Homologs in group_1742

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12145 FBDBKF_12145 93.6 Morganella morganii S1 sthA Si-specific NAD(P)(+) transhydrogenase
EHELCC_14160 EHELCC_14160 93.6 Morganella morganii S2 sthA Si-specific NAD(P)(+) transhydrogenase
NLDBIP_15255 NLDBIP_15255 93.6 Morganella morganii S4 sthA Si-specific NAD(P)(+) transhydrogenase
LHKJJB_15355 LHKJJB_15355 93.6 Morganella morganii S3 sthA Si-specific NAD(P)(+) transhydrogenase
HKOGLL_14475 HKOGLL_14475 93.6 Morganella morganii S5 sthA Si-specific NAD(P)(+) transhydrogenase
PMI_RS16030 PMI_RS16030 83.7 Proteus mirabilis HI4320 sthA Si-specific NAD(P)(+) transhydrogenase

Distribution of the homologs in the orthogroup group_1742

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1742

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MBG9 0.0 811 83 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4F1H1 0.0 810 83 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Proteus mirabilis (strain HI4320)
B1JQ50 0.0 807 83 2 467 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G61 0.0 807 83 2 467 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRG4 0.0 807 83 2 467 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis (strain Pestoides F)
Q1CNP4 0.0 807 83 2 467 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R6N5 0.0 807 83 2 467 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZA97 0.0 807 83 2 467 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis
B2JZF3 0.0 807 83 2 467 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBU5 0.0 807 83 2 467 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD10 0.0 807 83 2 467 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JI37 0.0 801 82 2 467 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GL77 0.0 794 81 3 467 3 sthA Soluble pyridine nucleotide transhydrogenase Serratia proteamaculans (strain 568)
Q6CZB1 0.0 776 79 1 465 3 sthA Soluble pyridine nucleotide transhydrogenase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C0Q478 0.0 769 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella paratyphi C (strain RKS4594)
Q57H91 0.0 769 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella choleraesuis (strain SC-B67)
A6TGE6 0.0 769 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B2VGA0 0.0 769 77 2 467 3 sthA Soluble pyridine nucleotide transhydrogenase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B5XZ14 0.0 769 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Klebsiella pneumoniae (strain 342)
B1IVB6 0.0 769 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A770 0.0 769 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O9:H4 (strain HS)
P66008 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66009 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella typhi
B5BJN6 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella paratyphi A (strain AKU_12601)
A9N0H2 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PK71 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5QXQ7 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella enteritidis PT4 (strain P125109)
B7LUN3 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A4WG49 0.0 768 78 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Enterobacter sp. (strain 638)
Q1R3U7 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain UTI89 / UPEC)
B6I5I0 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain SE11)
B7NFR2 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P27306 0.0 768 79 1 461 1 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain K12)
A1AIE2 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O1:K1 / APEC
B1XBX3 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain K12 / DH10B)
C5A0R1 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M718 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O8 (strain IAI1)
B7NU38 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z064 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O157:H7 (strain EC4115 / EHEC)
B7LA64 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain 55989 / EAEC)
B7MIA0 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZUI2 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O139:H28 (strain E24377A / ETEC)
B2TWF7 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LNS2 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain SMS-3-5 / SECEC)
Q8FB93 0.0 768 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q83MI1 0.0 766 78 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Shigella flexneri
B5REZ6 0.0 766 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q0TA96 0.0 766 78 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MR55 0.0 766 78 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O81 (strain ED1a)
B7UNU0 0.0 766 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q8X727 0.0 766 78 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O157:H7
A8AKW0 0.0 765 79 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q2NQZ3 0.0 739 76 2 461 3 sthA Soluble pyridine nucleotide transhydrogenase Sodalis glossinidius (strain morsitans)
C3LPZ2 0.0 723 73 1 465 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio cholerae serotype O1 (strain M66-2)
P50529 0.0 723 73 1 465 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4K5 0.0 723 73 1 465 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MQ83 0.0 717 74 1 463 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio vulnificus (strain YJ016)
Q8DD46 0.0 717 74 1 463 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio vulnificus (strain CMCP6)
B7VM91 0.0 715 73 1 465 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio atlanticus (strain LGP32)
Q87KN5 0.0 714 73 1 463 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5E212 0.0 708 71 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6LLT9 0.0 706 72 1 462 3 sthA Soluble pyridine nucleotide transhydrogenase Photobacterium profundum (strain SS9)
C4K3I8 0.0 698 72 2 463 3 sthA Soluble pyridine nucleotide transhydrogenase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q48A14 0.0 666 67 1 461 3 sthA Soluble pyridine nucleotide transhydrogenase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
P57112 0.0 599 62 1 466 1 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02PF5 0.0 599 62 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UZU5 0.0 599 62 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas aeruginosa (strain LESB58)
A6V3A6 0.0 598 61 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas aeruginosa (strain PA7)
Q9XBQ9 0.0 597 62 1 466 1 sthA Soluble pyridine nucleotide transhydrogenase Azotobacter vinelandii
C1DR10 0.0 597 62 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q1I7F0 0.0 592 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas entomophila (strain L48)
B1J606 0.0 592 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas putida (strain W619)
B0KH90 0.0 591 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas putida (strain GB-1)
Q4ZV77 0.0 590 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas syringae pv. syringae (strain B728a)
Q88KY8 0.0 590 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W6F5 0.0 590 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
C3K4W1 0.0 590 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas fluorescens (strain SBW25)
Q884I6 0.0 590 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4XSQ1 0.0 590 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas mendocina (strain ymp)
Q4KFA6 0.0 590 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q48KI8 0.0 589 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
O05139 0.0 588 60 1 466 1 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas fluorescens
A4VMU6 0.0 588 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Stutzerimonas stutzeri (strain A1501)
Q3K9F5 0.0 587 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas fluorescens (strain Pf0-1)
A1U1Y5 0.0 585 60 2 466 3 sthA Soluble pyridine nucleotide transhydrogenase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q1QX78 0.0 579 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A6VW16 0.0 575 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Marinomonas sp. (strain MWYL1)
Q2SIP2 0.0 557 60 1 466 3 sthA Soluble pyridine nucleotide transhydrogenase Hahella chejuensis (strain KCTC 2396)
P9WHH5 1.91e-117 355 42 5 464 1 sthA Probable soluble pyridine nucleotide transhydrogenase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH4 1.91e-117 355 42 5 464 3 sthA Probable soluble pyridine nucleotide transhydrogenase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U665 1.91e-117 355 42 5 464 3 sthA Soluble pyridine nucleotide transhydrogenase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AFH2 1.91e-117 355 42 5 464 3 sthA Soluble pyridine nucleotide transhydrogenase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KM51 1.91e-117 355 42 5 464 3 sthA Soluble pyridine nucleotide transhydrogenase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P66007 1.91e-117 355 42 5 464 3 sthA Probable soluble pyridine nucleotide transhydrogenase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P71317 3.1e-93 281 89 1 151 3 sthA Soluble pyridine nucleotide transhydrogenase (Fragment) Pectobacterium carotovorum subsp. carotovorum
Q9Z773 1.49e-62 213 33 10 466 3 lpdA Dihydrolipoyl dehydrogenase Chlamydia pneumoniae
Q9HUY1 5.96e-61 209 31 6 463 3 lpd3 Dihydrolipoyl dehydrogenase 3 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8KCW2 8.66e-59 203 31 10 477 3 lpd Dihydrolipoyl dehydrogenase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
P18925 9.44e-59 203 31 7 467 1 None Dihydrolipoyl dehydrogenase Azotobacter vinelandii
P43784 4.74e-58 201 30 9 466 3 lpdA Dihydrolipoyl dehydrogenase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O50311 9.13e-58 200 31 10 475 3 lpd Dihydrolipoyl dehydrogenase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
P90597 2.29e-57 199 31 10 444 1 LPD Dihydrolipoyl dehydrogenase Trypanosoma cruzi
P14218 2.98e-57 199 31 6 467 1 lpd Dihydrolipoyl dehydrogenase Pseudomonas fluorescens
Q9PJI3 3.09e-57 199 31 10 461 3 lpdA Dihydrolipoyl dehydrogenase Chlamydia muridarum (strain MoPn / Nigg)
P31046 3.36e-57 199 32 11 484 1 lpd3 Dihydrolipoyl dehydrogenase 3 Pseudomonas putida
O84561 3.81e-57 199 30 7 457 3 lpdA Dihydrolipoyl dehydrogenase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q9I3D1 3.83e-57 199 31 6 467 1 lpdG Dihydrolipoyl dehydrogenase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P11959 1.28e-56 197 31 7 458 1 pdhD Dihydrolipoyl dehydrogenase Geobacillus stearothermophilus
P49819 8.13e-56 196 30 8 472 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial Canis lupus familiaris
O50286 8.31e-56 195 29 10 466 3 lpd Dihydrolipoyl dehydrogenase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
O17953 1.29e-55 195 29 8 461 3 dld-1 Dihydrolipoyl dehydrogenase, mitochondrial Caenorhabditis elegans
P31052 1.84e-55 194 31 9 473 1 lpdG Dihydrolipoyl dehydrogenase Pseudomonas putida
F1N206 3.01e-55 195 30 8 473 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial Bos taurus
Q9KPF6 3.29e-55 194 29 10 466 3 lpd Dihydrolipoyl dehydrogenase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P09623 5.61e-55 194 30 8 473 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial Sus scrofa
Q8CIZ7 8.77e-55 193 30 8 473 2 DLD Dihydrolipoyl dehydrogenase, mitochondrial Cricetulus griseus
P57303 9.81e-55 192 30 11 463 3 lpdA Dihydrolipoyl dehydrogenase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q811C4 1.96e-54 192 29 8 469 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial (Fragment) Mesocricetus auratus
P21880 1.97e-54 192 30 9 462 3 pdhD Dihydrolipoyl dehydrogenase Bacillus subtilis (strain 168)
Q04933 2.51e-54 191 31 9 455 3 None Dihydrolipoyl dehydrogenase Trypanosoma brucei brucei
P09622 2.95e-54 192 30 8 473 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial Homo sapiens
O08749 4.37e-54 192 29 8 478 1 Dld Dihydrolipoyl dehydrogenase, mitochondrial Mus musculus
Q6P6R2 9.32e-54 191 29 8 473 1 Dld Dihydrolipoyl dehydrogenase, mitochondrial Rattus norvegicus
Q60HG3 1.37e-53 190 30 8 473 2 DLD Dihydrolipoyl dehydrogenase, mitochondrial Macaca fascicularis
Q9M5K3 1.44e-53 190 29 6 464 1 LPD1 Dihydrolipoyl dehydrogenase 1, mitochondrial Arabidopsis thaliana
O05940 3.48e-53 189 28 13 488 3 lpdA Dihydrolipoyl dehydrogenase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5R4B1 6.52e-53 188 30 8 473 2 DLD Dihydrolipoyl dehydrogenase, mitochondrial Pongo abelii
P0A0E7 1.74e-52 186 30 11 464 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain MW2)
P0A0E8 1.74e-52 186 30 11 464 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus
Q6GAB8 1.74e-52 186 30 11 464 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain MSSA476)
Q6GHY9 1.74e-52 186 30 11 464 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain MRSA252)
P99084 1.74e-52 186 30 11 464 1 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain N315)
P0A0E6 1.74e-52 186 30 11 464 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY8 1.74e-52 186 30 11 464 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain COL)
P23189 1.89e-52 186 29 7 451 3 gor Glutathione reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9SPB1 7.45e-52 186 29 6 440 1 FLBR Leghemoglobin reductase Vigna unguiculata
Q9M5K2 9.5e-52 185 29 7 447 1 LPD2 Dihydrolipoyl dehydrogenase 2, mitochondrial Arabidopsis thaliana
G0SB20 1.01e-51 185 29 9 469 1 CTHT_0048590 Dihydrolipoamide dehydrogenase Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
Q54EW8 1.62e-51 184 29 8 446 3 lpd Dihydrolipoyl dehydrogenase, mitochondrial Dictyostelium discoideum
P31023 2.55e-51 184 28 7 466 1 LPD Dihydrolipoyl dehydrogenase, mitochondrial Pisum sativum
P52992 6.82e-51 182 30 9 470 3 odhL Dihydrolipoyl dehydrogenase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P0A9P3 8.22e-51 182 28 10 459 3 lpdA Dihydrolipoyl dehydrogenase Shigella flexneri
P0A9P0 8.22e-51 182 28 10 459 1 lpdA Dihydrolipoyl dehydrogenase Escherichia coli (strain K12)
P0A9P1 8.22e-51 182 28 10 459 3 lpdA Dihydrolipoyl dehydrogenase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9P2 8.22e-51 182 28 10 459 3 lpdA Dihydrolipoyl dehydrogenase Escherichia coli O157:H7
O18480 9.42e-51 182 30 11 469 2 None Dihydrolipoyl dehydrogenase Manduca sexta
Q41219 3.21e-50 181 27 7 446 1 FLBR Leghemoglobin reductase Glycine max
O34324 9.49e-50 179 30 10 449 3 acoL Dihydrolipoyl dehydrogenase Bacillus subtilis (strain 168)
P50970 2.89e-49 177 29 7 466 3 lpd Dihydrolipoyl dehydrogenase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q8K9T7 3.95e-49 177 29 10 469 3 lpdA Dihydrolipoyl dehydrogenase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P09624 2.96e-48 176 29 8 474 1 LPD1 Dihydrolipoyl dehydrogenase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P48639 6.23e-47 171 29 8 456 3 gor Glutathione reductase Burkholderia cepacia
D9J041 2.84e-46 171 27 8 464 1 merA Mercuric reductase Lysinibacillus sphaericus
O00087 1.04e-45 169 28 8 463 2 dld1 Dihydrolipoyl dehydrogenase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5UWH2 1.48e-45 168 28 8 472 3 lpdA3 Dihydrolipoyl dehydrogenase 3 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P95596 3.35e-45 166 29 7 438 3 lpd Dihydrolipoyl dehydrogenase Rhodobacter capsulatus
P85207 6.46e-45 166 29 9 459 1 lpd Dihydrolipoyl dehydrogenase Thermus scotoductus (strain ATCC 700910 / SA-01)
Q89AQ8 2.1e-44 165 28 7 462 3 lpdA Dihydrolipoyl dehydrogenase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q04829 3.5e-44 164 28 9 465 1 lpdA Dihydrolipoyl dehydrogenase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q5UYG6 6.77e-44 163 30 9 456 3 lpdA2 Dihydrolipoyl dehydrogenase 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P30341 1.57e-43 162 28 9 442 2 merA Mercuric reductase Streptomyces lividans
P0A0E4 1.81e-43 164 27 10 463 3 merA Mercuric reductase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P0A0E5 1.81e-43 164 27 10 463 3 merA Mercuric reductase Staphylococcus aureus
P54533 1.99e-43 162 30 12 473 3 bfmBC Dihydrolipoyl dehydrogenase Bacillus subtilis (strain 168)
Q9HN74 4.62e-43 161 28 10 466 3 lpdA Dihydrolipoyl dehydrogenase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P48642 1.73e-42 160 28 10 464 2 GRC2 Glutathione reductase, cytosolic Oryza sativa subsp. japonica
P16171 2.17e-42 162 29 10 463 1 merA Mercuric reductase Bacillus cereus
D0VWY5 1.27e-41 157 30 13 458 1 garB Glutathione amide reductase Marichromatium gracile
Q43154 1.29e-41 157 27 8 464 2 None Glutathione reductase, chloroplastic (Fragment) Spinacia oleracea
Q43621 4.09e-41 156 27 8 463 2 None Glutathione reductase, cytosolic Pisum sativum
P48638 1.24e-39 151 27 11 473 3 gor Glutathione reductase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P80461 2.17e-39 152 29 13 462 1 GOR Glutathione reductase, chloroplastic (Fragment) Nicotiana tabacum
P72740 2.45e-39 151 29 14 474 1 lpdA Dihydrolipoyl dehydrogenase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P78965 2.39e-38 148 29 16 464 1 pgr1 Glutathione reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P27456 3.57e-38 149 27 12 466 2 GR Glutathione reductase, chloroplastic/mitochondrial Pisum sativum
Q50068 4.31e-38 147 27 9 461 3 lpd Dihydrolipoyl dehydrogenase Mycobacterium leprae (strain TN)
Q54465 7.48e-38 148 26 13 472 3 merA Mercuric reductase Shewanella putrefaciens
Q8NTE1 4.24e-37 145 27 8 462 1 lpd Dihydrolipoyl dehydrogenase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P48641 4.48e-37 145 26 11 466 1 At3g24170 Glutathione reductase, cytosolic Arabidopsis thaliana
P77212 5.06e-37 144 26 9 467 1 rclA Probable pyridine nucleotide-disulfide oxidoreductase RclA Escherichia coli (strain K12)
O04955 9.74e-37 144 26 10 465 2 GR1 Glutathione reductase, cytosolic Brassica rapa subsp. pekinensis
P42770 1.2e-36 145 27 13 465 2 EMB2360 Glutathione reductase, chloroplastic Arabidopsis thaliana
P48640 2.4e-36 144 27 9 428 2 GR Glutathione reductase, chloroplastic Glycine max
P00392 9.63e-36 142 26 11 456 1 merA Mercuric reductase Pseudomonas aeruginosa
P75393 1.43e-35 140 29 10 458 1 pdhD Dihydrolipoyl dehydrogenase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q52109 1.95e-35 141 26 11 460 3 merA Mercuric reductase Acinetobacter calcoaceticus
P94702 4.17e-35 140 26 13 466 3 merA Mercuric reductase Enterobacter agglomerans
F4JLP5 8.31e-35 140 29 13 420 2 LPD2 Dihydrolipoyl dehydrogenase 2, chloroplastic Arabidopsis thaliana
Q60151 1.15e-34 137 27 12 436 3 gor Glutathione reductase Streptococcus thermophilus
P08332 1.9e-34 139 26 11 458 3 merA Mercuric reductase Shigella flexneri
Q02733 2.32e-34 137 26 12 473 1 IRC15 Increased recombination centers protein 15 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9I1L9 2.32e-34 137 25 11 465 1 lpdV Dihydrolipoyl dehydrogenase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P41921 2.46e-34 137 26 14 463 1 GLR1 Glutathione reductase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P09063 2.77e-34 137 27 11 433 1 lpdV Dihydrolipoyl dehydrogenase Pseudomonas putida
P94188 6.42e-34 137 27 12 453 3 merA Mercuric reductase Alcaligenes sp.
Q74ZK4 2.1e-33 134 26 13 435 3 GLR1 Glutathione reductase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A8MS68 2.36e-33 136 29 13 420 2 LPD1 Dihydrolipoyl dehydrogenase 1, chloroplastic Arabidopsis thaliana
Q6HA23 8.56e-33 133 26 13 433 1 GLR1 Glutathione reductase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P13110 1.28e-32 132 27 13 470 1 TPR Trypanothione reductase Trypanosoma congolense
P43783 1.61e-32 132 27 13 436 3 gor Glutathione reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WHH7 6.74e-32 130 25 8 465 1 lpdA NAD(P)H dehydrogenase (quinone) Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH6 6.74e-32 130 25 8 465 3 lpdA NAD(P)H dehydrogenase (quinone) Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P06715 1.67e-31 129 27 13 435 1 gor Glutathione reductase Escherichia coli (strain K12)
Q51772 3.52e-31 129 25 11 453 3 merA Mercuric reductase Pseudomonas fluorescens
P9WHH9 7.3e-31 127 28 8 458 1 lpdC Dihydrolipoyl dehydrogenase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH8 7.3e-31 127 28 8 458 3 lpdC Dihydrolipoyl dehydrogenase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66005 7.3e-31 127 28 8 458 3 lpd Dihydrolipoyl dehydrogenase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P39051 1.04e-30 127 26 15 471 1 TPR Trypanothione reductase Trypanosoma brucei brucei
Q873E8 1.49e-30 126 26 15 470 3 gtr-1 Glutathione reductase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q25861 2.24e-30 127 26 17 487 1 TRXR Thioredoxin reductase Plasmodium falciparum (isolate FCH-5)
Q6FRV2 3.52e-30 125 25 14 433 3 GLR1 Glutathione reductase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P61076 3.89e-30 127 26 17 487 1 TRXR Thioredoxin reductase Plasmodium falciparum (isolate 3D7)
P9WHH3 8.76e-30 124 25 10 425 1 mtr Mycothione reductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH2 8.76e-30 124 25 10 425 3 mtr Mycothione reductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P47791 2.55e-29 123 27 10 462 1 Gsr Glutathione reductase, mitochondrial Mus musculus
P17239 3.28e-29 123 24 9 453 1 merA Mercuric reductase Acidithiobacillus ferrooxidans
Q6C5H4 6.21e-29 122 25 14 441 3 GLR1 Glutathione reductase Yarrowia lipolytica (strain CLIB 122 / E 150)
Q9N2I8 7.58e-29 122 28 16 483 1 TXNRD2 Thioredoxin reductase 2, mitochondrial Bos taurus
P47513 8.55e-29 121 28 11 463 3 pdhD Dihydrolipoyl dehydrogenase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8T137 2.19e-28 120 26 14 464 1 gsr Glutathione reductase Dictyostelium discoideum
A2TIL1 3.54e-28 120 26 9 461 2 GSR Glutathione reductase, mitochondrial Callithrix jacchus
Q6BPI1 1.89e-27 118 25 17 483 3 GLR1 Glutathione reductase Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q9JLT4 3.22e-27 117 28 14 441 1 Txnrd2 Thioredoxin reductase 2, mitochondrial Mus musculus
P28593 3.65e-27 117 26 17 483 1 TPR Trypanothione reductase Trypanosoma cruzi
P00390 7.8e-27 116 26 9 461 1 GSR Glutathione reductase, mitochondrial Homo sapiens
P30635 1.57e-26 115 25 15 477 3 trxr-2 Probable glutathione reductase 2 Caenorhabditis elegans
P91938 4.78e-26 114 27 17 478 1 Trxr1 Thioredoxin reductase 1, mitochondrial Drosophila melanogaster
Q9Z0J5 5.4e-25 111 26 14 446 1 Txnrd2 Thioredoxin reductase 2, mitochondrial Rattus norvegicus
P39050 9.49e-25 110 25 14 471 3 TPR Trypanothione reductase Leishmania donovani
Q99MD6 2.69e-24 109 27 17 442 1 Txnrd3 Thioredoxin reductase 3 Mus musculus
P39040 5.8e-24 107 24 15 476 1 TPR Trypanothione reductase Crithidia fasciculata
P70619 2.07e-23 105 28 9 334 2 Gsr Glutathione reductase (Fragment) Rattus norvegicus
Q9NNW7 2.63e-23 106 26 16 463 1 TXNRD2 Thioredoxin reductase 2, mitochondrial Homo sapiens
Q93379 3.42e-22 102 26 7 351 1 gsr-1 Glutathione reductase, mitochondrial Caenorhabditis elegans
B9A1H3 8.94e-22 101 24 17 486 1 SEP1 Thioredoxin reductase SEP1 Emiliania huxleyi
Q9VNT5 8e-21 98 24 18 489 2 Trxr2 Thioredoxin reductase 2, mitochondrial Drosophila melanogaster
P35484 1.73e-20 95 29 11 333 3 pdhD Dihydrolipoyl dehydrogenase (Fragment) Acholeplasma laidlawii
Q86VQ6 4.64e-18 90 25 18 445 1 TXNRD3 Thioredoxin reductase 3 Homo sapiens
O62768 3.03e-17 87 27 23 488 2 TXNRD1 Thioredoxin reductase 1, cytoplasmic Bos taurus
Q9MYY8 3.11e-17 87 25 20 443 2 TXNRD1 Thioredoxin reductase 1, cytoplasmic Sus scrofa
O89049 4.51e-17 87 25 19 413 1 Txnrd1 Thioredoxin reductase 1, cytoplasmic Rattus norvegicus
Q5NVA2 5.65e-17 86 25 20 481 2 TXNRD1 Thioredoxin reductase 1, cytoplasmic Pongo abelii
Q16881 2.85e-16 85 25 20 481 1 TXNRD1 Thioredoxin reductase 1, cytoplasmic Homo sapiens
Q9JMH6 6.03e-16 84 25 20 445 1 Txnrd1 Thioredoxin reductase 1, cytoplasmic Mus musculus
Q58065 1.46e-15 82 26 18 415 3 MJ0649 NADH oxidase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B5XVA0 1.16e-13 75 31 6 176 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Klebsiella pneumoniae (strain 342)
P42433 3.64e-13 75 26 11 304 2 nasB Assimilatory nitrate reductase electron transfer subunit Bacillus subtilis (strain 168)
Q17745 4.14e-13 75 26 15 400 1 trxr-1 Thioredoxin reductase 1 Caenorhabditis elegans
Q56839 1.49e-12 73 22 14 474 1 xecC 2-oxopropyl-CoM reductase, carboxylating Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A6TCX6 2.2e-12 72 30 6 176 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P08662 2.82e-12 72 24 7 249 3 merA Mercuric reductase (Fragments) Serratia marcescens
Q6D8S1 3.72e-12 71 30 5 175 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q94655 1.14e-11 70 23 8 316 1 GR Glutathione reductase Plasmodium falciparum (isolate K1 / Thailand)
O15770 1.36e-11 70 23 8 316 1 GR Glutathione reductase Plasmodium falciparum (isolate 3D7)
P37062 2.16e-11 69 32 6 177 1 npr NADH peroxidase Enterococcus faecalis (strain ATCC 700802 / V583)
Q96NN9 2.26e-10 66 31 5 169 1 AIFM3 Apoptosis-inducing factor 3 Homo sapiens
P42435 2.81e-10 66 26 12 285 2 nasD Nitrite reductase [NAD(P)H] Bacillus subtilis (strain 168)
Q5JGP4 3.31e-10 65 27 14 336 1 TK1299 NAD(P)H sulfur oxidoreductase (CoA-dependent) Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q3TY86 5.15e-10 65 27 12 258 1 Aifm3 Apoptosis-inducing factor 3 Mus musculus
Q49WB0 2.19e-09 63 27 3 151 3 cdr Coenzyme A disulfide reductase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P37337 5.35e-09 61 29 3 155 3 bphG Biphenyl dioxygenase system ferredoxin--NAD(+) reductase component Paraburkholderia xenovorans (strain LB400)
Q9UYU5 1.49e-08 60 25 16 377 3 PYRAB14120 NAD(P)H sulfur oxidoreductase (CoA-dependent) Pyrococcus abyssi (strain GE5 / Orsay)
P08201 1.5e-08 60 26 8 247 3 nirB Nitrite reductase (NADH) large subunit Escherichia coli (strain K12)
B5Z372 1.86e-08 59 24 9 242 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X850 1.86e-08 59 24 9 242 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O157:H7
A0KEJ2 1.99e-08 59 28 7 183 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A2RIB7 2.12e-08 60 23 23 497 1 noxE NADH oxidase Lactococcus lactis subsp. cremoris (strain MG1363)
Q8NXE8 3.44e-08 59 27 2 134 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain MW2)
Q6GAV6 3.44e-08 59 27 2 134 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain MSSA476)
O52582 3.53e-08 59 27 2 134 1 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q7A6H1 3.62e-08 59 27 2 134 1 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain N315)
Q99VC0 3.62e-08 59 27 2 134 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X0I7 3.62e-08 59 27 2 134 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5XC60 4.15e-08 58 24 16 366 1 M6_Spy0868 NADH oxidase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A5IRE8 4.25e-08 58 27 2 134 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain JH9)
A6U077 4.25e-08 58 27 2 134 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain JH1)
Q4L4Y7 4.3e-08 58 25 2 140 3 cdr Coenzyme A disulfide reductase Staphylococcus haemolyticus (strain JCSC1435)
Q31X75 5.23e-08 58 24 9 242 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella boydii serotype 4 (strain Sb227)
A8Z076 5.53e-08 58 27 2 134 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain USA300 / TCH1516)
A6QFI1 5.53e-08 58 27 2 134 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain Newman)
Q2FIA5 5.53e-08 58 27 2 134 1 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain USA300)
Q5HHB4 5.73e-08 58 27 2 134 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain COL)
B7M9E8 5.92e-08 58 24 9 242 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O8 (strain IAI1)
B7LEC2 5.92e-08 58 24 9 242 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain 55989 / EAEC)
Q51973 6.13e-08 58 34 6 142 1 cmtAa p-cumate 2,3-dioxygenase system, ferredoxin--NAD(+) reductase component Pseudomonas putida
A8A3I8 7.14e-08 58 24 9 242 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O9:H4 (strain HS)
Q8DP70 7.87e-08 58 24 16 369 1 nox NADH oxidase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
O84925 8.08e-08 58 24 16 369 1 nox NADH oxidase Streptococcus pneumoniae
B2U036 9e-08 57 24 9 242 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q8CPT6 1.03e-07 57 22 9 291 3 cdr Coenzyme A disulfide reductase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQI9 1.03e-07 57 22 9 291 3 cdr Coenzyme A disulfide reductase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8U1M0 1.15e-07 57 26 8 221 1 nsr NAD(P)H sulfur oxidoreductase (CoA-dependent) Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q6GIB7 1.15e-07 57 26 2 134 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain MRSA252)
B1LQ29 1.53e-07 57 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain SMS-3-5 / SECEC)
B7N6U1 1.71e-07 57 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A7ZQE0 1.83e-07 56 24 9 242 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O139:H28 (strain E24377A / ETEC)
A0A0H2UQZ4 1.93e-07 57 24 16 369 3 nox NADH oxidase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P59403 2.09e-07 56 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella flexneri
Q0T1D6 2.09e-07 56 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella flexneri serotype 5b (strain 8401)
A9MFX5 2.39e-07 56 26 7 182 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8FEN4 2.66e-07 56 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3YYF3 2.83e-07 56 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella sonnei (strain Ss046)
P37596 2.83e-07 56 24 9 242 1 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain K12)
B1IUW8 2.83e-07 56 24 9 242 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XCN8 2.83e-07 56 24 9 242 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain K12 / DH10B)
C4ZYV6 2.83e-07 56 24 9 242 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain K12 / MC4100 / BW2952)
Q1R7Y9 2.96e-07 56 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain UTI89 / UPEC)
A1AEQ1 2.96e-07 56 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O1:K1 / APEC
B7MKI0 2.96e-07 56 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7NSJ1 3.35e-07 55 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MYL1 3.76e-07 55 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O81 (strain ED1a)
A4STH3 3.79e-07 55 29 4 144 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aeromonas salmonicida (strain A449)
Q0TEG9 3.86e-07 55 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B4TT18 4.15e-07 55 28 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella schwarzengrund (strain CVM19633)
B6I697 4.18e-07 55 24 9 242 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain SE11)
P42454 4.88e-07 55 29 5 138 1 rubB Rubredoxin-NAD(+) reductase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8D4F7 4.98e-07 55 25 7 189 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Vibrio vulnificus (strain CMCP6)
Q2YWW1 5.32e-07 55 25 3 160 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8L3B0 7.05e-07 55 25 12 258 1 padH NADH-dependent phenylglyoxylate dehydrogenase subunit epsilon Aromatoleum evansii
B7UHC3 7.65e-07 54 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B4TF25 9.8e-07 54 28 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella heidelberg (strain SL476)
Q8ZMJ6 9.97e-07 54 28 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5QV90 9.97e-07 54 28 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella enteritidis PT4 (strain P125109)
B5F365 1.09e-06 54 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella agona (strain SL483)
A9N0E0 1.12e-06 54 28 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q7MFY7 1.16e-06 54 25 7 189 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Vibrio vulnificus (strain YJ016)
B7LW23 1.28e-06 53 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q8Z4C4 1.53e-06 53 27 4 174 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella typhi
A8ANR8 2.51e-06 53 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q32CL7 2.55e-06 53 24 9 242 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella dysenteriae serotype 1 (strain Sd197)
A1A653 3.19e-06 52 27 4 162 2 fer8 Fe-regulated protein 8 Ustilago maydis (strain 521 / FGSC 9021)
B5BEP9 3.38e-06 52 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella paratyphi A (strain AKU_12601)
Q5PF36 3.38e-06 52 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
W8X9R5 3.41e-06 52 28 9 223 1 ctmF Probable ferredoxin reductase CtmF Castellaniella defragrans (strain DSM 12143 / CCUG 39792 / 65Phen)
B4T3B2 3.45e-06 52 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella newport (strain SL254)
B5FSZ2 3.6e-06 52 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella dublin (strain CT_02021853)
B5RDG6 5.08e-06 52 27 6 177 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella gallinarum (strain 287/91 / NCTC 13346)
A8GG95 6.15e-06 52 30 4 146 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Serratia proteamaculans (strain 568)
P92947 7.13e-06 52 23 5 184 1 MDAR5 Monodehydroascorbate reductase, chloroplastic/mitochondrial Arabidopsis thaliana
Q07946 7.36e-06 52 28 9 221 1 bedA Benzene 1,2-dioxygenase system ferredoxin--NAD(+) reductase subunit Pseudomonas putida
C0PWN3 7.5e-06 51 27 5 176 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella paratyphi C (strain RKS4594)
Q57KT2 7.5e-06 51 27 5 176 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella choleraesuis (strain SC-B67)
Q0S032 2.18e-05 50 25 6 189 1 bphA4 Biphenyl 2,3-dioxygenase, ferredoxin reductase component Rhodococcus jostii (strain RHA1)
P80647 2.97e-05 44 39 0 53 1 None Dihydrolipoyl dehydrogenase (Fragment) Hymenolepis diminuta
P43494 3.35e-05 49 25 6 212 1 thcD Rhodocoxin reductase Rhodococcus erythropolis
A4WDR7 3.52e-05 49 28 4 142 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Enterobacter sp. (strain 638)
Q67QU3 4.42e-05 49 26 9 210 3 STH965 Ferredoxin--NADP reductase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
O58308 5.79e-05 48 26 14 336 1 PH0572 NAD(P)H coenzyme A polysulfide/persulfide reductase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P37061 0.000107 48 27 6 158 1 nox NADH oxidase Enterococcus faecalis (strain ATCC 700802 / V583)
P08655 0.000161 45 26 6 180 4 None Uncharacterized 19.7 kDa protein in mercuric resistance operon Staphylococcus aureus
Q06458 0.000383 47 25 6 208 3 nasB Nitrite reductase [NAD(P)H] large subunit Klebsiella oxytoca
Q2W0C9 0.000743 45 23 16 374 3 amb3892 Ferredoxin--NADP reductase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
O24679 0.000888 45 27 9 221 1 tecA4 Chlorobenzene dioxygenase, ferredoxin reductase component Cupriavidus sp. (strain PS12)
Q8S3R2 0.001 45 23 7 228 2 MDAR2 Monodehydroascorbate reductase 2, peroxisomal Oryza sativa subsp. japonica
Q8VHE9 0.001 45 48 0 45 2 Retsat All-trans-retinol 13,14-reductase Rattus norvegicus
Q64FW2 0.001 45 48 0 45 1 Retsat All-trans-retinol 13,14-reductase Mus musculus

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16940
Feature type CDS
Gene sthA
Product Si-specific NAD(P)(+) transhydrogenase
Location 9302 - 10702 (strand: 1)
Length 1401 (nucleotides) / 466 (amino acids)

Contig

Accession term accessions NZ_VXKB01000007 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 196482 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1742
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02852 Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain
PF07992 Pyridine nucleotide-disulphide oxidoreductase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1249 Energy production and conversion (C) C Dihydrolipoamide dehydrogenase (E3) component of pyruvate/2-oxoglutarate dehydrogenase complex or glutathione oxidoreductase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00322 NAD(P) transhydrogenase [EC:1.6.1.1] Nicotinate and nicotinamide metabolism
Metabolic pathways		 -

Protein Sequence

MQQNQFDAIVIGSGPGGEGVAMGLVKQGKRVAVVERYNNVGGGCTHWGTIPSKALRHAVSRIIEFNQNPLYSDNSRILKSSFSDILAHAGRVITQQTGMRRGFYERNGCTMFYGEAAFTDTGDIRVRYADGSCDILSATHTIIATGSRPYCPPDVDFNHPRIYNSDTILSLTHEPRHVIIYGAGVIGCEYASVFRGLSVKVDLINTRDRLLAFLDQEMSDALTYHFWNNGVVIRQNEEYERIEGTDDGVIVHFRSGKKVKADCLLYANGRTGNTDGLGLEHIGISADSRGLISVNDTYQTSNPAVYAVGDVIGYPSLASAAYDQGRIAARAITHDGDAPLHLIEDIPTGIYTIPEISSVGKTEQQLTAMKIPYEVGRAQFKHLARAQIAGLDVGSLKILFHRDTRQILGIHCFGERAAEIIHIGQAIMEQKGEGNTLDYFVNTTFNYPTMAEAYRVAALNGLNRLF

Flanking regions ( +/- flanking 50bp)

TGATGTTAAGATGATGTTATTAACTTATGTATAAACAGGTTATTTCTTATATGCAACAGAACCAGTTTGACGCAATTGTCATCGGCTCCGGTCCGGGCGGCGAAGGTGTGGCTATGGGGCTTGTAAAACAGGGAAAACGCGTTGCCGTTGTTGAGCGTTACAACAATGTCGGCGGCGGTTGTACCCATTGGGGCACCATTCCGTCCAAAGCGCTGCGCCACGCAGTCAGCCGTATTATCGAATTTAACCAGAATCCGCTGTACAGTGATAACTCCCGGATTCTGAAATCCTCTTTCTCTGACATTCTGGCACACGCCGGACGCGTGATAACCCAGCAAACCGGAATGCGCCGGGGCTTTTATGAGCGCAACGGCTGCACCATGTTCTACGGCGAAGCTGCATTTACAGACACCGGTGATATCCGTGTCCGTTACGCAGACGGCAGCTGTGATATTCTCAGCGCAACTCACACTATTATCGCCACCGGCTCCAGACCTTACTGCCCGCCGGATGTGGATTTTAATCATCCCCGTATCTATAACAGTGACACTATTCTCTCTCTGACACATGAGCCGCGCCATGTCATTATTTATGGCGCCGGTGTGATTGGCTGCGAATATGCCTCTGTTTTTCGCGGGTTAAGTGTAAAAGTGGATTTAATCAACACCCGCGACCGGTTGCTGGCGTTTCTTGACCAGGAGATGTCAGACGCACTGACTTATCATTTCTGGAACAATGGCGTGGTTATCCGCCAGAACGAGGAATATGAGCGGATTGAAGGCACGGATGACGGTGTGATTGTTCACTTCCGCTCCGGCAAAAAAGTAAAAGCAGACTGCCTGCTCTATGCTAACGGACGAACCGGGAATACGGATGGTCTGGGGCTGGAGCATATCGGGATCAGTGCCGACAGTCGCGGGCTTATCAGTGTTAATGATACCTATCAGACCAGTAATCCGGCGGTTTATGCAGTCGGGGATGTGATCGGCTATCCGAGCCTTGCCTCTGCGGCATATGATCAGGGGCGGATTGCTGCCCGCGCTATCACCCATGATGGTGATGCACCGCTGCATCTGATTGAAGATATCCCGACAGGCATTTATACCATCCCGGAAATCAGTTCCGTCGGTAAAACCGAGCAGCAACTGACTGCAATGAAAATTCCGTATGAAGTGGGACGGGCGCAGTTCAAACATCTGGCGCGGGCACAAATTGCCGGTCTGGATGTCGGCAGCCTGAAAATATTGTTCCACCGCGATACCCGCCAGATCCTCGGCATTCACTGCTTCGGCGAGCGGGCGGCAGAAATTATTCATATTGGTCAGGCAATTATGGAACAGAAAGGGGAAGGTAATACTCTCGATTATTTCGTGAATACCACCTTTAATTACCCGACCATGGCGGAAGCTTACCGTGTTGCCGCCCTTAACGGACTGAACCGGTTATTTTAAACCGGCGGTTCCTGCTGATAATACGCGCACATTTTTGCACGGATCGCTTC