase system, ferredoxin--NAD(+) reductase component Pseudomonas mendocina
A4TPL2 1.79e-06 51 22 8 231 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia pestis (strain Pestoides F)
Q1CLD8 1.79e-06 51 22 8 231 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZBZ5 1.79e-06 51 22 8 231 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia pestis
Q1C4D5 1.79e-06 51 22 8 231 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLJ3 1.79e-06 51 22 8 231 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q5F6X5 1.92e-06 51 25 5 160 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P39662 2.55e-06 51 24 6 197 1 hmp Flavohemoprotein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q255Y6 3e-06 50 33 4 90 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Chlamydia felis (strain Fe/C-56)
Q1Q7Z7 3.13e-06 50 25 5 162 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q66E01 3.51e-06 50 22 8 231 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia pseudotuberculosis serotype I (strain IP32953)
P07771 4.2e-06 50 24 8 222 1 benC Benzoate 1,2-dioxygenase electron transfer component Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q02PF8 4.34e-06 50 25 7 175 1 nqrF Na(+)-translocating NADH-quinone reductase subunit F Pseudomonas aeruginosa (strain UCBPP-PA14)
A1JNZ2 9.34e-06 49 22 8 231 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q821Q3 9.95e-06 49 32 5 96 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q9HZL1 1.45e-05 48 25 7 175 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8U2E4 1.89e-05 48 26 6 185 1 hydG Sulfhydrogenase 1 subunit gamma Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9K3E1 2.08e-05 48 21 9 234 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F (Fragment) Colwellia maris
Q9PLI3 3.58e-05 47 30 5 102 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Chlamydia muridarum (strain MoPn / Nigg)
A5UFX3 6.07e-05 47 25 7 169 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Haemophilus influenzae (strain PittGG)
Q9LCJ0 7.33e-05 46 22 4 161 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8GAZ4 9.59e-05 46 29 6 146 3 hmp Flavohemoprotein Burkholderia sp. (strain TH2)
Q7WUM8 0.000448 44 22 6 199 3 hmp Flavohemoprotein Rhizobium meliloti (strain 1021)
A3LT66 0.000643 43 24 5 161 3 MCR1 NADH-cytochrome b5 reductase 2 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q9X406 0.000889 43 22 3 169 1 msmD Putative methanesulfonate monooxygenase ferredoxin reductase subunit Methylosulfonomonas methylovora
Q7UIY1 0.000893 43 25 5 188 3 hmp Flavohemoprotein Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS18365
Feature type CDS
Gene fre
Product NAD(P)H-flavin reductase
Location 8034 - 8735 (strand: -1)
Length 702 (nucleotides) / 233 (amino acids)

Contig

Accession term accessions NZ_VXKB01000009 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 74461 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2208
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00175 Oxidoreductase NAD-binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0543 Coenzyme transport and metabolism (H)
Energy production and conversion (C)		 HC NAD(P)H-flavin reductase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05368 NAD(P)H-flavin reductase [EC:1.5.1.41] Riboflavin metabolism
Metabolic pathways		 -

Protein Sequence

MATLNCKVTSVESITDTVYRIKLLPDGDYSFKAGQYLLVVMDERDKRPFSMASAPSSQKEIELHIGASEFNLYAMAVMDRILDNRQVTIDLPHGKAWFRENSRAPMLLVAGGTGFSYTRSVLLAALEENPARDITFYWGAREHVYLYDLGELQSLAETHPNLKIIPVVEQPDESWRGRTGTVLSAVLDDFGSLAGKDIYIAGRFEMAKIARERFCQERAADINRLFGDAFEFI

Flanking regions ( +/- flanking 50bp)

GTTGACGCTTTATGGGATGAATTGAATATTCTCAATAATTGAGGGAGCACATGGCAACGCTAAACTGCAAAGTTACCTCTGTTGAATCTATAACGGATACGGTATACCGCATAAAATTATTACCTGATGGTGATTATTCATTTAAAGCCGGTCAGTATTTACTGGTGGTCATGGATGAACGGGATAAGCGCCCGTTTTCTATGGCATCTGCACCGTCATCACAGAAAGAAATCGAACTGCACATTGGCGCATCAGAATTTAACCTTTATGCCATGGCGGTAATGGACAGGATCCTGGATAACCGTCAGGTAACGATCGATTTACCACACGGAAAAGCATGGTTTCGCGAAAATAGCCGGGCGCCGATGTTGCTGGTGGCAGGCGGAACCGGTTTTTCTTACACCCGCTCAGTTTTGCTGGCGGCACTGGAAGAAAATCCTGCGCGTGATATTACGTTTTACTGGGGTGCAAGAGAACATGTCTATCTCTATGATCTCGGCGAACTTCAGTCTCTGGCAGAGACACACCCTAACCTGAAAATTATCCCGGTTGTTGAACAGCCTGATGAATCATGGCGGGGACGAACCGGTACCGTACTCAGTGCGGTACTCGATGATTTCGGATCGCTGGCAGGAAAAGATATCTATATTGCCGGTCGTTTTGAAATGGCAAAAATTGCCCGTGAGCGTTTTTGTCAGGAGCGTGCTGCTGATATTAACCGCTTGTTTGGTGATGCTTTCGAGTTTATTTAAAAAAATTCCTGACAGCGGAAATGCGGTAGTAACCGCCGGGAAAATGACTG