Homologs in group_166

Help

9 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15970 FBDBKF_15970 30.0 Morganella morganii S1 acrA Multidrug efflux pump subunit AcrA (membrane-fusion protein)
EHELCC_18575 EHELCC_18575 30.0 Morganella morganii S2 acrA Multidrug efflux pump subunit AcrA (membrane-fusion protein)
NLDBIP_17405 NLDBIP_17405 30.0 Morganella morganii S4 acrA Multidrug efflux pump subunit AcrA (membrane-fusion protein)
LHKJJB_17255 LHKJJB_17255 30.0 Morganella morganii S3 acrA Multidrug efflux pump subunit AcrA (membrane-fusion protein)
HKOGLL_17140 HKOGLL_17140 30.0 Morganella morganii S5 acrA Multidrug efflux pump subunit AcrA (membrane-fusion protein)
F4V73_RS16340 F4V73_RS16340 28.9 Morganella psychrotolerans - efflux RND transporter periplasmic adaptor subunit
PMI_RS00640 PMI_RS00640 32.2 Proteus mirabilis HI4320 - efflux RND transporter periplasmic adaptor subunit
PMI_RS13340 PMI_RS13340 24.1 Proteus mirabilis HI4320 - efflux RND transporter periplasmic adaptor subunit
PMI_RS17905 PMI_RS17905 27.7 Proteus mirabilis HI4320 - efflux RND transporter periplasmic adaptor subunit

Distribution of the homologs in the orthogroup group_166

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_166

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8X4L0 3.52e-51 179 33 3 323 3 mdtE Multidrug resistance protein MdtE Escherichia coli O157:H7
P37636 3.67e-51 179 33 3 323 1 mdtE Multidrug resistance protein MdtE Escherichia coli (strain K12)
Q8CVL1 5.65e-51 179 33 3 323 3 mdtE Multidrug resistance protein MdtE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE06 2.64e-47 169 34 4 338 1 acrA Multidrug efflux pump subunit AcrA Escherichia coli (strain K12)
P0AE07 2.64e-47 169 34 4 338 3 acrA Multidrug efflux pump subunit AcrA Escherichia coli O157:H7
Q9WWZ9 8e-47 167 34 8 326 2 ttgA Toluene efflux pump periplasmic linker protein TtgA Pseudomonas putida (strain DOT-T1E)
Q88N30 1.1e-46 167 34 8 326 1 ttgA Probable efflux pump periplasmic linker TtgA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P0C069 1.1e-46 167 34 8 326 1 mepA Multidrug/solvent efflux pump periplasmic linker protein MepA Pseudomonas putida
P24180 2.49e-45 164 32 3 323 1 acrE Multidrug export protein AcrE Escherichia coli (strain K12)
Q8FWV8 3.78e-45 164 31 5 387 1 bepF Efflux pump periplasmic linker BepF Brucella suis biovar 1 (strain 1330)
Q9KJC3 6.4e-44 159 33 7 317 2 arpA Antibiotic efflux pump periplasmic linker protein ArpA Pseudomonas putida
P52477 1.15e-43 159 32 8 329 1 mexA Multidrug resistance protein MexA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8G2M7 1.98e-42 156 33 5 341 1 bepD Efflux pump periplasmic linker BepD Brucella suis biovar 1 (strain 1330)
Q9KWV5 3.59e-42 155 32 9 328 2 ttgD Toluene efflux pump periplasmic linker protein TtgD Pseudomonas putida (strain DOT-T1E)
Q849Q9 3.59e-42 155 32 9 328 3 sepA Probable efflux pump periplasmic linker protein SepA Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
O31099 9.62e-42 154 32 9 327 2 srpA Solvent efflux pump periplasmic linker SrpA Pseudomonas putida
F2EYD8 1.09e-41 154 29 5 384 3 mdtA Multidrug resistance protein MdtA Pantoea ananatis (strain AJ13355)
Q93PU5 1.13e-41 154 32 9 327 2 ttgG Toluene efflux pump periplasmic linker protein TtgG Pseudomonas putida (strain DOT-T1E)
D4I6V2 5.01e-41 152 31 3 348 3 mdtA Multidrug resistance protein MdtA Erwinia amylovora (strain ATCC 49946 / CCPPB 0273 / Ea273 / 27-3)
A4WCC0 6.65e-41 152 30 4 333 3 mdtA Multidrug resistance protein MdtA Enterobacter sp. (strain 638)
A7FG18 1.04e-40 152 28 4 376 3 mdtA Multidrug resistance protein MdtA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1LNW7 2.4e-40 151 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli (strain SMS-3-5 / SECEC)
A4TMR2 5.05e-40 151 30 2 332 3 mdtA Multidrug resistance protein MdtA Yersinia pestis (strain Pestoides F)
Q1CK59 5.05e-40 151 30 2 332 3 mdtA Multidrug resistance protein MdtA Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCW1 5.05e-40 151 30 2 332 3 mdtA Multidrug resistance protein MdtA Yersinia pestis
Q1C5M1 5.05e-40 151 30 2 332 3 mdtA Multidrug resistance protein MdtA Yersinia pestis bv. Antiqua (strain Antiqua)
A6TBH3 5.43e-40 150 31 3 332 3 mdtA Multidrug resistance protein MdtA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4EY99 5.72e-40 150 30 5 372 3 mdtA Multidrug resistance protein MdtA Proteus mirabilis (strain HI4320)
B1JSD5 1.29e-39 150 29 2 332 3 mdtA Multidrug resistance protein MdtA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q7N3E3 1.53e-39 149 30 6 335 3 mdtA Multidrug resistance protein MdtA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B7ME86 2.32e-39 148 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli O45:K1 (strain S88 / ExPEC)
Q668C7 2.59e-39 149 29 2 332 3 mdtA Multidrug resistance protein MdtA Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K9L9 2.59e-39 149 29 2 332 3 mdtA Multidrug resistance protein MdtA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B7NCB0 2.6e-39 148 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NQB2 3.16e-39 148 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7M457 3.84e-39 148 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli O8 (strain IAI1)
Q8CVX8 4.17e-39 148 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TG16 4.17e-39 148 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MWY7 4.25e-39 148 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli O81 (strain ED1a)
A7ZNP7 4.76e-39 147 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli O139:H28 (strain E24377A / ETEC)
Q6D2B2 8.02e-39 147 30 3 327 3 mdtA Multidrug resistance protein MdtA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P76397 8.54e-39 147 29 3 333 2 mdtA Multidrug resistance protein MdtA Escherichia coli (strain K12)
A8A1U6 8.54e-39 147 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli O9:H4 (strain HS)
B1X7H0 8.54e-39 147 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli (strain K12 / DH10B)
C4ZSG2 8.54e-39 147 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli (strain K12 / MC4100 / BW2952)
B7UTB2 8.54e-39 147 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B2TYA9 1.2e-38 146 29 3 333 3 mdtA Multidrug resistance protein MdtA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YUD2 1.2e-38 146 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7J5 1.2e-38 146 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli O157:H7
A1JKX1 3.13e-38 146 28 4 369 3 mdtA Multidrug resistance protein MdtA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B7LV38 3.27e-38 145 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7L9U7 3.93e-38 145 29 3 333 3 mdtA Multidrug resistance protein MdtA Escherichia coli (strain 55989 / EAEC)
C6DBC6 5.05e-38 145 30 5 351 3 mdtA Multidrug resistance protein MdtA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q83KI5 1.49e-37 142 29 3 312 3 mdtA Putative multidrug resistance protein MdtA Shigella flexneri
C9XVZ5 3.26e-36 140 30 4 313 3 mdtA Multidrug resistance protein MdtA Cronobacter turicensis (strain DSM 18703 / CCUG 55852 / LMG 23827 / z3032)
P43505 1.25e-35 138 27 2 334 3 mtrC Membrane fusion protein MtrC Neisseria gonorrhoeae
D3V7P2 1.67e-35 138 28 5 367 3 mdtA Multidrug resistance protein MdtA Xenorhabdus bovienii (strain SS-2004)
C5BHN6 5.19e-34 134 29 3 313 3 mdtA Multidrug resistance protein MdtA Edwardsiella ictaluri (strain 93-146)
D2BTK6 1.09e-31 127 29 4 318 3 mdtA Multidrug resistance protein MdtA Dickeya zeae (strain Ech586)
Q8ZNQ3 2.39e-31 126 28 3 333 3 mdtA Multidrug resistance protein MdtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z5F8 2.75e-31 126 28 3 333 3 mdtA Multidrug resistance protein MdtA Salmonella typhi
C0Q1F4 2.75e-31 126 28 3 333 3 mdtA Multidrug resistance protein MdtA Salmonella paratyphi C (strain RKS4594)
B4T9U0 6.9e-31 125 28 3 333 3 mdtA Multidrug resistance protein MdtA Salmonella heidelberg (strain SL476)
P76185 1.46e-16 82 36 1 119 3 ydhJ Uncharacterized protein YdhJ Escherichia coli (strain K12)
P58411 3.1e-14 77 33 3 178 3 macA Macrolide export protein MacA Yersinia pestis
P75830 7.42e-11 67 32 2 153 1 macA Macrolide export protein MacA Escherichia coli (strain K12)
P64177 1.08e-10 66 28 4 195 3 macA Macrolide export protein MacA Shigella flexneri
P64176 1.08e-10 66 28 4 195 3 macA Macrolide export protein MacA Escherichia coli O157:H7
Q57500 1.29e-09 63 23 8 325 3 HI_0894 Uncharacterized protein HI_0894 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B2VGW1 2.04e-09 62 31 2 141 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8A550 2.26e-09 62 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O9:H4 (strain HS)
B7NLF9 3.43e-09 61 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5XSP8 3.9e-09 61 27 3 183 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Klebsiella pneumoniae (strain 342)
B7M0V3 5.77e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O8 (strain IAI1)
A7MJB1 5.88e-09 60 29 5 185 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Cronobacter sakazakii (strain ATCC BAA-894)
Q83Q03 6.21e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Shigella flexneri
Q0T047 6.32e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Shigella flexneri serotype 5b (strain 8401)
P46482 6.32e-09 60 29 5 177 2 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain K12)
B1XHL3 6.32e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain K12 / DH10B)
C4ZSX9 6.32e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain K12 / MC4100 / BW2952)
B7LHU9 6.32e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain 55989 / EAEC)
A7ZSD5 6.32e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YX06 6.5e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Shigella sonnei (strain Ss046)
B7NDL9 7.12e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q32B98 7.79e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Shigella dysenteriae serotype 1 (strain Sd197)
Q1R698 7.79e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain UTI89 / UPEC)
B1LGK7 7.79e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain SMS-3-5 / SECEC)
B6I1V9 7.79e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain SE11)
B1IQN8 7.79e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FD50 7.79e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCM4 7.79e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGD4 7.79e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O1:K1 / APEC
B7N0M6 7.79e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O81 (strain ED1a)
B7MC02 7.79e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJX3 7.79e-09 60 29 5 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P13510 9.02e-09 60 24 10 305 1 czcB Cobalt-zinc-cadmium resistance protein CzcB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P94176 1.15e-08 60 24 10 305 3 czcB Cation efflux system protein CzcB Alcaligenes sp. (strain CT14)
Q83P86 2.41e-08 58 27 5 176 3 mdtN Multidrug resistance protein MdtN Shigella flexneri
A1JRH9 5.68e-08 57 29 4 160 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P32716 7.09e-08 57 27 5 176 2 mdtN Multidrug resistance protein MdtN Escherichia coli (strain K12)
B1JKI2 7.87e-08 57 23 9 282 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
B7LRL6 7.9e-08 57 31 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q8X5R2 8.72e-08 57 28 6 179 3 mdtN Multidrug resistance protein MdtN Escherichia coli O157:H7
A7FDT5 9.35e-08 57 28 5 160 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q665H1 1.01e-07 57 28 4 160 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pseudotuberculosis serotype I (strain IP32953)
A4THE9 1.01e-07 57 28 4 160 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis (strain Pestoides F)
Q1CDW6 1.01e-07 57 28 4 160 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R1V9 1.01e-07 57 28 4 160 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAU9 1.01e-07 57 28 4 160 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis
B2K437 1.01e-07 57 28 4 160 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C1L2 1.01e-07 57 28 4 160 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis bv. Antiqua (strain Antiqua)
Q88F89 1.1e-07 57 24 11 359 1 pvdR Pyoverdine export membrane fusion protein PvdR Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A8AQD5 1.29e-07 56 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MNW9 1.62e-07 56 31 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5YSW7 2.55e-07 55 29 6 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9E5 2.55e-07 55 29 6 177 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O157:H7
Q8FAX1 2.7e-07 55 27 5 176 3 mdtN Multidrug resistance protein MdtN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B4TX73 3.92e-07 55 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella schwarzengrund (strain CVM19633)
B5F7M5 3.92e-07 55 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella agona (strain SL483)
Q7CPM8 5.94e-07 54 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XF83 5.94e-07 54 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella typhi
B5BGR9 5.94e-07 54 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella paratyphi A (strain AKU_12601)
C0PZR0 5.94e-07 54 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella paratyphi C (strain RKS4594)
A9N863 5.94e-07 54 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJT8 5.94e-07 54 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T775 5.94e-07 54 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella newport (strain SL254)
B4TJT9 5.94e-07 54 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella heidelberg (strain SL476)
B5R1A8 5.94e-07 54 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella enteritidis PT4 (strain P125109)
B5FIU3 5.94e-07 54 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella dublin (strain CT_02021853)
Q57JA3 5.94e-07 54 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella choleraesuis (strain SC-B67)
A4WF55 6.56e-07 54 28 5 180 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Enterobacter sp. (strain 638)
Q6DAH5 1.05e-06 53 29 3 144 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8AIZ1 5.73e-06 51 24 8 262 3 CKO_02332 UPF0194 membrane protein CKO_02332 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5REW3 6.58e-06 51 30 4 143 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella gallinarum (strain 287/91 / NCTC 13346)
A1A936 8.84e-06 50 24 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O1:K1 / APEC
B7MQP9 8.84e-06 50 24 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O81 (strain ED1a)
B7MGQ3 8.84e-06 50 24 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O45:K1 (strain S88 / ExPEC)
C6DIM2 1.14e-05 50 26 2 142 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q8FJN6 1.24e-05 50 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJQ3 1.29e-05 50 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1RED2 1.5e-05 50 24 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain UTI89 / UPEC)
A8GK45 1.67e-05 50 26 3 165 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Serratia proteamaculans (strain 568)
P0AFV0 1.92e-05 50 25 3 176 1 yibH Inner membrane protein YibH Escherichia coli (strain K12)
P0AFV1 1.92e-05 50 25 3 176 3 yibH Inner membrane protein YibH Escherichia coli O157:H7
B7LJW4 3.08e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NA95 3.08e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NNM5 3.08e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q8X7Y9 3.08e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O157:H7
B7ULZ2 3.08e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q3Z3Z0 3.25e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Shigella sonnei (strain Ss046)
B6I7V1 3.25e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain SE11)
P75777 3.25e-05 49 23 8 295 2 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain K12)
B1X7C5 3.25e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain K12 / DH10B)
C4ZXW7 3.25e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain K12 / MC4100 / BW2952)
B7M768 3.25e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O8 (strain IAI1)
B7LC78 3.25e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain 55989 / EAEC)
A7ZJK6 3.39e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0T6G6 3.42e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Shigella flexneri serotype 5b (strain 8401)
B1LM86 3.42e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain SMS-3-5 / SECEC)
B1IXH3 3.42e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZY51 3.42e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O9:H4 (strain HS)
B5YS86 3.42e-05 49 23 8 295 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q32I67 3.89e-05 48 23 8 295 3 ybhG UPF0194 membrane protein YbhG Shigella dysenteriae serotype 1 (strain Sd197)
A4W8D7 3.95e-05 48 24 8 260 3 Ent638_1286 UPF0194 membrane protein Ent638_1286 Enterobacter sp. (strain 638)
Q83S36 6.13e-05 48 23 8 295 3 ybhG UPF0194 membrane protein YbhG Shigella flexneri
Q323Z9 8.45e-05 47 23 8 295 3 ybhG UPF0194 membrane protein YbhG Shigella boydii serotype 4 (strain Sb227)
P77239 0.000811 45 25 6 202 1 cusB Cation efflux system protein CusB Escherichia coli (strain K12)
B5R785 0.000851 44 23 8 267 3 ybhG UPF0194 membrane protein YbhG Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q8ZQP0 0.000881 44 23 8 262 3 ybhG UPF0194 membrane protein YbhG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z879 0.000881 44 23 8 262 3 ybhG UPF0194 membrane protein YbhG Salmonella typhi
C0PX06 0.000881 44 23 8 262 3 ybhG UPF0194 membrane protein YbhG Salmonella paratyphi C (strain RKS4594)
B5QXS4 0.000881 44 23 8 262 3 ybhG UPF0194 membrane protein YbhG Salmonella enteritidis PT4 (strain P125109)
B5FP83 0.000881 44 23 8 262 3 ybhG UPF0194 membrane protein YbhG Salmonella dublin (strain CT_02021853)
Q57RE0 0.000881 44 23 8 262 3 ybhG UPF0194 membrane protein YbhG Salmonella choleraesuis (strain SC-B67)
B5F095 0.000881 44 23 8 262 3 ybhG UPF0194 membrane protein YbhG Salmonella agona (strain SL483)
Q8CWA2 0.001 45 25 6 202 3 cusB Cation efflux system protein CusB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A9MIT3 0.001 44 23 8 262 3 ybhG UPF0194 membrane protein YbhG Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS17015
Feature type CDS
Gene -
Product efflux RND transporter periplasmic adaptor subunit
Location 27773 - 28999 (strand: -1)
Length 1227 (nucleotides) / 408 (amino acids)

Contig

Accession term accessions NZ_VXKB01000007 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 196482 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_166
Orthogroup size 10
N. genomes 7

Actions

Genomic region

Domains

PF16576 Barrel-sandwich domain of CusB or HlyD membrane-fusion

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0845 Cell wall/membrane/envelope biogenesis (M)
Defense mechanisms (V)
MV Multidrug efflux pump subunit AcrA (membrane-fusion protein)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K19595 membrane fusion protein, gold/copper resistance efflux system - Multidrug resistance, efflux pump MexPQ-OpmE

Protein Sequence

MKMKIGVYATIFAAIAMGNIAAAQDNKNESKPESTSDIMLAKVPVAEVIQRDIVPFSEFTGYLAAPKIVELRPRVGGRINSVSIPEGQIIQKGDLLFLIDPQPFQIALDNAIGQLSQAEASALRANSDYNRIKKLIDKGVVSRKDYDDAQANRTVSNAQVKSAKAAVDAAKLNLSYTQVKAPITGRVDRALITEGNLVTGGDINTATLLTTIVSIDPVYAYFDIDEKTFHKLSAIQAESGTDQGTERPSVNISVSEEKNYPYSGSLDFMSNQIDRTTGTVKARAVVKNKNGTLIPGSFIRVQLPVGIKTSSILIDDQAIGFNQGQSYVLVIDNSNKAVYRQVEPGAMIDGLRVIKSGLVKGERIIIKGLVRPGMEVMPENVPMYLPEAENNNIGQSSDSVLNEAEGNQ

Flanking regions ( +/- flanking 50bp)

CAACAGTATTTAAATTAATTATTAATTTATTTGATCAGGCAAGGTTTTTTATGAAAATGAAAATTGGTGTATATGCAACTATCTTTGCCGCCATTGCAATGGGTAACATTGCGGCTGCACAAGATAATAAAAATGAGAGTAAGCCGGAAAGCACGAGTGATATCATGCTTGCGAAAGTTCCTGTCGCAGAAGTTATCCAGCGGGATATTGTTCCTTTTTCTGAGTTTACCGGCTACCTGGCCGCACCCAAAATAGTGGAATTACGTCCCCGGGTCGGAGGTCGGATTAATTCCGTCAGCATTCCGGAAGGTCAGATTATTCAAAAAGGCGATCTGTTGTTCCTGATCGATCCTCAGCCTTTCCAAATCGCATTAGATAACGCTATTGGTCAGTTAAGTCAGGCTGAAGCATCCGCTTTACGGGCGAATAGTGATTATAACCGAATCAAAAAGCTTATTGATAAAGGCGTAGTTTCCCGTAAAGATTACGATGATGCACAGGCTAATCGTACTGTAAGCAATGCTCAGGTTAAATCAGCAAAAGCCGCTGTTGACGCGGCTAAATTAAATTTATCTTACACGCAGGTTAAAGCACCGATTACAGGCCGGGTTGACAGGGCACTTATTACAGAAGGAAATCTTGTTACCGGCGGTGATATTAACACGGCTACGTTATTAACGACGATTGTCTCAATTGATCCTGTATATGCCTACTTTGATATTGATGAAAAAACCTTTCATAAACTGTCAGCCATACAGGCTGAATCCGGAACAGATCAGGGTACAGAGCGTCCTTCTGTAAATATCAGTGTATCTGAGGAAAAAAATTATCCTTATTCAGGTTCGCTTGATTTTATGAGCAACCAAATTGATCGTACTACGGGCACAGTCAAAGCCCGTGCGGTAGTTAAAAATAAAAATGGAACATTAATACCCGGTTCTTTTATTCGTGTCCAACTCCCTGTTGGTATTAAAACATCTTCAATATTGATTGATGACCAGGCTATTGGTTTTAATCAGGGCCAAAGCTATGTGCTGGTGATTGATAATAGTAATAAAGCGGTATACCGGCAAGTCGAACCGGGGGCGATGATTGATGGACTTCGGGTAATAAAGAGTGGTTTAGTCAAAGGTGAAAGGATCATTATTAAAGGCCTTGTCAGACCGGGAATGGAGGTCATGCCGGAGAATGTTCCGATGTATTTACCGGAGGCTGAGAATAATAACATCGGACAAAGTAGCGATAGCGTATTAAATGAAGCGGAGGGAAATCAATAATGAAGTTCTCTCATTTCTTTATACAGCGGCCAATTTTCGCCATTGTTTTA