Homologs in group_348

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12235 FBDBKF_12235 93.8 Morganella morganii S1 cytR DNA-binding transcriptional regulator CytR
EHELCC_14070 EHELCC_14070 93.8 Morganella morganii S2 cytR DNA-binding transcriptional regulator CytR
NLDBIP_15165 NLDBIP_15165 93.8 Morganella morganii S4 cytR DNA-binding transcriptional regulator CytR
LHKJJB_15445 LHKJJB_15445 93.8 Morganella morganii S3 cytR DNA-binding transcriptional regulator CytR
HKOGLL_14565 HKOGLL_14565 93.8 Morganella morganii S5 cytR DNA-binding transcriptional regulator CytR
PMI_RS14670 PMI_RS14670 31.7 Proteus mirabilis HI4320 - extracellular solute-binding protein
PMI_RS15915 PMI_RS15915 71.8 Proteus mirabilis HI4320 cytR DNA-binding transcriptional regulator CytR

Distribution of the homologs in the orthogroup group_348

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_348

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ACP0 4.23e-162 459 64 1 339 3 cytR HTH-type transcriptional repressor CytR Shigella flexneri
P0ACN7 4.23e-162 459 64 1 339 1 cytR HTH-type transcriptional repressor CytR Escherichia coli (strain K12)
P0ACN8 4.23e-162 459 64 1 339 3 cytR HTH-type transcriptional repressor CytR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACN9 4.23e-162 459 64 1 339 3 cytR HTH-type transcriptional repressor CytR Escherichia coli O157:H7
P46828 8.69e-67 216 36 2 311 1 ccpA Catabolite control protein A Priestia megaterium
A7N1L2 1.91e-64 210 33 3 330 3 purR HTH-type transcriptional repressor PurR Vibrio campbellii (strain ATCC BAA-1116)
C3LN44 2.62e-64 209 33 3 312 3 purR HTH-type transcriptional repressor PurR Vibrio cholerae serotype O1 (strain M66-2)
Q9KRC1 2.62e-64 209 33 3 312 3 purR HTH-type transcriptional repressor PurR Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F7H0 2.62e-64 209 33 3 312 3 purR HTH-type transcriptional repressor PurR Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q87QW9 3.69e-64 209 33 3 330 3 purR HTH-type transcriptional repressor PurR Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P25144 8.54e-64 208 35 2 311 1 ccpA Catabolite control protein A Bacillus subtilis (strain 168)
Q7MJ57 2.84e-63 207 32 3 330 3 purR HTH-type transcriptional repressor PurR Vibrio vulnificus (strain YJ016)
Q8DAQ5 2.84e-63 207 32 3 330 3 purR HTH-type transcriptional repressor PurR Vibrio vulnificus (strain CMCP6)
B7VMG4 3.38e-63 207 33 4 312 3 purR HTH-type transcriptional repressor PurR Vibrio atlanticus (strain LGP32)
Q6LQB9 5.49e-61 201 33 3 330 3 purR HTH-type transcriptional repressor PurR Photobacterium profundum (strain SS9)
Q7VL44 5.79e-61 201 35 5 311 3 purR HTH-type transcriptional repressor PurR Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9CPA2 3.26e-59 196 32 0 326 3 rbsR Ribose operon repressor Pasteurella multocida (strain Pm70)
P37947 4.12e-59 196 34 2 329 1 degA HTH-type transcriptional regulator DegA Bacillus subtilis (strain 168)
Q32FB3 1.05e-58 195 34 3 309 3 purR HTH-type transcriptional repressor PurR Shigella dysenteriae serotype 1 (strain Sd197)
A7ZMC4 1.14e-58 195 34 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli O139:H28 (strain E24377A / ETEC)
B2VEM5 1.3e-58 195 33 3 312 3 purR HTH-type transcriptional repressor PurR Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B5XWL8 2.04e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Klebsiella pneumoniae (strain 342)
P0ACP9 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Shigella flexneri
Q0T4B4 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Shigella flexneri serotype 5b (strain 8401)
Q321B7 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Shigella boydii serotype 4 (strain Sb227)
B2U2G3 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LEM6 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli (strain SMS-3-5 / SECEC)
B6IB98 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli (strain SE11)
B7NBB1 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ACP7 4.27e-58 194 34 3 309 1 purR HTH-type transcriptional repressor PurR Escherichia coli (strain K12)
B1IQ96 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A0K5 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli O9:H4 (strain HS)
C4ZYC2 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli (strain K12 / MC4100 / BW2952)
B7M0L5 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli O8 (strain IAI1)
B7NTX5 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z492 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ACP8 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli O157:H7
B7L5L1 4.27e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli (strain 55989 / EAEC)
A6TA06 5.34e-58 194 34 3 309 3 purR HTH-type transcriptional repressor PurR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q3Z213 6.62e-58 193 34 3 309 3 purR HTH-type transcriptional repressor PurR Shigella sonnei (strain Ss046)
B7LQA9 1.02e-57 193 34 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5BKD9 1.7e-57 192 34 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella paratyphi A (strain AKU_12601)
Q5PH15 1.7e-57 192 34 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
O68446 2.87e-57 192 34 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TUY8 2.87e-57 192 34 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella schwarzengrund (strain CVM19633)
C0Q5V2 2.87e-57 192 34 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella paratyphi C (strain RKS4594)
A9N0Y2 2.87e-57 192 34 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TH70 2.87e-57 192 34 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella heidelberg (strain SL476)
B5RAM9 2.87e-57 192 34 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QV29 2.87e-57 192 34 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella enteritidis PT4 (strain P125109)
B5FIH3 2.87e-57 192 34 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella dublin (strain CT_02021853)
Q57PK6 2.87e-57 192 34 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella choleraesuis (strain SC-B67)
Q8FH72 3.71e-57 191 33 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1RBD7 4.12e-57 191 33 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli (strain UTI89 / UPEC)
Q0THG9 4.12e-57 191 33 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ABJ9 4.12e-57 191 33 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli O1:K1 / APEC
B7MVD4 4.12e-57 191 33 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli O81 (strain ED1a)
B7MA12 4.12e-57 191 33 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli O45:K1 (strain S88 / ExPEC)
B7URZ9 4.12e-57 191 33 3 309 3 purR HTH-type transcriptional repressor PurR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7MFD3 5.22e-57 191 33 3 309 3 purR HTH-type transcriptional repressor PurR Cronobacter sakazakii (strain ATCC BAA-894)
A5UCM9 6.16e-57 191 33 6 333 3 purR HTH-type transcriptional repressor PurR Haemophilus influenzae (strain PittEE)
Q4QL70 6.16e-57 191 33 6 333 3 purR HTH-type transcriptional repressor PurR Haemophilus influenzae (strain 86-028NP)
B6EH86 7.83e-57 190 30 3 330 3 purR HTH-type transcriptional repressor PurR Aliivibrio salmonicida (strain LFI1238)
A9MEJ1 8.81e-57 190 33 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8Z6P1 9.81e-57 190 33 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella typhi
B4T567 9.81e-57 190 33 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella newport (strain SL254)
B5F6L7 9.81e-57 190 33 3 309 3 purR HTH-type transcriptional repressor PurR Salmonella agona (strain SL483)
B0BP99 3.79e-56 189 33 5 311 3 purR HTH-type transcriptional repressor PurR Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
P0ACQ3 5.51e-56 188 35 1 307 3 rbsR Ribose operon repressor Shigella flexneri
P0ACQ0 5.51e-56 188 35 1 307 1 rbsR Ribose operon repressor Escherichia coli (strain K12)
P0ACQ1 5.51e-56 188 35 1 307 3 rbsR Ribose operon repressor Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ2 5.51e-56 188 35 1 307 3 rbsR Ribose operon repressor Escherichia coli O157:H7
B5FF00 5.61e-56 188 32 4 314 3 purR HTH-type transcriptional repressor PurR Aliivibrio fischeri (strain MJ11)
Q5E4H9 8.69e-56 187 32 4 314 3 purR HTH-type transcriptional repressor PurR Aliivibrio fischeri (strain ATCC 700601 / ES114)
A5UIZ0 8.83e-56 187 32 6 333 3 purR HTH-type transcriptional repressor PurR Haemophilus influenzae (strain PittGG)
Q9CN88 1.83e-55 187 31 3 330 3 purR HTH-type transcriptional repressor PurR Pasteurella multocida (strain Pm70)
B4EWM9 2.3e-55 187 32 3 309 3 purR HTH-type transcriptional repressor PurR Proteus mirabilis (strain HI4320)
Q6D5W3 5.01e-55 186 32 4 317 3 purR HTH-type transcriptional repressor PurR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GDV6 5.82e-55 186 33 3 309 3 purR HTH-type transcriptional repressor PurR Serratia proteamaculans (strain 568)
Q7N3V8 7.6e-55 185 32 3 309 3 purR HTH-type transcriptional repressor PurR Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P44329 8.7e-55 185 31 0 331 3 rbsR Ribose operon repressor Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B3H1F6 9.57e-55 185 33 5 311 3 purR HTH-type transcriptional repressor PurR Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N0H9 9.57e-55 185 33 5 311 3 purR HTH-type transcriptional repressor PurR Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A6VNL0 1.1e-54 185 31 3 330 3 purR HTH-type transcriptional repressor PurR Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B1JJ59 1.23e-54 185 33 3 309 3 purR HTH-type transcriptional repressor PurR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66A32 1.23e-54 185 33 3 309 3 purR HTH-type transcriptional repressor PurR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TIQ4 1.23e-54 185 33 3 309 3 purR HTH-type transcriptional repressor PurR Yersinia pestis (strain Pestoides F)
Q1CIL0 1.23e-54 185 33 3 309 3 purR HTH-type transcriptional repressor PurR Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZB3 1.23e-54 185 33 3 309 3 purR HTH-type transcriptional repressor PurR Yersinia pestis bv. Antiqua (strain Angola)
Q7CIS2 1.23e-54 185 33 3 309 3 purR HTH-type transcriptional repressor PurR Yersinia pestis
B2K5I4 1.23e-54 185 33 3 309 3 purR HTH-type transcriptional repressor PurR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FHK2 1.23e-54 185 33 3 309 3 purR HTH-type transcriptional repressor PurR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C6DK36 1.25e-54 185 32 3 312 3 purR HTH-type transcriptional repressor PurR Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q65TP0 1.52e-54 184 31 5 332 3 purR HTH-type transcriptional repressor PurR Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P46456 2.2e-54 184 31 4 331 3 purR HTH-type transcriptional repressor PurR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
C5BE45 1.04e-53 182 31 1 311 3 purR HTH-type transcriptional repressor PurR Edwardsiella ictaluri (strain 93-146)
Q1C774 2.92e-53 181 33 3 309 3 purR HTH-type transcriptional repressor PurR Yersinia pestis bv. Antiqua (strain Antiqua)
Q0I4B4 4.22e-53 181 32 5 332 3 purR HTH-type transcriptional repressor PurR Histophilus somni (strain 129Pt)
A1JP52 4.72e-53 181 32 3 309 3 purR HTH-type transcriptional repressor PurR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B0UUN7 3.1e-52 178 31 5 332 3 purR HTH-type transcriptional repressor PurR Histophilus somni (strain 2336)
Q45831 1.28e-50 174 30 2 331 4 regA HTH-type transcriptional regulator RegA Clostridium saccharobutylicum
O07567 9.73e-49 169 32 4 329 4 ntdR NTD biosynthesis operon regulator NtdR Bacillus subtilis (strain 168)
P41030 1.67e-48 169 34 3 310 3 galS HTH-type transcriptional regulator GalS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B8F4D0 2.48e-48 168 31 3 309 3 purR HTH-type transcriptional repressor PurR Glaesserella parasuis serovar 5 (strain SH0165)
O87590 4.35e-48 168 30 6 345 4 celR HTH-type transcriptional regulator CelR Thermobifida fusca
P25748 9.69e-47 164 31 1 326 1 galS HTH-type transcriptional regulator GalS Escherichia coli (strain K12)
P03024 1.1e-46 164 28 1 332 1 galR HTH-type transcriptional regulator GalR Escherichia coli (strain K12)
Q9K6K2 2.22e-46 163 31 4 325 3 rbsR Ribose operon repressor Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P58258 2.63e-46 163 30 4 332 3 regA HTH-type transcriptional regulator RegA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O05103 3.91e-46 162 29 5 331 4 None HTH-type transcriptional regulator MalR Clostridium butyricum
P0CL11 1.21e-45 161 31 1 290 3 galR HTH-type transcriptional regulator GalR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WAQ4 1.21e-45 161 31 1 290 3 galR HTH-type transcriptional regulator GalR Salmonella typhimurium (strain SL1344)
Q9JMQ1 8.45e-45 159 30 6 335 2 exuR Probable HTH-type transcriptional repressor ExuR Bacillus subtilis (strain 168)
O07329 7.54e-44 156 29 5 307 3 ccpA Catabolite control protein A Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P36944 9.29e-42 151 31 5 313 4 rbsR Ribose operon repressor Bacillus subtilis (strain 168)
Q05954 5.43e-41 149 30 6 337 4 SCO4158 Uncharacterized HTH-type transcriptional regulator SCO4158 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8CNV8 6.43e-41 149 28 2 310 3 ccpA Catabolite control protein A Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNH3 6.43e-41 149 28 2 310 3 ccpA Catabolite control protein A Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P27871 1.44e-39 145 28 5 320 4 endR Probable HTH-type transcriptional regulator EndR Paenibacillus polymyxa
P77615 3.22e-39 144 29 4 317 4 ycjW Uncharacterized HTH-type transcriptional regulator YcjW Escherichia coli (strain K12)
Q8NW33 4.08e-39 144 27 3 314 3 ccpA Catabolite control protein A Staphylococcus aureus (strain MW2)
Q6G8J1 4.08e-39 144 27 3 314 3 ccpA Catabolite control protein A Staphylococcus aureus (strain MSSA476)
P99175 4.08e-39 144 27 3 314 1 ccpA Catabolite control protein A Staphylococcus aureus (strain N315)
P67655 4.08e-39 144 27 3 314 3 ccpA Catabolite control protein A Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HF38 4.08e-39 144 27 3 314 3 ccpA Catabolite control protein A Staphylococcus aureus (strain COL)
P31766 4.84e-39 144 30 2 293 4 galR HTH-type transcriptional regulator GalR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P72396 5.68e-39 144 30 7 340 4 malR HTH-type transcriptional regulator MalR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P24242 5.82e-39 144 30 3 308 1 ascG HTH-type transcriptional regulator AscG Escherichia coli (strain K12)
P72469 1.33e-38 143 30 7 343 4 reg1 HTH-type transcriptional regulator reg1 Streptomyces lividans
Q56194 1.19e-37 140 28 2 306 3 ccpA Catabolite control protein A Staphylococcus xylosus
Q6GFX2 5.89e-37 138 26 3 314 3 ccpA Catabolite control protein A Staphylococcus aureus (strain MRSA252)
O31690 9.65e-37 137 28 6 327 4 ykvZ Uncharacterized HTH-type transcriptional regulator YkvZ Bacillus subtilis (strain 168)
O06987 4.25e-35 133 28 6 331 4 yvdE Uncharacterized HTH-type transcriptional regulator YvdE Bacillus subtilis (strain 168)
Q88HH7 5.73e-35 133 30 9 334 1 ptxS HTH-type transcriptional regulator PtxS Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P50844 2.23e-34 132 27 9 349 1 kdgR HTH-type transcriptional regulator KdgR Bacillus subtilis (strain 168)
P0ACP5 5.24e-34 130 30 7 312 1 gntR HTH-type transcriptional regulator GntR Escherichia coli (strain K12)
P0ACP6 5.24e-34 130 30 7 312 3 gntR HTH-type transcriptional regulator GntR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23823 1.68e-33 129 28 6 336 4 None Uncharacterized HTH-type transcriptional regulator in aml 5'region Streptomyces limosus
Q9Z3R4 2.57e-33 129 28 6 339 4 aglR HTH-type transcriptional regulator AglR Rhizobium meliloti (strain 1021)
Q9S470 2.71e-33 129 30 8 340 3 araR Arabinose metabolism transcriptional repressor Geobacillus stearothermophilus
P43472 7.47e-33 127 30 7 315 3 scrR Sucrose operon repressor Pediococcus pentosaceus
P0A4T2 5.22e-32 125 28 6 281 1 malR HTH-type transcriptional regulator MalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4T1 5.22e-32 125 28 6 281 1 malR HTH-type transcriptional regulator MalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9CF41 1.11e-31 124 25 4 338 3 rbsR Ribose operon repressor Lactococcus lactis subsp. lactis (strain IL1403)
Q9I1F6 7.43e-31 122 29 4 331 1 gntR HTH-type transcriptional regulator GntR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q48544 2.77e-30 120 26 6 338 4 pepR1 HTH-type transcriptional regulator pepR1 Lactobacillus delbrueckii subsp. lactis
P39343 3.27e-30 120 27 7 313 4 idnR HTH-type transcriptional regulator IdnR Escherichia coli (strain K12)
P03023 5.27e-30 120 29 7 339 1 lacI Lactose operon repressor Escherichia coli (strain K12)
Q54430 3.4e-29 117 28 7 320 4 scrR Sucrose operon repressor Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
G3XD97 2.04e-28 115 28 6 311 1 ptxS HTH-type transcriptional regulator PtxS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A167V873 6.47e-28 114 28 7 337 1 ptxS HTH-type transcriptional regulator PtxS Pseudomonas plecoglossicida
A9KNI6 4.67e-27 112 24 4 329 2 Cphy_2742 HTH-type transcriptional regulator Cphy_2742 Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q9KBQ0 7.65e-27 112 27 6 290 3 araR Arabinose metabolism transcriptional repressor Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P18811 9.19e-27 111 26 4 305 2 malI Maltose regulon regulatory protein MalI Escherichia coli (strain K12)
P62572 2.95e-26 109 27 6 320 3 cscR Sucrose operon repressor Shigella flexneri
P62604 2.95e-26 109 27 6 320 3 cscR Sucrose operon repressor Escherichia coli
O34829 3.01e-26 110 29 11 347 1 melR HTH-type transcriptional repressor MelR Bacillus subtilis (strain 168)
P96711 1.23e-25 108 27 4 283 1 araR Arabinose metabolism transcriptional repressor Bacillus subtilis (strain 168)
P06846 2.51e-25 107 29 9 321 4 ebgR HTH-type transcriptional regulator EbgR Escherichia coli (strain K12)
P37076 8.18e-24 103 27 5 331 4 scrR Sucrose operon repressor Klebsiella pneumoniae
Q04939 1.24e-23 102 26 6 308 4 sacR Sucrose operon repressor Lactococcus lactis subsp. lactis
P21867 2.16e-23 102 27 9 318 1 rafR HTH-type transcriptional regulator RafR Escherichia coli
P37077 5.59e-23 100 26 5 331 4 scrR Sucrose operon repressor Salmonella typhimurium
P37517 2.03e-21 96 27 4 271 1 ccpB Catabolite control protein B Bacillus subtilis (strain 168)
P06220 7.27e-21 95 26 6 332 4 lacI Lactose operon repressor (Fragment) Klebsiella pneumoniae
Q56201 1.96e-19 90 24 3 334 4 malR HTH-type transcriptional regulator MalR Staphylococcus xylosus
O07008 4.1e-18 87 25 10 346 1 ganR HTH-type transcriptional regulator GanR Bacillus subtilis (strain 168)
Q01936 4.36e-17 79 41 1 113 4 lacI Lactose operon repressor (Fragment) Rhizobium radiobacter
Q9ZB11 1.11e-16 83 25 9 322 3 galR HTH-type transcriptional regulator GalR Streptococcus thermophilus
O84905 8.42e-15 77 24 8 341 3 galR HTH-type transcriptional regulator GalR Lacticaseibacillus casei
P96158 3e-14 72 36 1 109 4 malI Maltose regulon regulatory protein MalI (Fragment) Vibrio furnissii
P0A2P8 3.55e-14 75 23 5 310 3 cra Catabolite repressor/activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2P9 3.55e-14 75 23 5 310 3 cra Catabolite repressor/activator Salmonella typhi
P0ACP4 3.79e-14 75 23 5 310 3 cra Catabolite repressor/activator Shigella flexneri
P0ACP1 3.79e-14 75 23 5 310 1 cra Catabolite repressor/activator Escherichia coli (strain K12)
P0ACP2 3.79e-14 75 23 5 310 3 cra Catabolite repressor/activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACP3 3.79e-14 75 23 5 310 3 cra Catabolite repressor/activator Escherichia coli O157:H7
Q8NMF0 2.86e-12 70 25 10 340 1 ipsA HTH-type transcriptional regulator IpsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P36674 5.15e-12 69 23 10 313 3 treR HTH-type transcriptional regulator TreR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P27872 7.45e-11 64 28 1 163 4 opnR Probable opine utilization operon repressor (Fragment) Rhizobium rhizogenes
Q9KM69 1.76e-10 64 21 5 257 1 fruR Fructose operon regulatory protein Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P36673 4.51e-10 63 23 9 311 1 treR HTH-type transcriptional regulator TreR Escherichia coli (strain K12)
P24508 1.27e-08 55 45 0 62 4 scrR Sucrose operon repressor Vibrio alginolyticus
P36949 1.9e-08 58 24 8 273 1 rbsB Ribose import binding protein RbsB Bacillus subtilis (strain 168)
P74892 2.19e-08 58 23 8 293 4 scrR Sucrose operon repressor Staphylococcus xylosus
P07760 1.3e-07 55 26 2 171 4 rbtR Ribitol operon repressor Klebsiella aerogenes
P23822 2.35e-07 51 35 0 67 4 None Uncharacterized HTH-type transcriptional regulator in aml 5'region (Fragment) Streptomyces violaceus
P44737 4.43e-07 54 23 8 268 1 rbsB Ribose import binding protein RbsB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0A2C5 9.12e-07 53 22 10 286 1 rbsB Ribose import binding protein RbsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2C6 9.12e-07 53 22 10 286 3 rbsB Ribose import binding protein RbsB Salmonella typhi
P02925 2.55e-06 52 22 9 283 1 rbsB Ribose import binding protein RbsB Escherichia coli (strain K12)
Q9I2F8 0.000174 46 28 7 169 1 rbsB D-ribose/D-allose-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS17065
Feature type CDS
Gene cytR
Product DNA-binding transcriptional regulator CytR
Location 41433 - 42458 (strand: 1)
Length 1026 (nucleotides) / 341 (amino acids)

Contig

Accession term accessions NZ_VXKB01000007 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 196482 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_348
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00356 Bacterial regulatory proteins, lacI family
PF00532 Periplasmic binding proteins and sugar binding domain of LacI family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1609 Transcription (K) K DNA-binding transcriptional regulator, LacI/PurR family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05499 LacI family transcriptional regulator, repressor for deo operon, udp, cdd, tsx, nupC, and nupG - -

Protein Sequence

MEERRNDTGATMKDVANAAGVSTATVSRTLMNPEKVSVQTRQKVENAVLEVGYYPNNLSRGLKRNDSRTILVIVPDIGDPFFTDIIVGIEEIAAQHGYLVLIGDCRYQHKPEHTFLNLIVTKQIDGMVLLGSNVPFDRPDEQRHLPPMVMANEFAPELELPTVNIDNLTAAFNATHYLQQLGHGRIACISGPEDLPLCQYRIEGYIQAMRRMGMPVRKEYLVRGDFTHESGAACAAQLLALPEPPTAIFCHNDIMAIGVLWAARQQGLTLPRDLSVVGFDDLPAAQYCSPTLTTIAQPRYEIGRHSFLLLLEQLQGRAVAKGSRLLDSDLIIRESACAPKS

Flanking regions ( +/- flanking 50bp)

ACAAAAACCGCACAGATAATTCACTTACAGGGTAAACAAAGGAACCAACGATGGAAGAACGCCGCAATGATACCGGCGCGACCATGAAAGATGTCGCTAACGCTGCCGGCGTCTCAACAGCGACAGTTTCACGAACGCTGATGAACCCGGAAAAAGTGTCGGTGCAAACCCGGCAGAAAGTTGAAAATGCCGTTCTGGAAGTCGGTTACTACCCGAATAATCTCTCCCGGGGATTAAAACGTAATGATTCCCGCACCATTCTTGTTATCGTGCCTGACATCGGCGACCCTTTTTTTACTGATATCATTGTCGGAATTGAAGAAATTGCCGCGCAGCATGGCTATCTTGTGCTGATTGGCGACTGCCGTTATCAGCACAAACCGGAACACACATTCCTTAACCTGATTGTCACCAAACAAATTGACGGCATGGTGTTACTCGGCTCGAACGTCCCGTTTGACCGCCCTGATGAACAGCGCCATCTCCCGCCGATGGTGATGGCAAATGAATTTGCACCGGAACTGGAGCTGCCGACTGTCAATATTGATAACCTGACGGCGGCGTTTAATGCCACACACTATTTGCAGCAACTGGGACACGGGCGGATAGCCTGTATCTCAGGTCCGGAAGATTTACCTCTCTGCCAGTACCGTATCGAGGGGTATATTCAGGCAATGCGCCGGATGGGAATGCCGGTGCGCAAAGAATATCTGGTTCGCGGGGATTTCACACACGAAAGTGGTGCCGCCTGTGCCGCACAACTGCTGGCGCTGCCCGAACCACCCACCGCTATTTTTTGTCACAATGATATTATGGCCATTGGTGTTCTCTGGGCTGCCAGACAGCAGGGGCTGACACTGCCACGGGATCTTTCTGTGGTGGGTTTCGATGATTTACCGGCGGCGCAATATTGCTCCCCGACCCTGACAACGATTGCACAACCCCGCTATGAGATAGGCCGCCACTCTTTTTTACTGCTGCTGGAACAGTTGCAGGGACGCGCTGTTGCTAAGGGATCACGGCTCCTGGATTCTGATTTAATCATCAGAGAAAGTGCTTGTGCGCCTAAAAGCTAGGCAAAAACCGCCATATTCAGTAACATGTAAGGCTGAATAAGATATTTTCT