Homologs in group_12

Help

19 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01510 FBDBKF_01510 24.3 Morganella morganii S1 araJ putative arabinose efflux permease AraJ, MFS family
FBDBKF_06500 FBDBKF_06500 23.5 Morganella morganii S1 proP MFS family permease, includes anhydromuropeptide permease AmpG
FBDBKF_16510 FBDBKF_16510 23.3 Morganella morganii S1 proP MFS family permease, includes anhydromuropeptide permease AmpG
EHELCC_00035 EHELCC_00035 24.3 Morganella morganii S2 araJ putative arabinose efflux permease AraJ, MFS family
EHELCC_08375 EHELCC_08375 23.3 Morganella morganii S2 proP MFS family permease, includes anhydromuropeptide permease AmpG
EHELCC_09545 EHELCC_09545 23.5 Morganella morganii S2 proP MFS family permease, includes anhydromuropeptide permease AmpG
NLDBIP_03425 NLDBIP_03425 24.3 Morganella morganii S4 araJ putative arabinose efflux permease AraJ, MFS family
NLDBIP_08700 NLDBIP_08700 23.3 Morganella morganii S4 proP MFS family permease, includes anhydromuropeptide permease AmpG
NLDBIP_09925 NLDBIP_09925 23.5 Morganella morganii S4 proP MFS family permease, includes anhydromuropeptide permease AmpG
LHKJJB_04940 LHKJJB_04940 24.3 Morganella morganii S3 araJ putative arabinose efflux permease AraJ, MFS family
LHKJJB_05565 LHKJJB_05565 23.3 Morganella morganii S3 proP MFS family permease, includes anhydromuropeptide permease AmpG
LHKJJB_07830 LHKJJB_07830 23.5 Morganella morganii S3 proP MFS family permease, includes anhydromuropeptide permease AmpG
HKOGLL_02105 HKOGLL_02105 24.3 Morganella morganii S5 araJ putative arabinose efflux permease AraJ, MFS family
HKOGLL_05350 HKOGLL_05350 23.3 Morganella morganii S5 proP MFS family permease, includes anhydromuropeptide permease AmpG
HKOGLL_07380 HKOGLL_07380 23.5 Morganella morganii S5 proP MFS family permease, includes anhydromuropeptide permease AmpG
F4V73_RS01895 F4V73_RS01895 24.1 Morganella psychrotolerans - MFS transporter
F4V73_RS03030 F4V73_RS03030 24.1 Morganella psychrotolerans - MFS transporter
F4V73_RS15430 F4V73_RS15430 22.7 Morganella psychrotolerans - MFS transporter
PMI_RS07710 PMI_RS07710 25.1 Proteus mirabilis HI4320 - MFS transporter

Distribution of the homologs in the orthogroup group_12

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_12

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P40862 3.32e-28 119 25 15 444 3 proP Proline/betaine transporter Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0C0L7 4.39e-28 119 25 15 444 1 proP Proline/betaine transporter Escherichia coli (strain K12)
P0C0L8 4.39e-28 119 25 15 444 3 proP Proline/betaine transporter Escherichia coli O157:H7
Q8NXW9 3.67e-24 107 25 10 377 3 proP Putative proline/betaine transporter Staphylococcus aureus (strain MW2)
Q6GBR4 3.67e-24 107 25 10 377 3 proP Putative proline/betaine transporter Staphylococcus aureus (strain MSSA476)
Q7A771 6.4e-24 106 25 10 377 3 proP Putative proline/betaine transporter Staphylococcus aureus (strain N315)
Q99W36 6.4e-24 106 25 10 377 3 proP Putative proline/betaine transporter Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HIA2 6.4e-24 106 25 10 377 3 proP Putative proline/betaine transporter Staphylococcus aureus (strain COL)
Q9KWK6 6.4e-24 106 25 10 377 3 proP Putative proline/betaine transporter Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GJ96 7.17e-24 106 25 10 378 3 proP Putative proline/betaine transporter Staphylococcus aureus (strain MRSA252)
Q47421 1.68e-23 105 24 13 425 1 ousA Glycine betaine/proline/ectoine/pipecolic acid transporter OusA Dickeya dadantii (strain 3937)
P76350 9.71e-23 102 23 11 405 2 shiA Shikimate transporter Escherichia coli (strain K12)
P16482 3.5e-21 98 24 8 385 3 citH Citrate-proton symporter Klebsiella pneumoniae
Q5HRH0 5.3e-20 95 24 9 379 3 proP Putative proline/betaine transporter Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0AEX4 2.29e-19 92 27 12 333 3 kgtP Alpha-ketoglutarate permease Shigella flexneri
P0AEX3 2.29e-19 92 27 12 333 1 kgtP Alpha-ketoglutarate permease Escherichia coli (strain K12)
P07661 4.05e-17 86 28 2 207 3 citA Citrate-proton symporter Escherichia coli
P0DPR5 1.18e-16 84 26 3 211 2 abaF Fosfomycin resistance protein AbaF Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
P0A2G3 3.24e-16 83 28 2 207 3 citA Citrate-proton symporter Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2G4 3.24e-16 83 28 2 207 3 citA Citrate-proton symporter Salmonella typhi
A4QH18 6.08e-16 82 26 3 197 2 shiA Shikimate transporter Corynebacterium glutamicum (strain R)
Q4L3Q4 1.86e-15 81 24 9 381 3 proP Putative proline/betaine transporter Staphylococcus haemolyticus (strain JCSC1435)
Q79VC4 7.51e-14 76 22 8 391 1 proP Ectoine/proline transporter ProP Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P77228 2.66e-12 71 21 7 347 1 ydfJ Putative transporter YdfJ Escherichia coli (strain K12)
P37643 2.98e-11 68 22 13 423 1 yhjE Inner membrane metabolite transport protein YhjE Escherichia coli (strain K12)
B1JFW5 2.38e-08 59 25 6 200 3 nanT Sialic acid transporter NanT Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668K2 5.56e-08 58 25 6 200 3 nanT Sialic acid transporter NanT Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMJ0 5.56e-08 58 25 6 200 3 nanT Sialic acid transporter NanT Yersinia pestis (strain Pestoides F)
A9QZJ2 5.56e-08 58 25 6 200 3 nanT Sialic acid transporter NanT Yersinia pestis bv. Antiqua (strain Angola)
B2K942 5.56e-08 58 25 6 200 3 nanT Sialic acid transporter NanT Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FG99 5.56e-08 58 25 6 200 3 nanT Sialic acid transporter NanT Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P44610 6.67e-08 57 22 13 427 3 HI_0281 Putative metabolite transport protein HI_0281 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8ZCH3 8.8e-08 57 25 6 200 3 nanT Sialic acid transporter NanT Yersinia pestis
Q1C5V2 8.8e-08 57 25 6 200 3 nanT Sialic acid transporter NanT Yersinia pestis bv. Antiqua (strain Antiqua)
B5F7J8 1.28e-07 57 21 4 198 3 nanT Sialic acid transporter NanT Salmonella agona (strain SL483)
P39352 1.52e-07 56 25 3 147 1 nanX Sialic acid transporter NanX Escherichia coli (strain K12)
A8A534 3.36e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli O9:H4 (strain HS)
Q8FDU9 3.54e-07 55 23 4 198 3 nanT2 Sialic acid transporter NanT 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P59699 3.55e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Shigella flexneri
Q0T066 3.55e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Shigella flexneri serotype 5b (strain 8401)
B2U1W0 3.55e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1IQQ5 3.55e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7M0T6 3.55e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli O8 (strain IAI1)
B7LHS8 3.55e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli (strain 55989 / EAEC)
Q0TCP2 3.61e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B5YSV1 3.61e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9G8 3.61e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli O157:H7
P41036 3.67e-07 55 20 3 198 1 nanT Sialic acid transporter NanT Escherichia coli (strain K12)
B1XHJ7 3.67e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli (strain K12 / DH10B)
C4ZSW2 3.67e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli (strain K12 / MC4100 / BW2952)
P44699 3.75e-07 55 23 2 195 3 HI_0418 Putative metabolite transport protein HI_0418 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A9MNY7 3.77e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B1LGI9 3.87e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli (strain SMS-3-5 / SECEC)
B6I1U2 3.87e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli (strain SE11)
B7NKT5 3.87e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UJV7 3.87e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZSB7 3.87e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli O139:H28 (strain E24377A / ETEC)
B7MBY6 4.01e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia coli O45:K1 (strain S88 / ExPEC)
A8AQB4 4.05e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q8FD59 4.08e-07 55 20 3 198 3 nanT1 Sialic acid transporter NanT 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
C0PZN3 4.27e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella paratyphi C (strain RKS4594)
Q57JD0 4.27e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella choleraesuis (strain SC-B67)
B4TWI9 4.3e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella schwarzengrund (strain CVM19633)
P0A2G5 4.58e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2G6 4.58e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella typhi
A9N832 4.58e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T749 4.58e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella newport (strain SL254)
B5RET6 4.58e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R0L1 4.58e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella enteritidis PT4 (strain P125109)
B5FIR7 4.58e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella dublin (strain CT_02021853)
B5BGP4 4.7e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella paratyphi A (strain AKU_12601)
Q5PLF0 4.7e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TJR2 4.79e-07 55 21 4 198 3 nanT Sialic acid transporter NanT Salmonella heidelberg (strain SL476)
A7MJD1 5.51e-07 55 22 6 209 3 nanT Sialic acid transporter NanT Cronobacter sakazakii (strain ATCC BAA-894)
B7LRJ2 5.91e-07 55 20 3 198 3 nanT Sialic acid transporter NanT Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16950
Feature type CDS
Gene -
Product MFS transporter
Location 11722 - 12930 (strand: -1)
Length 1209 (nucleotides) / 402 (amino acids)

Contig

Accession term accessions NZ_VXKB01000007 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 196482 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_12
Orthogroup size 20
N. genomes 7

Actions

Genomic region

Domains

PF00083 Sugar (and other) transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0477 Carbohydrate transport and metabolism (G)
Amino acid transport and metabolism (E)
Inorganic ion transport and metabolism (P)
General function prediction only (R)		 GEPR MFS family permease, includes anhydromuropeptide permease AmpG

Protein Sequence

MKWRYRLGAAAGNALEYYDIAVFAAISVYLSAELEKQGYESATEMVWGIFALRFLARPIGGYIIGRYADRSGKRSALILTSLITGTATLCMALLPVNLLGVYTPVAILILQMTLSFSFGGEYPSLITYLFSDAKENEKARLSSLIVSSSVLGVIISLGLVFLLEKTLAPEMMQTIGWRIPLLVGLGNIMMSFWFRTRLPALPVHPVKNKRVNCYQALLIFLMTVPGSAVFYSYNMSYSLVREHIQIEVLRNSYTIYSSCLYLFCILICGWLTDKYSSVNSIFRFSIASLVVCSVPIYFLLGSEYFGLVIFAQLILTINAACISCTLASVIAGICEGHTTTLSLGYNLASTFVGGLTPLILSYLVAYDLTFAGAYLAISGLTVVLSYKLMRTNKIKRYTPQTE

Flanking regions ( +/- flanking 50bp)

GATACGGGCTGCCAGGCAGCCCGTGTATAACAGGATAAAGGAAGCAGGGAATGAAATGGAGATACCGGCTGGGAGCCGCGGCAGGGAATGCACTGGAGTATTATGATATTGCGGTTTTTGCCGCTATTTCCGTTTACCTTAGTGCAGAGCTTGAGAAACAGGGTTATGAATCCGCGACAGAAATGGTCTGGGGAATATTTGCACTGCGTTTTTTAGCGCGCCCGATTGGTGGTTATATTATCGGGCGTTATGCAGATAGGTCCGGTAAAAGGTCAGCATTAATATTAACCAGCCTGATTACAGGAACCGCAACATTATGTATGGCATTATTACCGGTTAATCTATTGGGTGTTTATACCCCGGTTGCGATATTAATTTTACAGATGACCTTATCTTTCAGTTTTGGTGGTGAATATCCGTCGTTGATAACGTATTTATTCAGTGATGCAAAAGAAAATGAGAAAGCACGGCTATCATCACTTATAGTATCCAGCTCTGTTTTAGGTGTTATTATTTCTCTCGGGCTGGTTTTTTTGCTGGAAAAAACACTGGCGCCGGAGATGATGCAAACTATAGGCTGGCGTATTCCATTGTTGGTAGGGCTGGGGAATATAATGATGAGCTTTTGGTTCCGTACCCGGTTACCTGCCTTGCCTGTACATCCGGTAAAAAATAAACGCGTTAACTGCTATCAGGCATTATTAATATTTCTGATGACGGTTCCCGGCTCTGCGGTATTCTATTCCTATAATATGTCTTATTCGCTGGTACGTGAGCATATACAGATAGAGGTATTGAGAAATAGCTATACAATATATTCATCTTGTTTGTATTTATTCTGTATTCTTATTTGTGGCTGGTTAACAGATAAATACAGTTCAGTAAATAGTATATTCAGATTCAGTATTGCATCTCTGGTTGTGTGTTCTGTACCGATCTATTTTTTACTGGGTAGTGAATATTTCGGGCTGGTTATTTTTGCTCAGTTAATCCTGACAATTAATGCAGCATGTATTTCATGTACACTGGCATCGGTTATCGCCGGTATTTGTGAGGGGCACACCACAACACTAAGTCTGGGTTATAATCTAGCTTCCACATTTGTCGGCGGATTAACACCACTGATTCTCAGTTATCTTGTCGCTTATGACCTGACATTTGCCGGTGCTTATCTTGCAATATCCGGATTAACCGTCGTGCTCTCGTATAAGTTAATGAGAACTAACAAGATAAAGAGATATACCCCGCAAACTGAATAGGTATTTTCCCATCCGTTGCCGGTACTGCGATTTAGACTCGACTAACAATT