Homologs in group_2087

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15605 FBDBKF_15605 95.6 Morganella morganii S1 mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
EHELCC_15965 EHELCC_15965 95.6 Morganella morganii S2 mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
NLDBIP_16405 NLDBIP_16405 95.6 Morganella morganii S4 mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
LHKJJB_16400 LHKJJB_16400 95.6 Morganella morganii S3 mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
HKOGLL_16170 HKOGLL_16170 95.6 Morganella morganii S5 mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
PMI_RS15480 PMI_RS15480 83.5 Proteus mirabilis HI4320 mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE

Distribution of the homologs in the orthogroup group_2087

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2087

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MAX1 0.0 798 87 0 454 3 mnmE tRNA modification GTPase MnmE Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1JRQ1 0.0 768 83 0 454 3 mnmE tRNA modification GTPase MnmE Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A1JT87 0.0 767 83 0 454 3 mnmE tRNA modification GTPase MnmE Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q663S6 0.0 766 83 0 454 3 mnmE tRNA modification GTPase MnmE Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSL0 0.0 766 83 0 454 3 mnmE tRNA modification GTPase MnmE Yersinia pestis (strain Pestoides F)
Q1CCJ3 0.0 766 83 0 454 3 mnmE tRNA modification GTPase MnmE Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5S1 0.0 766 83 0 454 3 mnmE tRNA modification GTPase MnmE Yersinia pestis bv. Antiqua (strain Angola)
B2K868 0.0 766 83 0 454 3 mnmE tRNA modification GTPase MnmE Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C0B3 0.0 766 83 0 454 3 mnmE tRNA modification GTPase MnmE Yersinia pestis bv. Antiqua (strain Antiqua)
A7FPC2 0.0 766 83 0 454 3 mnmE tRNA modification GTPase MnmE Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q8Z9U2 0.0 763 83 0 454 3 mnmE tRNA modification GTPase MnmE Yersinia pestis
A8G7P7 0.0 758 82 0 454 3 mnmE tRNA modification GTPase MnmE Serratia proteamaculans (strain 568)
C6DK97 0.0 753 81 0 454 3 mnmE tRNA modification GTPase MnmE Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6CYQ9 0.0 753 81 0 454 3 mnmE tRNA modification GTPase MnmE Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B7UMH3 0.0 751 82 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1R4M8 0.0 751 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli (strain UTI89 / UPEC)
B7NF24 0.0 751 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FBV3 0.0 751 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TB01 0.0 751 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHP0 0.0 751 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli O1:K1 / APEC
B7MGC8 0.0 751 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli O45:K1 (strain S88 / ExPEC)
B7LK49 0.0 750 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LL33 0.0 750 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli (strain SMS-3-5 / SECEC)
B7N211 0.0 750 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli O81 (strain ED1a)
Q31UW0 0.0 750 81 0 454 3 mnmE tRNA modification GTPase MnmE Shigella boydii serotype 4 (strain Sb227)
B2TUS2 0.0 750 81 0 454 3 mnmE tRNA modification GTPase MnmE Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I3T9 0.0 750 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli (strain SE11)
P25522 0.0 750 81 0 454 1 mnmE tRNA modification GTPase MnmE Escherichia coli (strain K12)
B1IX32 0.0 750 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1X9T5 0.0 750 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli (strain K12 / DH10B)
C4ZYY4 0.0 750 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli (strain K12 / MC4100 / BW2952)
B7M559 0.0 750 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli O8 (strain IAI1)
B5YXB0 0.0 749 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XB41 0.0 749 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli O157:H7
Q83PL3 0.0 749 81 0 454 3 mnmE tRNA modification GTPase MnmE Shigella flexneri
Q0SYP6 0.0 749 81 0 454 3 mnmE tRNA modification GTPase MnmE Shigella flexneri serotype 5b (strain 8401)
B4F0U0 0.0 749 83 0 454 3 mnmE tRNA modification GTPase MnmE Proteus mirabilis (strain HI4320)
Q3YWA7 0.0 748 81 0 454 3 mnmE tRNA modification GTPase MnmE Shigella sonnei (strain Ss046)
Q329B1 0.0 748 81 0 454 3 mnmE tRNA modification GTPase MnmE Shigella dysenteriae serotype 1 (strain Sd197)
A8A6G8 0.0 748 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli O9:H4 (strain HS)
B7L851 0.0 748 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli (strain 55989 / EAEC)
B7NR09 0.0 747 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A7ZTR2 0.0 745 81 0 454 3 mnmE tRNA modification GTPase MnmE Escherichia coli O139:H28 (strain E24377A / ETEC)
A7MN03 0.0 742 81 0 454 3 mnmE tRNA modification GTPase MnmE Cronobacter sakazakii (strain ATCC BAA-894)
A8ACL8 0.0 741 80 0 454 3 mnmE tRNA modification GTPase MnmE Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q8ZKY3 0.0 739 81 0 454 3 mnmE tRNA modification GTPase MnmE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MJT6 0.0 739 80 0 454 3 mnmE tRNA modification GTPase MnmE Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TN11 0.0 739 80 0 454 3 mnmE tRNA modification GTPase MnmE Salmonella schwarzengrund (strain CVM19633)
A9MX84 0.0 739 80 0 454 3 mnmE tRNA modification GTPase MnmE Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYB2 0.0 739 80 0 454 3 mnmE tRNA modification GTPase MnmE Salmonella newport (strain SL254)
B5QUQ5 0.0 739 80 0 454 3 mnmE tRNA modification GTPase MnmE Salmonella enteritidis PT4 (strain P125109)
Q57HZ6 0.0 739 80 0 454 3 mnmE tRNA modification GTPase MnmE Salmonella choleraesuis (strain SC-B67)
B2VCE7 0.0 739 80 0 454 3 mnmE tRNA modification GTPase MnmE Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C0Q2L4 0.0 738 80 0 454 3 mnmE tRNA modification GTPase MnmE Salmonella paratyphi C (strain RKS4594)
Q8Z2N8 0.0 736 80 0 454 3 mnmE tRNA modification GTPase MnmE Salmonella typhi
B5RFY2 0.0 736 80 0 454 3 mnmE tRNA modification GTPase MnmE Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5BIL9 0.0 735 80 0 454 3 mnmE tRNA modification GTPase MnmE Salmonella paratyphi A (strain AKU_12601)
Q5PKU1 0.0 734 80 0 454 3 mnmE tRNA modification GTPase MnmE Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A4WGH1 0.0 734 80 0 454 3 mnmE tRNA modification GTPase MnmE Enterobacter sp. (strain 638)
A6TG09 0.0 731 79 0 454 3 mnmE tRNA modification GTPase MnmE Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XZP4 0.0 728 79 0 454 3 mnmE tRNA modification GTPase MnmE Klebsiella pneumoniae (strain 342)
Q2NQ72 0.0 682 78 0 454 3 mnmE tRNA modification GTPase MnmE Sodalis glossinidius (strain morsitans)
A0KQZ6 0.0 676 73 0 452 3 mnmE tRNA modification GTPase MnmE Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4STS4 0.0 671 73 0 452 3 mnmE tRNA modification GTPase MnmE Aeromonas salmonicida (strain A449)
Q9CLQ1 0.0 670 73 0 450 3 mnmE tRNA modification GTPase MnmE Pasteurella multocida (strain Pm70)
Q8DDI1 0.0 668 72 0 452 3 mnmE tRNA modification GTPase MnmE Vibrio vulnificus (strain CMCP6)
Q5E8Z9 0.0 668 72 0 451 3 mnmE tRNA modification GTPase MnmE Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6LW56 0.0 667 72 0 453 3 mnmE tRNA modification GTPase MnmE Photobacterium profundum (strain SS9)
Q7MQK6 0.0 667 71 0 452 3 mnmE tRNA modification GTPase MnmE Vibrio vulnificus (strain YJ016)
A6VQS6 0.0 667 73 0 450 3 mnmE tRNA modification GTPase MnmE Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A4YCM1 0.0 666 71 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1RQE8 0.0 665 70 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella sp. (strain W3-18-1)
A7N0X8 0.0 664 71 0 452 3 mnmE tRNA modification GTPase MnmE Vibrio campbellii (strain ATCC BAA-1116)
Q87TR6 0.0 662 71 0 452 3 mnmE tRNA modification GTPase MnmE Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KVY5 0.0 662 71 0 452 3 mnmE tRNA modification GTPase MnmE Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A3QJT0 0.0 662 70 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A0KR31 0.0 661 69 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella sp. (strain ANA-3)
Q0HD65 0.0 661 69 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella sp. (strain MR-4)
B0BR82 0.0 661 73 0 450 3 mnmE tRNA modification GTPase MnmE Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q0HPE7 0.0 660 69 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella sp. (strain MR-7)
A3N2D8 0.0 660 73 0 450 3 mnmE tRNA modification GTPase MnmE Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A8HAH9 0.0 659 69 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A5F485 0.0 658 71 0 452 3 mnmE tRNA modification GTPase MnmE Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B0TQH0 0.0 658 69 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella halifaxensis (strain HAW-EB4)
B1KQ64 0.0 655 68 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella woodyi (strain ATCC 51908 / MS32)
Q8CX52 0.0 655 70 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q07VS7 0.0 654 69 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella frigidimarina (strain NCIMB 400)
Q12HM9 0.0 654 69 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A9KX19 0.0 653 69 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella baltica (strain OS195)
A8FP41 0.0 652 68 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella sediminis (strain HAW-EB3)
A6WUK3 0.0 652 69 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella baltica (strain OS185)
Q7U344 0.0 652 72 0 450 3 mnmE tRNA modification GTPase MnmE Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A3DAS7 0.0 651 69 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q3IK56 0.0 649 70 2 455 3 mnmE tRNA modification GTPase MnmE Pseudoalteromonas translucida (strain TAC 125)
Q4QLQ9 0.0 647 71 0 450 3 mnmE tRNA modification GTPase MnmE Haemophilus influenzae (strain 86-028NP)
A1S1G4 0.0 646 69 0 452 3 mnmE tRNA modification GTPase MnmE Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A5UID5 0.0 645 70 0 450 3 mnmE tRNA modification GTPase MnmE Haemophilus influenzae (strain PittGG)
A5UD71 0.0 645 71 0 450 3 mnmE tRNA modification GTPase MnmE Haemophilus influenzae (strain PittEE)
P43730 0.0 642 71 0 450 3 mnmE tRNA modification GTPase MnmE Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A1T0N0 0.0 641 66 0 454 3 mnmE tRNA modification GTPase MnmE Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q65VC3 0.0 641 69 0 454 3 mnmE tRNA modification GTPase MnmE Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q15MS9 0.0 632 68 0 450 3 mnmE tRNA modification GTPase MnmE Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
C4K7P4 0.0 631 68 4 461 3 mnmE tRNA modification GTPase MnmE Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q0I0Z2 0.0 626 69 1 452 3 mnmE tRNA modification GTPase MnmE Histophilus somni (strain 129Pt)
B0URU2 0.0 626 69 1 452 3 mnmE tRNA modification GTPase MnmE Histophilus somni (strain 2336)
Q5QZJ5 0.0 619 67 0 450 3 mnmE tRNA modification GTPase MnmE Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A6W3V0 0.0 595 64 1 450 3 mnmE tRNA modification GTPase MnmE Marinomonas sp. (strain MWYL1)
A1U7J3 0.0 588 64 2 454 3 mnmE tRNA modification GTPase MnmE Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q47U36 0.0 587 64 3 455 3 mnmE tRNA modification GTPase MnmE Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q1I2H5 0.0 579 65 3 452 3 mnmE tRNA modification GTPase MnmE Pseudomonas entomophila (strain L48)
Q87TS2 0.0 577 64 3 452 3 mnmE tRNA modification GTPase MnmE Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q02DE1 0.0 577 65 2 453 3 mnmE tRNA modification GTPase MnmE Pseudomonas aeruginosa (strain UCBPP-PA14)
B1JFV3 0.0 577 65 3 452 3 mnmE tRNA modification GTPase MnmE Pseudomonas putida (strain W619)
Q9HT07 0.0 577 65 2 453 3 mnmE tRNA modification GTPase MnmE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B0KRC0 0.0 576 64 3 452 3 mnmE tRNA modification GTPase MnmE Pseudomonas putida (strain GB-1)
Q21DG1 0.0 573 63 4 455 3 mnmE tRNA modification GTPase MnmE Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
P0A176 0.0 573 64 3 452 3 mnmE tRNA modification GTPase MnmE Pseudomonas putida
P0A175 0.0 573 64 3 452 3 mnmE tRNA modification GTPase MnmE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WBB6 0.0 573 64 3 452 3 mnmE tRNA modification GTPase MnmE Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q2S6M6 0.0 572 65 1 451 3 mnmE tRNA modification GTPase MnmE Hahella chejuensis (strain KCTC 2396)
A4Y199 0.0 572 64 2 454 3 mnmE tRNA modification GTPase MnmE Pseudomonas mendocina (strain ymp)
A4VS81 0.0 569 63 2 455 3 mnmE tRNA modification GTPase MnmE Stutzerimonas stutzeri (strain A1501)
Q4ZL12 0.0 568 64 3 452 3 mnmE tRNA modification GTPase MnmE Pseudomonas syringae pv. syringae (strain B728a)
Q48BF3 0.0 567 64 3 452 3 mnmE tRNA modification GTPase MnmE Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q3K429 0.0 566 64 3 452 3 mnmE tRNA modification GTPase MnmE Pseudomonas fluorescens (strain Pf0-1)
Q4K396 0.0 562 64 3 452 3 mnmE tRNA modification GTPase MnmE Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q31DJ0 0.0 560 63 3 455 3 mnmE tRNA modification GTPase MnmE Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A6VF44 0.0 559 65 2 442 3 mnmE tRNA modification GTPase MnmE Pseudomonas aeruginosa (strain PA7)
Q1QS99 0.0 555 62 1 450 3 mnmE tRNA modification GTPase MnmE Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
P94612 1.35e-174 499 55 4 450 3 mnmE tRNA modification GTPase MnmE Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NBA7 1.35e-174 499 55 4 450 3 mnmE tRNA modification GTPase MnmE Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KBS9 1.35e-174 499 55 4 450 3 mnmE tRNA modification GTPase MnmE Coxiella burnetii (strain Dugway 5J108-111)
Q5X0M3 8.07e-174 497 57 5 453 3 mnmE tRNA modification GTPase MnmE Legionella pneumophila (strain Paris)
Q5WSF0 9.3e-174 497 57 5 453 3 mnmE tRNA modification GTPase MnmE Legionella pneumophila (strain Lens)
Q5ZR82 9.93e-174 497 57 5 453 3 mnmE tRNA modification GTPase MnmE Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IIK3 1.02e-173 497 57 5 453 3 mnmE tRNA modification GTPase MnmE Legionella pneumophila (strain Corby)
Q1LTV8 2.51e-173 496 56 2 452 3 mnmE tRNA modification GTPase MnmE Baumannia cicadellinicola subsp. Homalodisca coagulata
Q7NPT9 7.05e-169 485 56 6 456 3 mnmE tRNA modification GTPase MnmE Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0VKU8 2.6e-166 479 58 6 456 3 mnmE tRNA modification GTPase MnmE Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0AE55 4.55e-166 478 55 3 456 3 mnmE tRNA modification GTPase MnmE Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A1WDB4 2.69e-164 474 56 4 461 3 mnmE tRNA modification GTPase MnmE Acidovorax sp. (strain JS42)
Q82XA1 8.06e-162 467 55 4 459 3 mnmE tRNA modification GTPase MnmE Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A1TWI4 2.44e-161 467 55 6 481 3 mnmE tRNA modification GTPase MnmE Paracidovorax citrulli (strain AAC00-1)
Q3J6L9 6.73e-160 462 53 2 451 3 mnmE tRNA modification GTPase MnmE Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q121L2 1.79e-158 459 53 5 475 3 mnmE tRNA modification GTPase MnmE Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q602M5 9.36e-158 457 54 3 450 3 mnmE tRNA modification GTPase MnmE Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B0TYD1 3.59e-157 455 50 5 457 3 mnmE tRNA modification GTPase MnmE Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q13SH7 4.02e-157 456 54 8 466 3 mnmE tRNA modification GTPase MnmE Paraburkholderia xenovorans (strain LB400)
Q39BQ4 1.68e-156 454 54 6 466 3 mnmE tRNA modification GTPase MnmE Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B0V5S5 2.3e-156 453 54 4 455 3 mnmE tRNA modification GTPase MnmE Acinetobacter baumannii (strain AYE)
A3M8Y8 2.3e-156 453 54 4 455 3 mnmE tRNA modification GTPase MnmE Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B1K0Y2 4.05e-156 453 54 6 463 3 mnmE tRNA modification GTPase MnmE Burkholderia orbicola (strain MC0-3)
Q1BSF9 5.44e-156 453 54 6 466 3 mnmE tRNA modification GTPase MnmE Burkholderia orbicola (strain AU 1054)
A0KBN1 5.44e-156 453 54 6 466 3 mnmE tRNA modification GTPase MnmE Burkholderia cenocepacia (strain HI2424)
A1VUS4 6.86e-156 453 52 5 473 3 mnmE tRNA modification GTPase MnmE Polaromonas naphthalenivorans (strain CJ2)
C1D6H7 6.95e-156 452 54 6 447 3 mnmE tRNA modification GTPase MnmE Laribacter hongkongensis (strain HLHK9)
Q1GXL7 8.32e-156 452 54 3 454 3 mnmE tRNA modification GTPase MnmE Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q6F6L1 2.87e-155 451 54 4 455 3 mnmE tRNA modification GTPase MnmE Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q0BAQ4 3.99e-155 451 54 5 463 3 mnmE tRNA modification GTPase MnmE Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YQJ5 5.72e-155 450 54 5 463 3 mnmE tRNA modification GTPase MnmE Burkholderia ambifaria (strain MC40-6)
A4JJ44 8.75e-155 450 54 7 463 3 mnmE tRNA modification GTPase MnmE Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q1LH94 2.3e-154 449 54 7 474 3 mnmE tRNA modification GTPase MnmE Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
O51830 9.39e-154 447 50 3 455 3 mnmE tRNA modification GTPase MnmE Buchnera aphidicola subsp. Myzus persicae
Q5P4P5 2.01e-153 446 52 4 451 3 mnmE tRNA modification GTPase MnmE Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q21QM5 2.07e-153 446 54 5 468 3 mnmE tRNA modification GTPase MnmE Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8Y3H5 1.49e-152 444 54 4 467 3 mnmE tRNA modification GTPase MnmE Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0KFG6 6.78e-152 443 55 6 469 3 mnmE tRNA modification GTPase MnmE Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9JWB7 8.4e-152 441 52 5 457 3 mnmE tRNA modification GTPase MnmE Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q46VM0 3.39e-151 441 54 6 469 3 mnmE tRNA modification GTPase MnmE Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B4RRB9 4.8e-151 439 52 5 457 3 mnmE tRNA modification GTPase MnmE Neisseria gonorrhoeae (strain NCCP11945)
Q5F529 4.8e-151 439 52 5 457 3 mnmE tRNA modification GTPase MnmE Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9JXL4 7.92e-151 439 52 5 457 3 mnmE tRNA modification GTPase MnmE Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9M0N5 8.09e-151 439 52 5 457 3 mnmE tRNA modification GTPase MnmE Neisseria meningitidis serogroup C (strain 053442)
A4GAN2 2.27e-150 439 51 5 463 3 mnmE tRNA modification GTPase MnmE Herminiimonas arsenicoxydans
Q0A4L6 7.27e-150 436 54 5 449 3 mnmE tRNA modification GTPase MnmE Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q494C0 8.86e-150 437 49 7 468 3 mnmE tRNA modification GTPase MnmE Blochmanniella pennsylvanica (strain BPEN)
A9IJ97 1.28e-149 436 52 5 452 3 mnmE tRNA modification GTPase MnmE Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q2Y5A9 1.36e-149 436 51 5 457 3 mnmE tRNA modification GTPase MnmE Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A1KW66 2.98e-149 435 52 5 456 3 mnmE tRNA modification GTPase MnmE Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q63YV9 4.7e-148 432 53 5 466 3 mnmE tRNA modification GTPase MnmE Burkholderia pseudomallei (strain K96243)
A3N480 4.7e-148 432 53 5 466 3 mnmE tRNA modification GTPase MnmE Burkholderia pseudomallei (strain 668)
A3NPX5 4.7e-148 432 53 5 466 3 mnmE tRNA modification GTPase MnmE Burkholderia pseudomallei (strain 1106a)
A1V7D3 4.7e-148 432 53 5 466 3 mnmE tRNA modification GTPase MnmE Burkholderia mallei (strain SAVP1)
Q62EM6 4.7e-148 432 53 5 466 3 mnmE tRNA modification GTPase MnmE Burkholderia mallei (strain ATCC 23344)
A2S8D8 4.7e-148 432 53 5 466 3 mnmE tRNA modification GTPase MnmE Burkholderia mallei (strain NCTC 10229)
A3MS17 4.7e-148 432 53 5 466 3 mnmE tRNA modification GTPase MnmE Burkholderia mallei (strain NCTC 10247)
P57132 2.46e-147 430 48 3 452 3 mnmE tRNA modification GTPase MnmE Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8D3I9 2.46e-147 430 46 2 455 3 mnmE tRNA modification GTPase MnmE Wigglesworthia glossinidia brevipalpis
A6T4D6 3.71e-147 430 50 5 462 3 mnmE tRNA modification GTPase MnmE Janthinobacterium sp. (strain Marseille)
Q44633 2.17e-146 428 48 4 458 3 mnmE tRNA modification GTPase MnmE Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q0BLL9 4.39e-146 427 50 5 457 3 mnmE tRNA modification GTPase MnmE Francisella tularensis subsp. holarctica (strain OSU18)
Q7VSR5 9.61e-146 426 52 5 445 3 mnmE tRNA modification GTPase MnmE Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q2A342 1.62e-145 426 50 5 457 3 mnmE tRNA modification GTPase MnmE Francisella tularensis subsp. holarctica (strain LVS)
A7NCL5 1.62e-145 426 50 5 457 3 mnmE tRNA modification GTPase MnmE Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q2STM2 2.2e-145 426 52 5 466 3 mnmE tRNA modification GTPase MnmE Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2KTI2 2.95e-145 425 52 7 463 3 mnmE tRNA modification GTPase MnmE Bordetella avium (strain 197N)
A4IX14 3.4e-145 425 50 5 457 3 mnmE tRNA modification GTPase MnmE Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NFF3 4.86e-145 424 50 5 457 3 mnmE tRNA modification GTPase MnmE Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14GV5 4.86e-145 424 50 5 457 3 mnmE tRNA modification GTPase MnmE Francisella tularensis subsp. tularensis (strain FSC 198)
A0Q7G4 9.25e-145 424 50 5 457 3 mnmE tRNA modification GTPase MnmE Francisella tularensis subsp. novicida (strain U112)
Q7WDI4 1.01e-144 424 52 5 445 3 mnmE tRNA modification GTPase MnmE Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q477Q5 1.74e-144 423 52 4 453 3 mnmE tRNA modification GTPase MnmE Dechloromonas aromatica (strain RCB)
Q7W2J0 2e-144 423 52 5 445 3 mnmE tRNA modification GTPase MnmE Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q3SF39 3.05e-142 417 55 5 450 3 mnmE tRNA modification GTPase MnmE Thiobacillus denitrificans (strain ATCC 25259)
A1WSU0 6.54e-142 418 51 5 492 3 mnmE tRNA modification GTPase MnmE Verminephrobacter eiseniae (strain EF01-2)
A2SMI8 3.41e-141 415 51 4 467 3 mnmE tRNA modification GTPase MnmE Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q3JXI0 6.4e-141 414 53 5 466 3 mnmE tRNA modification GTPase MnmE Burkholderia pseudomallei (strain 1710b)
A1KCP8 9.86e-140 411 52 3 450 3 mnmE tRNA modification GTPase MnmE Azoarcus sp. (strain BH72)
Q4FPR8 2.76e-137 405 51 8 468 3 mnmE tRNA modification GTPase MnmE Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A4T0N1 3.55e-136 402 49 4 453 3 mnmE tRNA modification GTPase MnmE Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
P59569 5.55e-135 399 49 6 457 3 mnmE tRNA modification GTPase MnmE Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q1Q7V4 5.98e-135 400 51 7 467 3 mnmE tRNA modification GTPase MnmE Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A1AXR3 1.96e-134 397 47 7 458 3 mnmE tRNA modification GTPase MnmE Ruthia magnifica subsp. Calyptogena magnifica
A5CVJ3 8.67e-134 395 48 6 455 3 mnmE tRNA modification GTPase MnmE Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B1Y0F6 2.53e-133 395 50 4 473 3 mnmE tRNA modification GTPase MnmE Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A5WI36 1.81e-129 385 50 9 470 3 mnmE tRNA modification GTPase MnmE Psychrobacter sp. (strain PRwf-1)
A5EY43 3.64e-127 379 47 5 457 3 mnmE tRNA modification GTPase MnmE Dichelobacter nodosus (strain VCS1703A)
Q7VQV3 6.14e-122 366 44 6 468 3 mnmE tRNA modification GTPase MnmE Blochmanniella floridana
B0RMM4 8.37e-118 355 47 8 470 3 mnmE tRNA modification GTPase MnmE Xanthomonas campestris pv. campestris (strain B100)
Q8P340 2.85e-117 353 47 8 467 3 mnmE tRNA modification GTPase MnmE Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UNL0 2.85e-117 353 47 8 467 3 mnmE tRNA modification GTPase MnmE Xanthomonas campestris pv. campestris (strain 8004)
Q3BLZ9 3.15e-114 345 48 14 476 3 mnmE tRNA modification GTPase MnmE Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q2NX54 1.07e-113 344 48 15 477 3 mnmE tRNA modification GTPase MnmE Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q5GTT5 1.94e-113 343 48 14 476 3 mnmE tRNA modification GTPase MnmE Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SUV8 7.2e-113 342 47 14 476 3 mnmE tRNA modification GTPase MnmE Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q8PEH9 8.64e-113 342 48 11 470 3 mnmE tRNA modification GTPase MnmE Xanthomonas axonopodis pv. citri (strain 306)
Q058F5 9.71e-110 334 40 2 455 3 mnmE tRNA modification GTPase MnmE Buchnera aphidicola subsp. Cinara cedri (strain Cc)
A1WWE4 2.09e-104 321 45 10 461 3 mnmE tRNA modification GTPase MnmE Halorhodospira halophila (strain DSM 244 / SL1)
Q879S5 9.56e-102 314 45 6 438 3 mnmE tRNA modification GTPase MnmE Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9P9U3 1.61e-99 308 44 6 438 3 mnmE tRNA modification GTPase MnmE Xylella fastidiosa (strain 9a5c)
O67030 2.96e-99 307 39 5 453 3 mnmE tRNA modification GTPase MnmE Aquifex aeolicus (strain VF5)
B2A470 1.86e-95 298 38 8 464 3 mnmE tRNA modification GTPase MnmE Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B1KUB2 5.41e-95 296 35 8 466 3 mnmE tRNA modification GTPase MnmE Clostridium botulinum (strain Loch Maree / Type A3)
B1IHR9 1.86e-94 295 34 6 465 3 mnmE tRNA modification GTPase MnmE Clostridium botulinum (strain Okra / Type B1)
A5I816 1.86e-94 295 34 6 465 3 mnmE tRNA modification GTPase MnmE Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FPM0 1.86e-94 295 34 6 465 3 mnmE tRNA modification GTPase MnmE Clostridium botulinum (strain ATCC 19397 / Type A)
Q181S7 2.54e-94 295 36 9 462 3 mnmE tRNA modification GTPase MnmE Clostridioides difficile (strain 630)
A7GJN9 4.13e-94 295 35 6 465 3 mnmE tRNA modification GTPase MnmE Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A4J9S1 4.96e-94 294 39 7 469 3 mnmE tRNA modification GTPase MnmE Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A5N451 1.29e-93 293 34 7 467 3 mnmE tRNA modification GTPase MnmE Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q899S2 1.58e-93 293 35 10 470 3 mnmE tRNA modification GTPase MnmE Clostridium tetani (strain Massachusetts / E88)
A5CY46 3.57e-92 289 40 11 471 3 mnmE tRNA modification GTPase MnmE Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q97CW2 8.72e-92 288 35 10 469 3 mnmE tRNA modification GTPase MnmE Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q67J33 3.63e-91 287 39 9 461 3 mnmE tRNA modification GTPase MnmE Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A6M3M5 4.15e-91 287 35 7 469 3 mnmE tRNA modification GTPase MnmE Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A5G9V3 5.74e-91 286 38 8 467 3 mnmE tRNA modification GTPase MnmE Geotalea uraniireducens (strain Rf4)
Q1IHC2 1.21e-90 285 38 9 463 3 mnmE tRNA modification GTPase MnmE Koribacter versatilis (strain Ellin345)
Q39ZT0 1.21e-90 285 39 7 466 3 mnmE tRNA modification GTPase MnmE Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q7NHT3 1.62e-90 285 38 6 459 3 mnmE tRNA modification GTPase MnmE Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A0M2N6 5.75e-90 284 37 9 477 3 mnmE tRNA modification GTPase MnmE Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A0PX77 1.64e-88 280 35 10 469 3 mnmE tRNA modification GTPase MnmE Clostridium novyi (strain NT)
Q8XH30 1.71e-87 277 36 6 465 3 mnmE tRNA modification GTPase MnmE Clostridium perfringens (strain 13 / Type A)
Q0TLZ4 1.71e-87 277 36 6 465 3 mnmE tRNA modification GTPase MnmE Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SPQ3 2.55e-87 277 36 6 465 3 mnmE tRNA modification GTPase MnmE Clostridium perfringens (strain SM101 / Type A)
Q3AG56 3.12e-87 277 36 8 466 3 mnmE tRNA modification GTPase MnmE Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B1GYZ9 1e-86 275 34 4 452 3 mnmE tRNA modification GTPase MnmE Endomicrobium trichonymphae
Q11TG8 1.38e-86 275 35 6 455 3 mnmE tRNA modification GTPase MnmE Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A6UEE9 5.68e-86 273 40 9 462 3 mnmE tRNA modification GTPase MnmE Sinorhizobium medicae (strain WSM419)
A3DHY8 1.91e-85 272 34 7 466 3 mnmE tRNA modification GTPase MnmE Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q256D0 2.04e-85 271 39 9 458 3 mnmE tRNA modification GTPase MnmE Chlamydia felis (strain Fe/C-56)
B4RD04 2.2e-85 271 39 7 458 3 mnmE tRNA modification GTPase MnmE Phenylobacterium zucineum (strain HLK1)
Q0BW92 2.32e-85 271 37 8 456 3 mnmE tRNA modification GTPase MnmE Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B1ZWP5 4.69e-85 271 37 7 459 3 mnmE tRNA modification GTPase MnmE Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
B1YGA8 1.05e-84 270 36 7 466 3 mnmE tRNA modification GTPase MnmE Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A6WX76 1.73e-84 269 38 8 460 3 mnmE tRNA modification GTPase MnmE Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B3PS53 1.8e-84 269 40 6 459 3 mnmE tRNA modification GTPase MnmE Rhizobium etli (strain CIAT 652)
A8LPC2 2.06e-84 268 36 7 459 3 mnmE tRNA modification GTPase MnmE Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A8I264 2.1e-84 268 38 9 462 3 mnmE tRNA modification GTPase MnmE Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q2S6H2 2.68e-84 269 39 7 464 3 mnmE tRNA modification GTPase MnmE Salinibacter ruber (strain DSM 13855 / M31)
B2IJQ3 2.85e-84 269 38 8 459 3 mnmE tRNA modification GTPase MnmE Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q1MA18 4.26e-84 268 40 7 460 3 mnmE tRNA modification GTPase MnmE Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A0LE48 5.1e-84 269 36 7 470 3 mnmE tRNA modification GTPase MnmE Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B3Q8A8 3.68e-83 266 39 7 456 3 mnmE tRNA modification GTPase MnmE Rhodopseudomonas palustris (strain TIE-1)
Q2LSF6 4.01e-83 266 36 9 461 3 mnmE tRNA modification GTPase MnmE Syntrophus aciditrophicus (strain SB)
Q02A42 4.97e-83 265 38 8 457 3 mnmE tRNA modification GTPase MnmE Solibacter usitatus (strain Ellin6076)
Q6G1K8 5.54e-83 265 37 10 457 3 mnmE tRNA modification GTPase MnmE Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A9IZY1 5.91e-83 265 37 8 454 3 mnmE tRNA modification GTPase MnmE Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q6ND14 9.98e-83 265 38 7 456 3 mnmE tRNA modification GTPase MnmE Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A7HSK9 1.65e-82 264 42 12 459 3 mnmE tRNA modification GTPase MnmE Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A7NN19 2.13e-82 264 36 8 476 3 mnmE tRNA modification GTPase MnmE Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q1WVH7 4.09e-82 263 35 8 464 3 mnmE tRNA modification GTPase MnmE Ligilactobacillus salivarius (strain UCC118)
Q8CY34 4.85e-82 263 36 6 455 3 mnmE tRNA modification GTPase MnmE Brucella suis biovar 1 (strain 1330)
Q39PQ9 5.29e-82 263 37 6 466 3 mnmE tRNA modification GTPase MnmE Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A0AMD2 5.46e-82 263 35 11 462 3 mnmE tRNA modification GTPase MnmE Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B0TAB6 5.47e-82 263 38 10 473 3 mnmE tRNA modification GTPase MnmE Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q8YJS6 5.95e-82 263 36 6 455 3 mnmE tRNA modification GTPase MnmE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q821L2 6.39e-82 262 37 9 458 3 mnmE tRNA modification GTPase MnmE Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
A9M9E5 8.47e-82 262 36 6 455 3 mnmE tRNA modification GTPase MnmE Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A8F732 1.12e-81 262 35 8 459 3 mnmE tRNA modification GTPase MnmE Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q746Q3 1.26e-81 262 37 4 462 3 mnmE tRNA modification GTPase MnmE Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q30YQ7 1.29e-81 262 39 12 477 3 mnmE tRNA modification GTPase MnmE Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A5VT20 1.56e-81 261 36 6 455 3 mnmE tRNA modification GTPase MnmE Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q6FYB8 1.62e-81 261 37 9 458 3 mnmE tRNA modification GTPase MnmE Bartonella quintana (strain Toulouse)
Q57AJ6 1.68e-81 261 36 6 455 3 mnmE tRNA modification GTPase MnmE Brucella abortus biovar 1 (strain 9-941)
Q2YR11 1.68e-81 261 36 6 455 3 mnmE tRNA modification GTPase MnmE Brucella abortus (strain 2308)
A4XN51 1.75e-81 261 38 11 466 3 mnmE tRNA modification GTPase MnmE Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A4SGR9 1.89e-81 262 36 8 458 3 mnmE tRNA modification GTPase MnmE Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A6Q3D6 1.92e-81 261 35 8 456 3 mnmE tRNA modification GTPase MnmE Nitratiruptor sp. (strain SB155-2)
Q71VV0 2.01e-81 261 35 10 462 3 mnmE tRNA modification GTPase MnmE Listeria monocytogenes serotype 4b (strain F2365)
A5FGE0 2.13e-81 262 35 8 470 3 mnmE tRNA modification GTPase MnmE Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
B0CJG2 2.27e-81 261 36 6 455 3 mnmE tRNA modification GTPase MnmE Brucella suis (strain ATCC 23445 / NCTC 10510)
Q5L4W0 2.31e-81 261 37 8 458 3 mnmE tRNA modification GTPase MnmE Chlamydia abortus (strain DSM 27085 / S26/3)
Q8Y3M4 2.69e-81 261 35 10 462 3 mnmE tRNA modification GTPase MnmE Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92KW1 3.03e-81 261 39 10 465 3 mnmE tRNA modification GTPase MnmE Rhizobium meliloti (strain 1021)
A4ITX1 3.74e-81 261 35 9 470 3 mnmE tRNA modification GTPase MnmE Geobacillus thermodenitrificans (strain NG80-2)
Q4FNR7 7.82e-81 259 35 9 454 3 mnmE tRNA modification GTPase MnmE Pelagibacter ubique (strain HTCC1062)
Q926U7 8.27e-81 260 35 10 462 3 mnmE tRNA modification GTPase MnmE Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A8MKR9 9.23e-81 260 34 8 468 3 mnmE tRNA modification GTPase MnmE Alkaliphilus oremlandii (strain OhILAs)
A5IKF4 9.81e-81 259 36 12 469 3 mnmE tRNA modification GTPase MnmE Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
P25811 1.4e-80 259 35 13 471 3 mnmE tRNA modification GTPase MnmE Bacillus subtilis (strain 168)
A7ZAW1 2.26e-80 259 35 13 471 3 mnmE tRNA modification GTPase MnmE Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q8YN91 2.54e-80 259 36 8 467 1 mnmE tRNA modification GTPase MnmE Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A8GTM1 3.15e-80 258 36 12 463 3 mnmE tRNA modification GTPase MnmE Rickettsia rickettsii (strain Sheila Smith)
B0BV57 3.15e-80 258 36 12 463 3 mnmE tRNA modification GTPase MnmE Rickettsia rickettsii (strain Iowa)
A8G2J5 3.27e-80 258 35 7 448 3 mnmE tRNA modification GTPase MnmE Prochlorococcus marinus (strain MIT 9215)
Q03D59 3.28e-80 259 35 11 464 3 mnmE tRNA modification GTPase MnmE Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q21CM0 4.45e-80 258 38 8 460 3 mnmE tRNA modification GTPase MnmE Rhodopseudomonas palustris (strain BisB18)
Q65CN1 4.58e-80 258 34 11 466 3 mnmE tRNA modification GTPase MnmE Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A9NE34 4.93e-80 258 36 8 456 3 mnmE tRNA modification GTPase MnmE Acholeplasma laidlawii (strain PG-8A)
A9VTM0 5.23e-80 258 36 11 462 3 mnmE tRNA modification GTPase MnmE Bacillus mycoides (strain KBAB4)
A6LDT9 5.74e-80 258 36 10 466 3 mnmE tRNA modification GTPase MnmE Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A8FJG0 7.65e-80 258 34 11 470 3 mnmE tRNA modification GTPase MnmE Bacillus pumilus (strain SAFR-032)
A9BHZ7 7.66e-80 257 33 8 458 3 mnmE tRNA modification GTPase MnmE Petrotoga mobilis (strain DSM 10674 / SJ95)
Q92GE8 7.99e-80 257 36 12 463 3 mnmE tRNA modification GTPase MnmE Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8KAS1 9.12e-80 258 36 9 463 1 mnmE tRNA modification GTPase MnmE Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q814F6 9.42e-80 257 36 12 464 3 mnmE tRNA modification GTPase MnmE Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A2BNY4 1.06e-79 257 35 7 450 3 mnmE tRNA modification GTPase MnmE Prochlorococcus marinus (strain AS9601)
A3PAQ7 1.13e-79 257 35 7 448 3 mnmE tRNA modification GTPase MnmE Prochlorococcus marinus (strain MIT 9301)
Q5FS11 1.48e-79 256 39 12 455 3 mnmE tRNA modification GTPase MnmE Gluconobacter oxydans (strain 621H)
Q2NIG1 1.91e-79 256 34 10 467 3 mnmE tRNA modification GTPase MnmE Aster yellows witches'-broom phytoplasma (strain AYWB)
A2C018 1.95e-79 256 34 9 465 3 mnmE tRNA modification GTPase MnmE Prochlorococcus marinus (strain NATL1A)
A8YYS1 2.07e-79 256 34 12 466 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain USA300 / TCH1516)
A6QKK2 2.07e-79 256 34 12 466 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain Newman)
Q5HCI3 2.07e-79 256 34 12 466 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain COL)
Q2FDE8 2.07e-79 256 34 12 466 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain USA300)
Q11CN2 2.14e-79 256 38 10 462 3 mnmE tRNA modification GTPase MnmE Chelativorans sp. (strain BNC1)
A6TXE5 2.46e-79 256 35 10 468 3 mnmE tRNA modification GTPase MnmE Alkaliphilus metalliredigens (strain QYMF)
Q8CX54 2.56e-79 256 33 10 471 3 mnmE tRNA modification GTPase MnmE Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B1ZGG9 2.96e-79 256 39 9 459 3 mnmE tRNA modification GTPase MnmE Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B2UPK5 3.62e-79 255 37 9 446 3 mnmE tRNA modification GTPase MnmE Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q047F9 3.81e-79 256 34 7 460 3 mnmE tRNA modification GTPase MnmE Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G7Z4 3.81e-79 256 34 7 460 3 mnmE tRNA modification GTPase MnmE Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q0BWA8 4.51e-79 255 36 8 458 3 mnmE tRNA modification GTPase MnmE Hyphomonas neptunium (strain ATCC 15444)
Q6HAF2 4.78e-79 255 35 11 464 3 mnmE tRNA modification GTPase MnmE Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81JD9 4.78e-79 255 35 11 464 3 mnmE tRNA modification GTPase MnmE Bacillus anthracis
Q9WYA4 5.65e-79 255 36 12 469 1 mnmE tRNA modification GTPase MnmE Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q88RX5 5.65e-79 255 34 10 465 3 mnmE tRNA modification GTPase MnmE Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8CMN5 5.96e-79 255 33 11 472 3 mnmE tRNA modification GTPase MnmE Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HS36 5.96e-79 255 33 11 472 3 mnmE tRNA modification GTPase MnmE Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q630B8 6.05e-79 255 35 12 464 3 mnmE tRNA modification GTPase MnmE Bacillus cereus (strain ZK / E33L)
Q72WU3 6.11e-79 255 35 12 465 3 mnmE tRNA modification GTPase MnmE Bacillus cereus (strain ATCC 10987 / NRS 248)
Q033L0 6.32e-79 255 35 8 460 3 mnmE tRNA modification GTPase MnmE Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
C0R405 6.88e-79 254 34 9 462 3 mnmE tRNA modification GTPase MnmE Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q8DPZ8 7.37e-79 255 35 11 462 3 mnmE tRNA modification GTPase MnmE Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04KR8 7.37e-79 255 35 11 462 3 mnmE tRNA modification GTPase MnmE Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q2RFI8 7.42e-79 255 36 10 471 3 mnmE tRNA modification GTPase MnmE Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q48TS5 7.73e-79 255 34 10 462 3 mnmE tRNA modification GTPase MnmE Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q8DTT8 8.92e-79 254 34 10 464 3 mnmE tRNA modification GTPase MnmE Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q98DZ0 8.95e-79 254 38 7 457 3 mnmE tRNA modification GTPase MnmE Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q30T75 1.09e-78 254 37 12 459 3 mnmE tRNA modification GTPase MnmE Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q2WBH0 1.18e-78 254 40 10 460 3 mnmE tRNA modification GTPase MnmE Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q3MBM5 1.19e-78 254 36 8 464 3 mnmE tRNA modification GTPase MnmE Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A9HE16 1.31e-78 253 38 10 458 3 mnmE tRNA modification GTPase MnmE Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A0RLR2 1.6e-78 254 35 12 464 3 mnmE tRNA modification GTPase MnmE Bacillus thuringiensis (strain Al Hakam)
Q1RKJ6 1.61e-78 254 36 12 465 3 mnmE tRNA modification GTPase MnmE Rickettsia bellii (strain RML369-C)
Q5KU57 1.62e-78 254 35 10 472 3 mnmE tRNA modification GTPase MnmE Geobacillus kaustophilus (strain HTA426)
Q89Z26 1.74e-78 254 35 11 470 3 mnmE tRNA modification GTPase MnmE Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A8GPN6 1.74e-78 253 35 12 467 3 mnmE tRNA modification GTPase MnmE Rickettsia akari (strain Hartford)
A8GUF3 1.85e-78 253 36 12 465 3 mnmE tRNA modification GTPase MnmE Rickettsia bellii (strain OSU 85-389)
A5CFM7 2.2e-78 253 35 12 466 3 mnmE tRNA modification GTPase MnmE Orientia tsutsugamushi (strain Boryong)
B0UJI9 2.21e-78 253 37 11 463 3 mnmE tRNA modification GTPase MnmE Methylobacterium sp. (strain 4-46)
B1IBH5 2.44e-78 253 35 11 462 3 mnmE tRNA modification GTPase MnmE Streptococcus pneumoniae (strain Hungary19A-6)
Q8CX13 2.48e-78 253 35 9 459 3 mnmE tRNA modification GTPase MnmE Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K1I2 2.48e-78 253 35 9 459 3 mnmE tRNA modification GTPase MnmE Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q2K2S0 2.54e-78 253 39 7 460 3 mnmE tRNA modification GTPase MnmE Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5WAG3 2.76e-78 253 34 10 468 3 mnmE tRNA modification GTPase MnmE Shouchella clausii (strain KSM-K16)
A4VWD1 3.02e-78 253 35 8 460 3 mnmE tRNA modification GTPase MnmE Streptococcus suis (strain 05ZYH33)
A4W2N6 3.02e-78 253 35 8 460 3 mnmE tRNA modification GTPase MnmE Streptococcus suis (strain 98HAH33)
Q820T0 3.63e-78 253 35 14 485 3 mnmE tRNA modification GTPase MnmE Enterococcus faecalis (strain ATCC 700802 / V583)
B1L9N6 3.67e-78 253 36 12 469 3 mnmE tRNA modification GTPase MnmE Thermotoga sp. (strain RQ2)
Q8E5T7 3.8e-78 253 35 9 459 3 mnmE tRNA modification GTPase MnmE Streptococcus agalactiae serotype III (strain NEM316)
Q46HI4 4.81e-78 253 34 9 465 3 mnmE tRNA modification GTPase MnmE Prochlorococcus marinus (strain NATL2A)
Q5FF19 4.83e-78 252 36 10 457 3 mnmE tRNA modification GTPase MnmE Ehrlichia ruminantium (strain Gardel)
P66973 5.38e-78 253 34 12 469 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain MW2)
Q6GD92 5.38e-78 253 34 12 469 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain MRSA252)
P66972 5.38e-78 253 34 12 469 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain N315)
A5IWD7 5.38e-78 253 34 12 469 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain JH9)
Q2FUQ2 5.38e-78 253 34 12 469 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U595 5.38e-78 253 34 12 469 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain JH1)
A2RP37 7.16e-78 252 35 10 462 3 mnmE tRNA modification GTPase MnmE Lactococcus lactis subsp. cremoris (strain MG1363)
Q3ANQ3 7.33e-78 253 36 8 466 3 mnmE tRNA modification GTPase MnmE Chlorobium chlorochromatii (strain CaD3)
Q03KR8 7.85e-78 252 34 8 458 3 mnmE tRNA modification GTPase MnmE Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5LZW3 7.85e-78 252 34 8 458 3 mnmE tRNA modification GTPase MnmE Streptococcus thermophilus (strain CNRZ 1066)
Q6G5W4 8.15e-78 252 34 12 469 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain MSSA476)
Q97R24 8.23e-78 252 35 11 460 3 mnmE tRNA modification GTPase MnmE Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B0K8H9 8.37e-78 252 33 9 468 3 mnmE tRNA modification GTPase MnmE Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q03N64 8.56e-78 252 33 9 466 3 mnmE tRNA modification GTPase MnmE Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q9CDH8 9.76e-78 252 35 10 460 3 mnmE tRNA modification GTPase MnmE Lactococcus lactis subsp. lactis (strain IL1403)
A7GVP7 9.82e-78 252 34 9 462 3 mnmE tRNA modification GTPase MnmE Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q2YZB8 1.02e-77 252 34 12 469 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5M4H3 1.05e-77 252 34 8 458 3 mnmE tRNA modification GTPase MnmE Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5SJS7 1.09e-77 251 35 9 460 3 mnmE tRNA modification GTPase MnmE Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q1JLX3 1.2e-77 252 34 10 462 3 mnmE tRNA modification GTPase MnmE Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q8R6K8 1.22e-77 252 33 9 468 3 mnmE tRNA modification GTPase MnmE Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B0K5N4 1.27e-77 252 33 9 468 3 mnmE tRNA modification GTPase MnmE Thermoanaerobacter sp. (strain X514)
Q6MFA3 1.55e-77 251 35 7 455 3 mnmE tRNA modification GTPase MnmE Protochlamydia amoebophila (strain UWE25)
Q02VP7 1.6e-77 251 35 10 462 3 mnmE tRNA modification GTPase MnmE Lactococcus lactis subsp. cremoris (strain SK11)
Q1J6U1 1.62e-77 251 34 10 462 3 mnmE tRNA modification GTPase MnmE Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q9RCA7 1.66e-77 251 34 8 462 3 mnmE tRNA modification GTPase MnmE Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q3SWH5 1.84e-77 251 36 10 461 3 mnmE tRNA modification GTPase MnmE Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A4YJT5 1.91e-77 251 37 7 443 3 mnmE tRNA modification GTPase MnmE Bradyrhizobium sp. (strain ORS 278)
Q5FHQ5 2.13e-77 251 32 8 466 3 mnmE tRNA modification GTPase MnmE Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q6APY7 2.56e-77 251 34 11 470 3 mnmE tRNA modification GTPase MnmE Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q5P9B1 2.82e-77 250 37 13 462 3 mnmE tRNA modification GTPase MnmE Anaplasma marginale (strain St. Maries)
Q64X55 2.87e-77 251 35 11 470 3 mnmE tRNA modification GTPase MnmE Bacteroides fragilis (strain YCH46)
Q5LG80 3.13e-77 251 35 11 470 3 mnmE tRNA modification GTPase MnmE Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q931E1 3.44e-77 251 34 12 469 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X7A8 3.44e-77 251 34 12 469 3 mnmE tRNA modification GTPase MnmE Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q31CZ2 3.85e-77 251 33 6 447 3 mnmE tRNA modification GTPase MnmE Prochlorococcus marinus (strain MIT 9312)
Q0AKE8 3.86e-77 250 38 12 460 3 mnmE tRNA modification GTPase MnmE Maricaulis maris (strain MCS10)
Q5GTQ0 4.08e-77 250 34 9 463 3 mnmE tRNA modification GTPase MnmE Wolbachia sp. subsp. Brugia malayi (strain TRS)
A2REM7 4.29e-77 250 34 9 462 3 mnmE tRNA modification GTPase MnmE Streptococcus pyogenes serotype M5 (strain Manfredo)
Q99ZU0 4.42e-77 250 34 9 462 3 mnmE tRNA modification GTPase MnmE Streptococcus pyogenes serotype M1
Q68VZ0 4.67e-77 250 34 11 463 3 mnmE tRNA modification GTPase MnmE Rickettsia typhi (strain ATCC VR-144 / Wilmington)
O84704 5.51e-77 249 36 9 458 3 mnmE tRNA modification GTPase MnmE Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0BAF3 5.51e-77 249 36 9 458 3 mnmE tRNA modification GTPase MnmE Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B8S4 5.51e-77 249 36 9 458 3 mnmE tRNA modification GTPase MnmE Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q9PLM9 6.68e-77 249 36 11 465 3 mnmE tRNA modification GTPase MnmE Chlamydia muridarum (strain MoPn / Nigg)
Q3KKZ6 6.75e-77 249 36 9 458 3 mnmE tRNA modification GTPase MnmE Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q1JH22 6.85e-77 250 34 9 462 3 mnmE tRNA modification GTPase MnmE Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8P161 6.85e-77 250 34 9 462 3 mnmE tRNA modification GTPase MnmE Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q9ZCI1 7.16e-77 249 34 12 466 3 mnmE tRNA modification GTPase MnmE Rickettsia prowazekii (strain Madrid E)
A8F2P7 8.59e-77 249 35 12 463 3 mnmE tRNA modification GTPase MnmE Rickettsia massiliae (strain Mtu5)
Q8RHA2 9.79e-77 249 33 8 461 3 mnmE tRNA modification GTPase MnmE Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q3AVY3 1.01e-76 249 37 9 452 3 mnmE tRNA modification GTPase MnmE Synechococcus sp. (strain CC9902)
Q4L2Z2 1.52e-76 249 33 11 465 3 mnmE tRNA modification GTPase MnmE Staphylococcus haemolyticus (strain JCSC1435)
Q5XCB7 1.54e-76 249 34 9 462 3 mnmE tRNA modification GTPase MnmE Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q2JIE6 1.71e-76 249 38 12 458 3 mnmE tRNA modification GTPase MnmE Synechococcus sp. (strain JA-2-3B'a(2-13))
P0DG23 2.29e-76 248 34 9 462 3 mnmE tRNA modification GTPase MnmE Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DG22 2.29e-76 248 34 9 462 3 mnmE tRNA modification GTPase MnmE Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B8GW34 2.43e-76 248 37 11 465 3 mnmE tRNA modification GTPase MnmE Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAX2 2.43e-76 248 37 11 465 3 mnmE tRNA modification GTPase MnmE Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q24M98 2.73e-76 248 35 9 468 3 mnmE tRNA modification GTPase MnmE Desulfitobacterium hafniense (strain Y51)
A9KLX9 2.8e-76 248 35 12 473 3 mnmE tRNA modification GTPase MnmE Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A1UQU6 3.69e-76 247 36 12 459 3 mnmE tRNA modification GTPase MnmE Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
A8EV95 3.73e-76 248 35 10 467 3 mnmE tRNA modification GTPase MnmE Aliarcobacter butzleri (strain RM4018)
Q89WP4 3.73e-76 248 40 9 457 3 mnmE tRNA modification GTPase MnmE Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7MVZ2 3.81e-76 248 37 10 474 3 mnmE tRNA modification GTPase MnmE Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A6LMN4 4.58e-76 247 36 14 459 3 mnmE tRNA modification GTPase MnmE Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
A9CHB2 4.97e-76 247 38 11 463 3 mnmE tRNA modification GTPase MnmE Agrobacterium fabrum (strain C58 / ATCC 33970)
B3CMJ7 5.83e-76 247 33 10 464 3 mnmE tRNA modification GTPase MnmE Wolbachia pipientis subsp. Culex pipiens (strain wPip)
A5UY19 5.94e-76 248 36 9 473 3 mnmE tRNA modification GTPase MnmE Roseiflexus sp. (strain RS-1)
Q040F3 7.76e-76 247 35 12 464 3 mnmE tRNA modification GTPase MnmE Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
A6GXB2 1.03e-75 247 35 9 467 3 mnmE tRNA modification GTPase MnmE Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
A8AXP0 1.05e-75 247 33 9 460 3 mnmE tRNA modification GTPase MnmE Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A8Z5X0 1.05e-75 246 30 10 470 3 mnmE tRNA modification GTPase MnmE Karelsulcia muelleri (strain GWSS)
A3CNB0 1.21e-75 246 34 8 460 3 mnmE tRNA modification GTPase MnmE Streptococcus sanguinis (strain SK36)
Q2JSU8 1.64e-75 246 37 12 458 3 mnmE tRNA modification GTPase MnmE Synechococcus sp. (strain JA-3-3Ab)
Q6YPI0 1.74e-75 246 33 10 467 3 mnmE tRNA modification GTPase MnmE Onion yellows phytoplasma (strain OY-M)
Q3B1B4 1.85e-75 246 36 12 469 3 mnmE tRNA modification GTPase MnmE Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q7VE01 1.98e-75 246 36 9 457 3 mnmE tRNA modification GTPase MnmE Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A8EZV9 2.3e-75 245 35 11 467 3 mnmE tRNA modification GTPase MnmE Rickettsia canadensis (strain McKiel)
Q9Z768 2.46e-75 245 36 10 461 3 mnmE tRNA modification GTPase MnmE Chlamydia pneumoniae
Q2GIJ8 3.13e-75 245 35 7 460 3 mnmE tRNA modification GTPase MnmE Anaplasma phagocytophilum (strain HZ)
B0S3V2 3.26e-75 245 34 7 459 3 mnmE tRNA modification GTPase MnmE Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q2GI42 3.33e-75 245 35 11 459 3 mnmE tRNA modification GTPase MnmE Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
A8YTQ7 4.41e-75 245 33 8 466 3 mnmE tRNA modification GTPase MnmE Lactobacillus helveticus (strain DPC 4571)
Q16CZ5 7.03e-75 244 35 7 452 3 mnmE tRNA modification GTPase MnmE Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q1QRZ0 1.14e-74 244 37 10 460 3 mnmE tRNA modification GTPase MnmE Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q9RVL1 1.69e-74 243 36 9 456 3 mnmE tRNA modification GTPase MnmE Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q3AGU7 2.47e-74 243 37 7 450 3 mnmE tRNA modification GTPase MnmE Synechococcus sp. (strain CC9605)
Q72VY6 3.25e-74 243 33 7 468 3 mnmE tRNA modification GTPase MnmE Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B1M0E0 3.96e-74 242 36 10 466 3 mnmE tRNA modification GTPase MnmE Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q07UP2 4.7e-74 242 34 9 474 3 mnmE tRNA modification GTPase MnmE Rhodopseudomonas palustris (strain BisA53)
B0JVV0 9.49e-74 241 34 7 463 3 mnmE tRNA modification GTPase MnmE Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
P97043 1.02e-73 241 33 7 468 3 mnmE tRNA modification GTPase MnmE Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
A1BCU6 1.06e-73 242 35 8 470 3 mnmE tRNA modification GTPase MnmE Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q13E22 1.06e-73 241 37 8 475 3 mnmE tRNA modification GTPase MnmE Rhodopseudomonas palustris (strain BisB5)
Q4UK70 1.07e-73 242 33 13 498 3 mnmE tRNA modification GTPase MnmE Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q7U3V6 1.33e-73 241 38 10 453 3 mnmE tRNA modification GTPase MnmE Parasynechococcus marenigrum (strain WH8102)
Q0I6N5 1.4e-73 241 36 8 461 3 mnmE tRNA modification GTPase MnmE Synechococcus sp. (strain CC9311)
Q74H94 1.7e-73 241 34 9 460 3 mnmE tRNA modification GTPase MnmE Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q5HCD7 1.72e-73 240 35 12 464 3 mnmE tRNA modification GTPase MnmE Ehrlichia ruminantium (strain Welgevonden)
Q7M901 3.69e-73 240 34 6 451 3 mnmE tRNA modification GTPase MnmE Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A6L6E8 3.92e-73 241 33 15 507 3 mnmE tRNA modification GTPase MnmE Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A5E8G7 6.4e-73 239 36 8 450 3 mnmE tRNA modification GTPase MnmE Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q72K85 1.17e-72 238 34 9 456 3 mnmE tRNA modification GTPase MnmE Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q6MGL5 1.21e-72 239 33 10 478 3 mnmE tRNA modification GTPase MnmE Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q5LLM7 2.43e-72 237 36 7 454 3 mnmE tRNA modification GTPase MnmE Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1J154 2.48e-72 237 36 7 456 3 mnmE tRNA modification GTPase MnmE Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A1AXX6 2.77e-72 237 36 9 452 3 mnmE tRNA modification GTPase MnmE Paracoccus denitrificans (strain Pd 1222)
Q8KPU2 2.78e-72 238 36 9 465 3 mnmE tRNA modification GTPase MnmE Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q55C52 3.06e-72 239 35 13 494 3 gtpbp3 tRNA modification GTPase gtpbp3, mitochondrial Dictyostelium discoideum
Q1MPF1 3.11e-72 238 35 10 472 3 mnmE tRNA modification GTPase MnmE Lawsonia intracellularis (strain PHE/MN1-00)
B1HPM3 3.27e-72 238 33 12 472 3 mnmE tRNA modification GTPase MnmE Lysinibacillus sphaericus (strain C3-41)
A5GPA1 5.15e-72 237 35 9 455 3 mnmE tRNA modification GTPase MnmE Synechococcus sp. (strain WH7803)
Q73GH3 5.71e-72 238 32 13 517 3 mnmE tRNA modification GTPase MnmE Wolbachia pipientis wMel
Q9RL97 7.7e-72 237 33 10 463 3 mnmE tRNA modification GTPase MnmE Streptococcus agalactiae
A6QAL0 1.36e-71 236 35 10 454 3 mnmE tRNA modification GTPase MnmE Sulfurovum sp. (strain NBC37-1)
A9WKE3 2.69e-71 235 39 9 462 3 mnmE tRNA modification GTPase MnmE Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS17550
Feature type CDS
Gene mnmE
Product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
Location 144940 - 146304 (strand: -1)
Length 1365 (nucleotides) / 454 (amino acids)

Contig

Accession term accessions NZ_VXKB01000007 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 196482 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2087
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01926 50S ribosome-binding GTPase
PF10396 GTP-binding protein TrmE N-terminus
PF12631 MnmE helical domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0486 Translation, ribosomal structure and biogenesis (J) J tRNA U34 5-carboxymethylaminomethyl modifying GTPase MnmE/TrmE

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03650 tRNA modification GTPase [EC:3.6.-.-] - -

Protein Sequence

MQSTDTIVAQATPPGRGGVGILRVSGPQAVQVAQIVLGKLPKARYADYLPFRDETGNILDQGIAIFFPGPNSFTGEDVLELQGHGGPVILDLLLKRILLIDNIRIANPGEFSERAFLNDKLDLAQAEAIADLIDASSEQAARSAMNSLQGAFSGEVHQMVEALTNLRIYVEAAIDFPDEEIDFLSDGVIEAKLDTVIAHLERVRSQARQGSLLREGMKVVIAGRPNAGKSSLLNALAGREAAIVTAIAGTTRDVLREHIHIDGMPLHIIDTAGLREAGDEVERIGIERAWQEISQADRVLFMVDGTTIDAQTPEQIWPEFMARLPAGIPVTVIRNKTDITGESTGMTELNGNTLIKLSAREGNGIDLLRDHLKVTMGFEGNTEGGFLARRRHLQALNTAAEHLISGHEQLVVACSGELLAEELRLAQLTLSEITGEFTSDDLLGRIFSSFCIGK

Flanking regions ( +/- flanking 50bp)

ATTATTTATCGCACGGTAAGAAAAGAGAGATTGTTATGAATAACGTTGAAATTCAGAGCACTGATACCATTGTGGCACAGGCAACACCACCCGGGCGTGGCGGCGTCGGGATCTTGCGTGTATCCGGACCGCAGGCGGTACAGGTGGCTCAGATTGTTTTGGGTAAACTTCCCAAAGCGCGTTATGCCGATTATCTGCCTTTCCGTGATGAAACAGGCAATATCTTAGATCAGGGAATCGCGATTTTCTTCCCGGGACCGAACTCCTTTACAGGGGAAGATGTACTGGAACTCCAGGGGCACGGCGGACCGGTTATCCTTGATTTATTGCTTAAACGTATTTTACTTATCGATAATATTCGTATTGCCAATCCGGGTGAATTTTCTGAACGGGCATTCCTTAATGACAAATTGGATCTTGCCCAGGCGGAAGCCATTGCCGACCTGATTGATGCCAGCTCAGAGCAGGCCGCGCGTTCTGCCATGAATTCATTGCAGGGTGCATTTTCCGGGGAAGTTCACCAAATGGTGGAAGCACTTACTAACTTGCGGATCTATGTGGAAGCGGCGATAGATTTTCCTGATGAAGAAATCGACTTTCTCTCTGACGGCGTGATTGAGGCAAAGTTAGATACCGTGATCGCCCATCTGGAACGTGTTCGTTCGCAGGCTCGTCAGGGCAGTTTACTGCGTGAAGGTATGAAAGTAGTGATTGCCGGGCGTCCGAATGCAGGGAAATCCAGTTTACTGAATGCGTTGGCGGGACGTGAAGCGGCGATTGTGACGGCTATCGCGGGAACTACCCGTGATGTTCTGCGTGAACATATTCATATCGATGGTATGCCGCTGCATATTATTGATACCGCCGGATTACGTGAAGCCGGTGACGAAGTTGAGCGTATCGGTATTGAGCGTGCATGGCAGGAAATCAGTCAGGCAGACCGCGTTCTGTTTATGGTGGATGGCACTACGATTGATGCGCAGACACCGGAGCAAATCTGGCCTGAATTTATGGCGCGCTTACCGGCAGGTATTCCGGTGACGGTGATCCGCAATAAAACCGATATCACCGGGGAATCTACCGGTATGACGGAGCTGAACGGCAATACATTGATTAAACTCTCTGCCCGCGAAGGTAACGGGATTGATTTGCTGCGCGATCATCTGAAAGTTACGATGGGGTTTGAAGGAAATACCGAAGGGGGATTTCTTGCCCGCCGCCGGCATTTACAGGCACTGAATACCGCCGCAGAACACCTGATATCCGGTCATGAACAGTTAGTGGTTGCGTGCTCCGGCGAATTACTGGCAGAAGAGCTGCGTCTTGCTCAGCTGACTCTGAGTGAAATTACCGGCGAATTTACCTCTGATGATTTACTCGGACGTATTTTCTCGAGTTTTTGTATTGGTAAGTAGTTTTTCGTCCATATAGGTCCGAGAACGTTCTCTAACCCGTATTAATTGTC