Homologs in group_2955

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15915 FBDBKF_15915 93.6 Morganella morganii S1 cysK Cysteine synthase
EHELCC_18515 EHELCC_18515 93.6 Morganella morganii S2 cysK Cysteine synthase
NLDBIP_17350 NLDBIP_17350 93.6 Morganella morganii S4 cysK Cysteine synthase
LHKJJB_17310 LHKJJB_17310 93.6 Morganella morganii S3 cysK Cysteine synthase
HKOGLL_17085 HKOGLL_17085 93.6 Morganella morganii S5 cysK Cysteine synthase

Distribution of the homologs in the orthogroup group_2955

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2955

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O69652 6.78e-152 434 63 1 334 1 cds1 L-cysteine desulfhydrase Cds1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5U908 6.78e-152 434 63 1 334 1 cds1 L-cysteine desulfhydrase Cds1 Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q19374 3.49e-42 155 31 10 355 1 F13B12.4 Putative pyridoxal-phosphate dependent protein F13B12.4 Caenorhabditis elegans
P71128 1.61e-25 107 29 9 298 3 cysM Cysteine synthase B Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P55708 3.34e-25 107 27 10 325 3 NGR_a00730 Putative cysteine synthase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q54CN7 4.76e-25 107 25 10 337 3 cysK Cysteine synthase Dictyostelium discoideum
O59701 2.76e-22 99 26 7 300 1 cys11 Cysteine synthase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P50867 4.87e-20 93 25 7 304 3 cysB Cysteine synthase 1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O67507 4.8e-18 87 28 13 313 3 cysM Cysteine synthase Aquifex aeolicus (strain VF5)
P16703 5.11e-18 86 26 8 297 1 cysM Cysteine synthase B Escherichia coli (strain K12)
P29848 5.69e-18 86 27 9 298 1 cysM Cysteine synthase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7A1Z6 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain MW2)
A8YZ41 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD09 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain MSSA476)
Q6GKI9 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain MRSA252)
Q932K9 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QDA0 1.63e-17 85 24 7 307 1 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain Newman)
D0K799 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain ED98)
Q5HJQ3 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain COL)
A5INY7 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain JH9)
Q2G1N3 1.63e-17 85 24 7 307 1 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
D2N3G7 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain MRSA ST398 / isolate S0385)
D3ERF5 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain 04-02981)
Q2FKE3 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain USA300)
A6TXQ1 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain JH1)
A7WX68 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain Mu3 / ATCC 700698)
D1GUM7 1.63e-17 85 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain TW20 / 0582)
Q99X99 1.78e-17 85 25 9 308 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain N315)
Q2YUU0 4.63e-17 84 24 7 307 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain bovine RF122 / ET3-1)
P87131 6.14e-17 84 25 10 323 3 cys12 Cysteine synthase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9I526 1.27e-16 82 27 12 337 3 cysM Cysteine synthase B Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P63872 1.37e-16 82 23 9 293 3 cysK Cysteine synthase Staphylococcus aureus (strain MW2)
Q6GBX5 1.37e-16 82 23 9 293 3 cysK Cysteine synthase Staphylococcus aureus (strain MSSA476)
Q6GJF8 1.37e-16 82 23 9 293 3 cysK Cysteine synthase Staphylococcus aureus (strain MRSA252)
P63871 1.37e-16 82 23 9 293 1 cysK Cysteine synthase Staphylococcus aureus (strain N315)
P63870 1.37e-16 82 23 9 293 3 cysK Cysteine synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HIG2 1.37e-16 82 23 9 293 3 cysK Cysteine synthase Staphylococcus aureus (strain COL)
Q5BD67 1.87e-16 83 26 12 341 3 cysF Cysteine synthase 2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5XAQ3 2.01e-16 82 25 10 309 1 cysK Cysteine synthase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P32232 2.35e-16 83 26 9 321 1 Cbs Cystathionine beta-synthase Rattus norvegicus
Q7RYW6 3.55e-16 82 26 11 316 3 cys-17 Cysteine synthase 1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q91WT9 4.39e-16 82 26 9 321 1 Cbs Cystathionine beta-synthase Mus musculus
Q8CMT6 1.21e-15 79 22 9 310 3 cysK Cysteine synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRP1 1.21e-15 79 22 9 310 3 cysK Cysteine synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O34476 1.87e-15 79 23 8 297 3 ytkP Probable cysteine synthase Bacillus subtilis (strain 168)
O45679 5.05e-15 78 26 12 307 1 cysl-2 Bifunctional L-3-cyanoalanine synthase/cysteine synthase Caenorhabditis elegans
Q44004 7.92e-15 77 26 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8XSQ0 9.79e-15 77 27 10 305 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P46794 2.16e-14 77 28 8 296 2 cysB Cystathionine beta-synthase Dictyostelium discoideum
P35520 2.53e-14 77 25 8 304 1 CBS Cystathionine beta-synthase Homo sapiens
Q58H57 4.3e-14 76 25 8 304 2 CBS Cystathionine beta-synthase Macaca fascicularis
P56067 8.57e-14 74 26 7 287 1 cysM Cysteine synthase Helicobacter pylori (strain ATCC 700392 / 26695)
O01592 8.68e-14 74 26 14 297 1 cysl-3 Cysteine synthase 3 Caenorhabditis elegans
O05393 1.19e-12 71 25 8 293 1 mccA O-acetylserine dependent cystathionine beta-synthase Bacillus subtilis (strain 168)
P32582 1.26e-12 72 23 11 331 1 CYS4 Cystathionine beta-synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9N0V7 2.36e-12 71 26 9 305 2 CBS Cystathionine beta-synthase Oryctolagus cuniculus
Q7DDL5 3.69e-12 69 27 9 293 1 cysK Cysteine synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
D2Z027 4.14e-12 69 26 10 297 1 dcsD O-ureido-L-serine synthase Streptomyces lavendulae
Q93244 4.77e-12 69 28 12 303 1 cysl-1 Cysteine synthase 1 Caenorhabditis elegans
P9WP53 1.6e-11 67 40 0 90 1 cysM O-phosphoserine sulfhydrylase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WP52 1.6e-11 67 40 0 90 3 cysM O-phosphoserine sulfhydrylase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63874 1.6e-11 67 40 0 90 3 cysM O-phosphoserine sulfhydrylase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P53206 1.86e-11 68 24 8 316 1 MCY1 Putative mitochondrial cysteine synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P9WP51 2.16e-11 68 25 6 298 1 cbs Probable cystathionine beta-synthase Rv1077 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WP50 2.16e-11 68 25 6 298 3 cbs Putative cystathionine beta-synthase MT1108 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7SHQ1 3.51e-11 67 25 11 317 3 cys-12 Cysteine synthase 2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q59447 7.62e-11 65 25 3 184 3 cysK Cysteine synthase Flavobacterium sp. (strain K3-15 / DSM ID92-509)
Q59966 1.14e-10 65 27 12 346 2 srpG Cysteine synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P48028 8.91e-10 60 30 1 120 3 cysM Cysteine synthase B (Fragment) Pseudomonas syringae pv. syringae
Q2V0C9 9.99e-10 63 26 9 305 1 CBS Cystathionine beta-synthase Apis mellifera
O81154 1.14e-09 62 27 12 299 2 None Cysteine synthase Solanum tuberosum
O81155 1.72e-09 62 27 12 292 2 None Cysteine synthase, chloroplastic/chromoplastic Solanum tuberosum
O32978 2.32e-09 61 24 6 287 3 cysK O-acetylserine sulfhydrylase Mycobacterium leprae (strain TN)
F4K5T2 2.43e-09 61 26 9 301 1 DES1 Bifunctional cystathionine gamma-lyase/cysteine synthase Arabidopsis thaliana
Q9ZMW6 2.93e-09 60 25 7 287 3 cysM Cysteine synthase Helicobacter pylori (strain J99 / ATCC 700824)
Q43153 5.94e-09 60 27 12 303 1 CYSC Bifunctional L-3-cyanoalanine synthase/cysteine synthase, mitochondrial Spinacia oleracea
Q9SXS7 1.08e-08 59 26 10 302 1 CYSD2 Bifunctional L-3-cyanoalanine synthase/cysteine synthase D2 Arabidopsis thaliana
P9WP55 1.34e-08 58 23 6 288 1 cysK1 O-acetylserine sulfhydrylase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WP54 1.34e-08 58 23 6 288 3 cysK1 O-acetylserine sulfhydrylase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A535 1.34e-08 58 23 6 288 3 cysK O-acetylserine sulfhydrylase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q76MX2 4.74e-08 57 25 9 307 1 PCAS-1 Bifunctional L-3-cyanoalanine synthase/cysteine synthase 1, mitochondrial Solanum tuberosum
Q00834 5.77e-08 57 25 11 303 1 None Cysteine synthase Spinacia oleracea
Q9FS29 1.07e-07 56 24 9 290 1 PCAS-2 Bifunctional L-3-cyanoalanine synthase/cysteine synthase 2, mitochondrial Solanum tuberosum
P73410 1.15e-07 56 26 10 299 3 cysK Cysteine synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P80608 1.46e-07 55 27 11 292 1 None Cysteine synthase Zea mays
P38076 1.57e-07 55 26 11 299 2 CYS1 Cysteine synthase Triticum aestivum
P40817 1.71e-07 56 23 14 293 1 dpaL Diaminopropionate ammonia-lyase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9S6Z7 2.24e-07 55 26 9 288 1 CYSD1 Bifunctional L-3-cyanoalanine synthase/cysteine synthase D1 Arabidopsis thaliana
Q9GZT4 3.34e-07 55 27 6 210 1 SRR Serine racemase Homo sapiens
P0A1E3 4.82e-07 54 24 8 293 1 cysK Cysteine synthase A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1E4 4.82e-07 54 24 8 293 3 cysK Cysteine synthase A Salmonella typhi
O23733 6.72e-07 53 27 10 301 2 None Cysteine synthase Brassica juncea
P47998 6.78e-07 53 27 11 302 1 OASA1 Cysteine synthase 1 Arabidopsis thaliana
O23735 7.41e-07 53 25 10 301 2 None Cysteine synthase Brassica juncea
P31300 8.93e-07 53 26 11 292 2 None Cysteine synthase, chloroplastic/chromoplastic Capsicum annuum
Q43317 1.4e-06 53 26 10 301 1 None Cysteine synthase Citrullus lanatus
P47999 1.61e-06 53 25 11 298 1 OASB Cysteine synthase, chloroplastic/chromoplastic Arabidopsis thaliana
A0JNI4 1.61e-06 52 26 7 209 2 SRR Serine racemase Bos taurus
P0ABK5 1.62e-06 52 23 8 296 1 cysK Cysteine synthase A Escherichia coli (strain K12)
P0ABK6 1.62e-06 52 23 8 296 3 cysK Cysteine synthase A Escherichia coli O157:H7
Q43725 2.07e-06 52 26 12 295 1 OASC Cysteine synthase, mitochondrial Arabidopsis thaliana
Q1KLZ1 2.51e-06 52 25 11 296 1 CAS2 L-3-cyanoalanine synthase 2, mitochondrial Malus domestica
Q9XEA6 2.72e-06 52 25 12 306 2 RCS1 Cysteine synthase Oryza sativa subsp. japonica
P37887 2.82e-06 52 25 9 300 1 cysK Cysteine synthase Bacillus subtilis (strain 168)
P32260 2.92e-06 52 24 12 292 1 CYSK Cysteine synthase, chloroplastic/chromoplastic Spinacia oleracea
Q8CNK9 3.94e-06 52 26 6 182 3 ilvA L-threonine dehydratase biosynthetic IlvA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMF5 3.94e-06 52 26 6 182 3 ilvA L-threonine dehydratase biosynthetic IlvA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1KLZ2 4.38e-06 51 24 9 295 1 CAS1 L-3-cyanoalanine synthase 1, mitochondrial Malus domestica
Q9S757 6.85e-06 51 26 9 288 1 CYSC1 Bifunctional L-3-cyanoalanine synthase/cysteine synthase C1, mitochondrial Arabidopsis thaliana
P57171 1.23e-05 50 24 9 309 3 cysK Cysteine synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9N4K2 2.41e-05 49 24 9 309 2 cbs-2 Putative cystathionine beta-synthase cbs-2 Caenorhabditis elegans
Q8VBT2 7.88e-05 47 25 5 149 1 Sds L-serine dehydratase/L-threonine deaminase Mus musculus
P25306 0.000242 46 26 8 206 1 TD2 Threonine dehydratase 2 biosynthetic, chloroplastic Solanum lycopersicum
Q9XEA8 0.000247 46 25 10 291 2 RCS3 Cysteine synthase Oryza sativa subsp. japonica
A1B8Z2 0.000721 44 25 6 187 1 bhcB beta-hydroxyaspartate dehydratase Paracoccus denitrificans (strain Pd 1222)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16395
Feature type CDS
Gene -
Product PLP-dependent cysteine synthase family protein
Location 96007 - 97047 (strand: 1)
Length 1041 (nucleotides) / 346 (amino acids)

Contig

Accession term accessions NZ_VXKB01000006 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 212134 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2955
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00291 Pyridoxal-phosphate dependent enzyme

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0031 Amino acid transport and metabolism (E) E Cysteine synthase

Protein Sequence

MTTQWTTFAINAIQADYQRSADTHLIPVELPVFPGVSLYLKDESTHPTGSLKHRLARSLFLYGLCNGWIREGTTVIEASSGSTAVSEAYFARLLGLPFIAVMPRCTARRKVEQIEFYGGQCHFVDNSAQIYAESERLARETGGHYMDQFTYAERATDWRGNNNIAESIFRQMSREAHPVPQYLVMSAGTGGTSATLGRFIRYQGHNTKLIVVDPENSVFHDCYHQKCSHLRCETGSKIEGIGRPRAEPSFIPGVIDDVMKVSDKCSIATLYWLEKLLGRRVGASTGTNVWGALQLAAQMHAEQQSGSIVTLICDSGERYPDTYYNPQWVADNIGDLTDALATLPKW

Flanking regions ( +/- flanking 50bp)

TCTCTCACAGAATTGCTAAGATTAAGCAACTGACAGTGAGGAGATAATGTATGACAACCCAATGGACGACATTCGCCATTAATGCTATTCAGGCCGATTATCAACGCAGCGCGGATACCCACCTGATCCCGGTGGAATTACCCGTCTTCCCGGGGGTTTCATTATACCTCAAGGATGAAAGTACGCACCCGACCGGTAGTCTGAAACACCGCCTGGCACGGTCACTTTTTTTATACGGGCTGTGTAACGGCTGGATACGTGAAGGTACAACGGTTATCGAAGCCTCATCCGGCAGCACTGCCGTATCTGAAGCCTATTTTGCCCGCCTGCTCGGTCTGCCGTTTATCGCCGTGATGCCGCGCTGCACTGCCCGGCGCAAAGTGGAACAAATTGAGTTCTACGGCGGACAATGTCATTTTGTCGATAACAGCGCACAAATTTATGCCGAATCCGAGCGCCTTGCCCGTGAAACCGGCGGTCATTATATGGATCAGTTTACCTACGCCGAGCGGGCAACTGACTGGCGCGGCAACAACAATATTGCTGAAAGCATTTTCCGTCAGATGTCACGGGAAGCACACCCTGTGCCACAGTATCTGGTGATGAGTGCAGGTACCGGCGGTACTTCTGCCACACTGGGACGTTTTATCCGCTATCAGGGACACAATACAAAATTAATTGTCGTTGACCCTGAAAACTCTGTATTCCATGACTGTTATCACCAGAAATGCTCACATTTACGCTGTGAAACCGGCAGTAAAATAGAGGGGATCGGTCGTCCGCGTGCAGAGCCTTCATTTATTCCCGGCGTTATTGATGATGTGATGAAAGTCAGCGACAAATGCAGTATCGCCACACTTTACTGGCTGGAAAAACTGCTCGGACGCAGAGTCGGCGCATCAACCGGCACCAATGTCTGGGGTGCGCTGCAACTGGCGGCACAAATGCATGCAGAGCAGCAGAGCGGCTCTATCGTTACCCTGATTTGTGACAGCGGCGAGCGCTATCCGGACACCTATTACAATCCGCAGTGGGTGGCAGACAATATCGGCGATCTGACCGACGCACTTGCAACACTACCCAAATGGTGATGCAGCCGTTACCATATACCCAATCTTTTTTATTGTGAGGGTTACAGATG