Homologs in group_182

Help

8 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06485 FBDBKF_06485 95.3 Morganella morganii S1 dnaJ molecular chaperone DnaJ
EHELCC_09530 EHELCC_09530 95.3 Morganella morganii S2 dnaJ molecular chaperone DnaJ
NLDBIP_09910 NLDBIP_09910 95.3 Morganella morganii S4 dnaJ molecular chaperone DnaJ
LHKJJB_07845 LHKJJB_07845 95.3 Morganella morganii S3 dnaJ molecular chaperone DnaJ
HKOGLL_07395 HKOGLL_07395 95.3 Morganella morganii S5 dnaJ molecular chaperone DnaJ
PMI_RS00050 PMI_RS00050 81.2 Proteus mirabilis HI4320 dnaJ molecular chaperone DnaJ
PMI_RS03925 PMI_RS03925 39.3 Proteus mirabilis HI4320 cbpA curved DNA-binding protein
PMI_RS18735 PMI_RS18735 33.1 Proteus mirabilis HI4320 - J domain-containing protein

Distribution of the homologs in the orthogroup group_182

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_182

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8Y3 0.0 619 82 1 379 3 dnaJ Chaperone protein DnaJ Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1JL03 0.0 617 81 0 379 3 dnaJ Chaperone protein DnaJ Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66ES9 0.0 617 81 0 379 3 dnaJ Chaperone protein DnaJ Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TQF8 0.0 617 81 0 379 3 dnaJ Chaperone protein DnaJ Yersinia pestis (strain Pestoides F)
Q1CMV6 0.0 617 81 0 379 3 dnaJ Chaperone protein DnaJ Yersinia pestis bv. Antiqua (strain Nepal516)
A9R014 0.0 617 81 0 379 3 dnaJ Chaperone protein DnaJ Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIM6 0.0 617 81 0 379 3 dnaJ Chaperone protein DnaJ Yersinia pestis
B2K3M1 0.0 617 81 0 379 3 dnaJ Chaperone protein DnaJ Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C0J8 0.0 617 81 0 379 3 dnaJ Chaperone protein DnaJ Yersinia pestis bv. Antiqua (strain Antiqua)
A7FME2 0.0 617 81 0 379 3 dnaJ Chaperone protein DnaJ Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B5YYA8 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q3Z600 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Shigella sonnei (strain Ss046)
A6T4F5 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7LVP7 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1RGI7 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli (strain UTI89 / UPEC)
B1LFU5 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli (strain SMS-3-5 / SECEC)
B6HZ11 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli (strain SE11)
B7N7N9 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IRF9 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FLC5 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A7ZVV8 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli O9:H4 (strain HS)
B7M0B1 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli O8 (strain IAI1)
B7MNM2 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli O81 (strain ED1a)
B7NHB7 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q8XA65 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli O157:H7
B7L4D9 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli (strain 55989 / EAEC)
B7MAD6 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UI60 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZHA5 0.0 615 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli O139:H28 (strain E24377A / ETEC)
B4F2V6 0.0 614 80 1 379 3 dnaJ Chaperone protein DnaJ Proteus mirabilis (strain HI4320)
B5Y241 0.0 614 81 1 379 3 dnaJ Chaperone protein DnaJ Klebsiella pneumoniae (strain 342)
Q0T8H5 0.0 613 81 1 379 3 dnaJ Chaperone protein DnaJ Shigella flexneri serotype 5b (strain 8401)
P0A1G7 0.0 613 80 0 379 3 dnaJ Chaperone protein DnaJ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1G8 0.0 613 80 0 379 3 dnaJ Chaperone protein DnaJ Salmonella typhi
B4TVZ6 0.0 613 80 0 379 3 dnaJ Chaperone protein DnaJ Salmonella schwarzengrund (strain CVM19633)
C0Q4F4 0.0 613 80 0 379 3 dnaJ Chaperone protein DnaJ Salmonella paratyphi C (strain RKS4594)
A9MXI3 0.0 613 80 0 379 3 dnaJ Chaperone protein DnaJ Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T6D7 0.0 613 80 0 379 3 dnaJ Chaperone protein DnaJ Salmonella newport (strain SL254)
B4TIB5 0.0 613 80 0 379 3 dnaJ Chaperone protein DnaJ Salmonella heidelberg (strain SL476)
B5RF09 0.0 613 80 0 379 3 dnaJ Chaperone protein DnaJ Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R5I3 0.0 613 80 0 379 3 dnaJ Chaperone protein DnaJ Salmonella enteritidis PT4 (strain P125109)
B5FHA7 0.0 613 80 0 379 3 dnaJ Chaperone protein DnaJ Salmonella dublin (strain CT_02021853)
Q57TP2 0.0 613 80 0 379 3 dnaJ Chaperone protein DnaJ Salmonella choleraesuis (strain SC-B67)
B5F6Y9 0.0 613 80 0 379 3 dnaJ Chaperone protein DnaJ Salmonella agona (strain SL483)
Q32KA4 0.0 613 81 1 379 3 dnaJ Chaperone protein DnaJ Shigella dysenteriae serotype 1 (strain Sd197)
Q326K6 0.0 613 81 1 379 3 dnaJ Chaperone protein DnaJ Shigella boydii serotype 4 (strain Sb227)
B2U233 0.0 613 81 1 379 3 dnaJ Chaperone protein DnaJ Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P08622 0.0 612 81 1 379 1 dnaJ Chaperone protein DnaJ Escherichia coli (strain K12)
B1XBE0 0.0 612 81 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli (strain K12 / DH10B)
C4ZPU1 0.0 611 80 1 379 3 dnaJ Chaperone protein DnaJ Escherichia coli (strain K12 / MC4100 / BW2952)
A9MR76 0.0 610 80 1 379 3 dnaJ Chaperone protein DnaJ Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5BLH9 0.0 610 79 1 379 3 dnaJ Chaperone protein DnaJ Salmonella paratyphi A (strain AKU_12601)
Q5PDJ4 0.0 610 79 1 379 3 dnaJ Chaperone protein DnaJ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B2VGS0 0.0 610 80 1 380 3 dnaJ Chaperone protein DnaJ Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q7UDU1 0.0 606 80 1 379 3 dnaJ Chaperone protein DnaJ Shigella flexneri
C6DF09 0.0 603 79 1 379 3 dnaJ Chaperone protein DnaJ Pectobacterium carotovorum subsp. carotovorum (strain PC1)
C5B7L8 0.0 602 79 2 379 3 dnaJ Chaperone protein DnaJ Edwardsiella ictaluri (strain 93-146)
A4W6D6 0.0 602 79 1 382 3 dnaJ Chaperone protein DnaJ Enterobacter sp. (strain 638)
Q6D0B8 0.0 595 79 2 380 3 dnaJ Chaperone protein DnaJ Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JJD6 0.0 593 79 2 379 3 dnaJ Chaperone protein DnaJ Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8G9K9 0.0 593 79 3 379 3 dnaJ Chaperone protein DnaJ Serratia proteamaculans (strain 568)
Q2NVZ0 0.0 589 78 2 379 3 dnaJ Chaperone protein DnaJ Sodalis glossinidius (strain morsitans)
A7MIK3 0.0 577 78 2 380 3 dnaJ Chaperone protein DnaJ Cronobacter sakazakii (strain ATCC BAA-894)
Q493S6 0.0 563 70 2 379 3 dnaJ Chaperone protein DnaJ Blochmanniella pennsylvanica (strain BPEN)
B8D757 0.0 546 67 2 379 3 dnaJ Chaperone protein DnaJ Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
O32465 0.0 546 67 2 379 3 dnaJ Chaperone protein DnaJ Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8V3 0.0 546 67 2 379 3 dnaJ Chaperone protein DnaJ Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A8FYT9 0.0 541 71 2 381 3 dnaJ Chaperone protein DnaJ Shewanella sediminis (strain HAW-EB3)
C4L8Y4 0.0 540 69 1 378 3 dnaJ Chaperone protein DnaJ Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B1KRT1 0.0 534 70 2 381 3 dnaJ Chaperone protein DnaJ Shewanella woodyi (strain ATCC 51908 / MS32)
A8H759 0.0 533 71 3 380 3 dnaJ Chaperone protein DnaJ Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q8K9Y9 0.0 531 65 1 379 3 dnaJ Chaperone protein DnaJ Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q7MN84 0.0 528 72 2 381 3 dnaJ Chaperone protein DnaJ Vibrio vulnificus (strain YJ016)
Q8DF67 0.0 528 72 2 381 3 dnaJ Chaperone protein DnaJ Vibrio vulnificus (strain CMCP6)
B8CKF4 0.0 528 70 3 381 3 dnaJ Chaperone protein DnaJ Shewanella piezotolerans (strain WP3 / JCM 13877)
Q87RX2 0.0 526 72 2 381 3 dnaJ Chaperone protein DnaJ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C3LTA6 0.0 526 71 1 380 3 dnaJ Chaperone protein DnaJ Vibrio cholerae serotype O1 (strain M66-2)
O34242 0.0 526 71 1 380 3 dnaJ Chaperone protein DnaJ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F362 0.0 526 71 1 380 3 dnaJ Chaperone protein DnaJ Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q6LUA6 0.0 522 69 3 382 3 dnaJ Chaperone protein DnaJ Photobacterium profundum (strain SS9)
Q15UD2 0.0 521 68 2 379 3 dnaJ Chaperone protein DnaJ Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A3QGW1 0.0 520 70 2 378 3 dnaJ Chaperone protein DnaJ Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q5E3A8 0.0 518 69 2 381 3 dnaJ Chaperone protein DnaJ Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8D2Q6 0.0 518 63 2 379 3 dnaJ Chaperone protein DnaJ Wigglesworthia glossinidia brevipalpis
A7MWW1 0.0 518 71 2 381 3 dnaJ Chaperone protein DnaJ Vibrio campbellii (strain ATCC BAA-1116)
B0TQC1 0.0 517 69 2 378 3 dnaJ Chaperone protein DnaJ Shewanella halifaxensis (strain HAW-EB4)
Q086J2 0.0 517 70 3 381 3 dnaJ Chaperone protein DnaJ Shewanella frigidimarina (strain NCIMB 400)
A6WRU8 0.0 516 69 3 380 3 dnaJ Chaperone protein DnaJ Shewanella baltica (strain OS185)
A3D7T3 0.0 516 69 3 380 3 dnaJ Chaperone protein DnaJ Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E4S2 0.0 516 69 3 380 3 dnaJ Chaperone protein DnaJ Shewanella baltica (strain OS223)
Q8EHT6 0.0 516 69 3 381 3 dnaJ Chaperone protein DnaJ Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q89AU7 0.0 516 63 2 383 3 dnaJ Chaperone protein DnaJ Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B6EKA0 0.0 516 69 2 381 3 dnaJ Chaperone protein DnaJ Aliivibrio salmonicida (strain LFI1238)
Q0HY10 0.0 515 70 3 380 3 dnaJ Chaperone protein DnaJ Shewanella sp. (strain MR-7)
Q0HLM9 0.0 515 70 3 380 3 dnaJ Chaperone protein DnaJ Shewanella sp. (strain MR-4)
A9L0R7 0.0 515 69 3 380 3 dnaJ Chaperone protein DnaJ Shewanella baltica (strain OS195)
Q65U54 0.0 514 68 2 379 3 dnaJ Chaperone protein DnaJ Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7VQL3 0.0 514 68 3 380 3 dnaJ Chaperone protein DnaJ Blochmanniella floridana
A1RGN2 0.0 514 70 3 380 3 dnaJ Chaperone protein DnaJ Shewanella sp. (strain W3-18-1)
Q9CMS2 0.0 513 68 2 379 3 dnaJ Chaperone protein DnaJ Pasteurella multocida (strain Pm70)
A0KTS6 0.0 513 69 3 380 3 dnaJ Chaperone protein DnaJ Shewanella sp. (strain ANA-3)
A4Y9Q2 0.0 513 69 3 380 3 dnaJ Chaperone protein DnaJ Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B7VJX0 1.27e-180 509 71 2 382 3 dnaJ Chaperone protein DnaJ Vibrio atlanticus (strain LGP32)
A1S8K6 6.05e-180 507 70 2 378 3 dnaJ Chaperone protein DnaJ Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A0KMI5 1.63e-178 504 72 2 380 3 dnaJ Chaperone protein DnaJ Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q5QXL2 2.03e-178 503 67 3 382 3 dnaJ Chaperone protein DnaJ Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q4QJW5 7.32e-178 502 67 1 379 3 dnaJ Chaperone protein DnaJ Haemophilus influenzae (strain 86-028NP)
O87385 6.6e-177 500 70 3 385 3 dnaJ Chaperone protein DnaJ Vibrio harveyi
Q3IC07 1.08e-176 499 69 2 381 3 dnaJ Chaperone protein DnaJ Pseudoalteromonas translucida (strain TAC 125)
Q1IF58 3.61e-176 498 66 3 380 3 dnaJ Chaperone protein DnaJ Pseudomonas entomophila (strain L48)
Q12Q07 4.37e-176 497 70 3 381 3 dnaJ Chaperone protein DnaJ Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
C4K3I5 2.59e-175 495 62 4 378 3 dnaJ Chaperone protein DnaJ Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q88DU3 3.29e-175 495 66 3 380 3 dnaJ Chaperone protein DnaJ Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
C1DFM2 2.37e-173 490 67 3 379 3 dnaJ Chaperone protein DnaJ Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A1STE5 2.78e-173 490 66 3 383 3 dnaJ Chaperone protein DnaJ Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B0KIS4 4.71e-173 489 65 3 379 3 dnaJ Chaperone protein DnaJ Pseudomonas putida (strain GB-1)
A5W9A2 6.47e-173 489 65 3 379 3 dnaJ Chaperone protein DnaJ Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A6VNB0 7.85e-173 489 64 1 379 3 dnaJ Chaperone protein DnaJ Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B1J255 1.06e-172 489 65 3 379 3 dnaJ Chaperone protein DnaJ Pseudomonas putida (strain W619)
Q2SMM7 4.44e-172 487 64 3 378 3 dnaJ Chaperone protein DnaJ Hahella chejuensis (strain KCTC 2396)
Q9HV44 5.35e-171 484 65 3 381 3 dnaJ Chaperone protein DnaJ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02FR2 5.35e-171 484 65 3 381 3 dnaJ Chaperone protein DnaJ Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V1H2 5.35e-171 484 65 3 381 3 dnaJ Chaperone protein DnaJ Pseudomonas aeruginosa (strain LESB58)
Q6VAY5 1.98e-170 483 66 3 379 3 dnaJ Chaperone protein DnaJ Stutzerimonas stutzeri
A4SQ24 7.69e-170 482 69 2 381 3 dnaJ Chaperone protein DnaJ Aeromonas salmonicida (strain A449)
Q48E63 8.67e-170 481 64 2 382 3 dnaJ Chaperone protein DnaJ Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P77866 1.31e-169 481 65 3 380 3 dnaJ Chaperone protein DnaJ Aggregatibacter actinomycetemcomitans
Q0VST5 4.42e-169 479 63 3 378 3 dnaJ Chaperone protein DnaJ Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q4KIH0 8.21e-169 479 64 3 379 3 dnaJ Chaperone protein DnaJ Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A1U613 8.86e-169 479 64 2 377 3 dnaJ Chaperone protein DnaJ Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q1QSX1 2.41e-168 478 64 4 380 3 dnaJ Chaperone protein DnaJ Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A6VCL7 2.82e-168 478 65 3 381 3 dnaJ Chaperone protein DnaJ Pseudomonas aeruginosa (strain PA7)
Q4ZNP8 3.23e-168 478 64 2 382 3 dnaJ Chaperone protein DnaJ Pseudomonas syringae pv. syringae (strain B728a)
P48208 5.05e-167 474 63 1 379 3 dnaJ Chaperone protein DnaJ Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A4XYF5 7.69e-167 474 65 3 379 3 dnaJ Chaperone protein DnaJ Pseudomonas mendocina (strain ymp)
B8F7S3 7.75e-167 474 65 2 380 3 dnaJ Chaperone protein DnaJ Glaesserella parasuis serovar 5 (strain SH0165)
C3K274 7.76e-167 474 64 3 379 3 dnaJ Chaperone protein DnaJ Pseudomonas fluorescens (strain SBW25)
Q057X7 4.47e-166 473 53 3 389 3 dnaJ Chaperone protein DnaJ Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q87WP1 6.94e-166 472 65 2 382 3 dnaJ Chaperone protein DnaJ Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0I3V1 1.97e-165 470 62 3 379 3 dnaJ Chaperone protein DnaJ Histophilus somni (strain 129Pt)
B0UWR3 9.82e-165 468 61 3 379 3 dnaJ Chaperone protein DnaJ Histophilus somni (strain 2336)
B0BTI6 3.88e-164 467 63 2 381 3 dnaJ Chaperone protein DnaJ Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q47XI7 7.68e-164 466 65 1 377 3 dnaJ Chaperone protein DnaJ Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B8GNX2 8e-164 466 61 3 378 3 dnaJ Chaperone protein DnaJ Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A3N3J9 9.6e-164 466 63 2 381 3 dnaJ Chaperone protein DnaJ Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A9KG87 1.08e-163 466 61 3 375 3 dnaJ Chaperone protein DnaJ Coxiella burnetii (strain Dugway 5J108-111)
B6J7U6 1.08e-163 466 61 3 375 3 dnaJ Chaperone protein DnaJ Coxiella burnetii (strain CbuK_Q154)
Q5P1H7 9.04e-163 464 61 4 376 3 dnaJ2 Chaperone protein DnaJ 2 Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q21H37 1.17e-162 463 63 3 379 3 dnaJ Chaperone protein DnaJ Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
C1DD87 2.47e-162 462 61 3 380 3 dnaJ Chaperone protein DnaJ Laribacter hongkongensis (strain HLHK9)
B6IZJ1 3.68e-162 462 61 4 375 3 dnaJ Chaperone protein DnaJ Coxiella burnetii (strain CbuG_Q212)
P43735 3.71e-162 462 63 0 379 3 dnaJ Chaperone protein DnaJ Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P42381 4.2e-162 462 61 4 375 3 dnaJ Chaperone protein DnaJ Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q8L3D3 8.1e-162 461 66 2 378 3 dnaJ Chaperone protein DnaJ Colwellia maris
A9N8H1 1.61e-161 460 61 4 375 3 dnaJ Chaperone protein DnaJ Coxiella burnetii (strain RSA 331 / Henzerling II)
A5UF67 7.42e-161 459 62 0 379 3 dnaJ Chaperone protein DnaJ Haemophilus influenzae (strain PittGG)
C5BQ32 8.97e-159 453 61 3 380 3 dnaJ Chaperone protein DnaJ Teredinibacter turnerae (strain ATCC 39867 / T7901)
P50025 1.74e-158 453 59 3 380 3 dnaJ Chaperone protein DnaJ Legionella pneumophila
Q5ZTY4 1.74e-158 453 59 3 380 3 dnaJ Chaperone protein DnaJ Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IDK7 1.74e-158 453 59 3 380 3 dnaJ Chaperone protein DnaJ Legionella pneumophila (strain Corby)
Q5X3M8 1.74e-158 453 59 3 380 3 dnaJ Chaperone protein DnaJ Legionella pneumophila (strain Paris)
Q5WV16 1.76e-158 453 59 3 380 3 dnaJ Chaperone protein DnaJ Legionella pneumophila (strain Lens)
A6W2D1 2.39e-158 452 62 3 380 3 dnaJ Chaperone protein DnaJ Marinomonas sp. (strain MWYL1)
Q3SIN3 1.61e-157 450 60 3 374 3 dnaJ Chaperone protein DnaJ Thiobacillus denitrificans (strain ATCC 25259)
A1K4C4 1.75e-157 450 60 3 377 3 dnaJ Chaperone protein DnaJ Azoarcus sp. (strain BH72)
Q3J7D9 1.91e-157 450 61 2 380 3 dnaJ Chaperone protein DnaJ Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q1H3B9 5.73e-157 449 59 2 374 3 dnaJ Chaperone protein DnaJ Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q9PB06 9.81e-156 446 57 4 378 3 dnaJ Chaperone protein DnaJ Xylella fastidiosa (strain 9a5c)
Q9ZFC5 4.98e-155 444 58 3 374 3 dnaJ Chaperone protein DnaJ Methylovorus sp. (strain SS1 / DSM 11726)
Q87BS9 5.89e-155 443 57 4 378 3 dnaJ Chaperone protein DnaJ Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6F5 5.89e-155 443 57 4 378 3 dnaJ Chaperone protein DnaJ Xylella fastidiosa (strain M23)
B0U3J7 1.44e-154 442 57 4 378 3 dnaJ Chaperone protein DnaJ Xylella fastidiosa (strain M12)
Q7NXI1 1.86e-154 442 59 2 376 3 dnaJ Chaperone protein DnaJ Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q607A6 3.64e-154 442 62 3 378 3 dnaJ Chaperone protein DnaJ Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q0A7E4 6.58e-154 441 61 3 382 3 dnaJ Chaperone protein DnaJ Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A2SIR5 1e-153 441 56 5 381 3 dnaJ Chaperone protein DnaJ Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q0AIY0 3.92e-153 439 58 4 379 3 dnaJ Chaperone protein DnaJ Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q145F0 1e-152 438 58 3 382 3 dnaJ Chaperone protein DnaJ Paraburkholderia xenovorans (strain LB400)
O06431 1.39e-152 437 58 4 377 3 dnaJ Chaperone protein DnaJ Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8XW41 4.02e-152 437 57 4 380 3 dnaJ Chaperone protein DnaJ Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B2SXC7 4.93e-152 436 58 3 381 3 dnaJ Chaperone protein DnaJ Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q5NSW9 1.02e-151 436 57 2 377 3 dnaJ Chaperone protein DnaJ Burkholderia multivorans (strain ATCC 17616 / 249)
B4SSQ7 2.21e-151 435 58 3 380 3 dnaJ Chaperone protein DnaJ Stenotrophomonas maltophilia (strain R551-3)
Q7W520 5.8e-151 434 58 2 377 3 dnaJ Chaperone protein DnaJ Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q39JC7 1.26e-150 433 56 2 379 3 dnaJ Chaperone protein DnaJ Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1BYX2 1.42e-150 433 56 2 379 3 dnaJ Chaperone protein DnaJ Burkholderia orbicola (strain AU 1054)
B1JW20 1.42e-150 433 56 2 379 3 dnaJ Chaperone protein DnaJ Burkholderia orbicola (strain MC0-3)
B4EDZ1 1.42e-150 433 56 2 379 3 dnaJ Chaperone protein DnaJ Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0K4S9 1.42e-150 433 56 2 379 3 dnaJ Chaperone protein DnaJ Burkholderia cenocepacia (strain HI2424)
B2FMY6 1.44e-150 432 59 3 379 3 dnaJ Chaperone protein DnaJ Stenotrophomonas maltophilia (strain K279a)
Q2KWA4 2.02e-150 432 58 2 374 3 dnaJ Chaperone protein DnaJ Bordetella avium (strain 197N)
Q0BI17 3.02e-150 432 56 2 379 3 dnaJ Chaperone protein DnaJ Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YTK1 3.02e-150 432 56 2 379 3 dnaJ Chaperone protein DnaJ Burkholderia ambifaria (strain MC40-6)
A4JBS2 4.83e-150 431 56 2 379 3 dnaJ Chaperone protein DnaJ Burkholderia vietnamiensis (strain G4 / LMG 22486)
A5EYE5 7.59e-150 431 57 4 380 3 dnaJ Chaperone protein DnaJ Dichelobacter nodosus (strain VCS1703A)
Q7WGI5 1.28e-149 430 57 3 377 3 dnaJ Chaperone protein DnaJ Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A3ND66 2.1e-149 430 57 2 377 3 dnaJ Chaperone protein DnaJ Burkholderia pseudomallei (strain 668)
A3NYX5 2.1e-149 430 57 2 377 3 dnaJ Chaperone protein DnaJ Burkholderia pseudomallei (strain 1106a)
Q63R47 6.13e-149 429 57 2 377 3 dnaJ Chaperone protein DnaJ Burkholderia pseudomallei (strain K96243)
Q3JP12 6.13e-149 429 57 2 377 3 dnaJ Chaperone protein DnaJ Burkholderia pseudomallei (strain 1710b)
Q2SYZ3 9.09e-149 428 57 2 377 3 dnaJ Chaperone protein DnaJ Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B2JGE1 1.13e-148 428 57 3 379 3 dnaJ Chaperone protein DnaJ Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A1V0U8 1.35e-148 427 56 2 377 3 dnaJ Chaperone protein DnaJ Burkholderia mallei (strain SAVP1)
Q62HD6 1.35e-148 427 56 2 377 3 dnaJ Chaperone protein DnaJ Burkholderia mallei (strain ATCC 23344)
A2S563 1.35e-148 427 56 2 377 3 dnaJ Chaperone protein DnaJ Burkholderia mallei (strain NCTC 10229)
A3MN97 1.35e-148 427 56 2 377 3 dnaJ Chaperone protein DnaJ Burkholderia mallei (strain NCTC 10247)
O52065 1.53e-148 427 61 2 381 3 dnaJ Chaperone protein DnaJ Mannheimia haemolytica
A1WAR7 1.95e-148 427 58 4 378 3 dnaJ Chaperone protein DnaJ Acidovorax sp. (strain JS42)
A9IGC5 2.67e-148 427 56 3 377 3 dnaJ Chaperone protein DnaJ Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B9MDJ8 5.63e-148 426 58 4 378 3 dnaJ Chaperone protein DnaJ Acidovorax ebreus (strain TPSY)
Q7VVY3 5.85e-148 426 56 3 385 3 dnaJ Chaperone protein DnaJ Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A9BNG6 6.98e-148 426 57 4 380 3 dnaJ Chaperone protein DnaJ Delftia acidovorans (strain DSM 14801 / SPH-1)
Q46XI8 9.88e-148 426 55 3 381 3 dnaJ Chaperone protein DnaJ Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q5H185 4.58e-147 424 58 3 379 3 dnaJ Chaperone protein DnaJ Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SQU3 4.58e-147 424 58 3 379 3 dnaJ Chaperone protein DnaJ Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P458 4.58e-147 424 58 3 379 3 dnaJ Chaperone protein DnaJ Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8PAK8 3.45e-146 421 58 3 379 3 dnaJ Chaperone protein DnaJ Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UT12 3.45e-146 421 58 3 379 3 dnaJ Chaperone protein DnaJ Xanthomonas campestris pv. campestris (strain 8004)
B0RVU1 3.89e-146 421 58 3 379 3 dnaJ Chaperone protein DnaJ Xanthomonas campestris pv. campestris (strain B100)
B3R6G6 6.81e-146 421 55 3 379 3 dnaJ Chaperone protein DnaJ Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q3BVB7 1.04e-145 420 58 2 378 3 dnaJ Chaperone protein DnaJ Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PMA9 1.32e-145 420 58 2 378 3 dnaJ Chaperone protein DnaJ Xanthomonas axonopodis pv. citri (strain 306)
B6IVA5 1.73e-145 420 55 4 381 3 dnaJ Chaperone protein DnaJ Rhodospirillum centenum (strain ATCC 51521 / SW)
B9KPP3 2.49e-145 419 54 5 386 3 dnaJ Chaperone protein DnaJ Cereibacter sphaeroides (strain KD131 / KCTC 12085)
B2UBP2 3.27e-145 419 55 2 381 3 dnaJ Chaperone protein DnaJ Ralstonia pickettii (strain 12J)
Q3IYM8 3.65e-145 419 54 5 387 3 dnaJ Chaperone protein DnaJ Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PNM0 3.77e-145 419 54 5 387 3 dnaJ Chaperone protein DnaJ Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A1WX30 5.09e-145 419 56 3 384 3 dnaJ Chaperone protein DnaJ Halorhodospira halophila (strain DSM 244 / SL1)
Q6G553 8.53e-145 418 53 4 380 3 dnaJ Chaperone protein DnaJ Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q6F6R1 2.13e-144 417 58 6 380 3 dnaJ Chaperone protein DnaJ Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B1Y787 3.29e-144 417 55 4 385 3 dnaJ Chaperone protein DnaJ Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
C3MC05 6.48e-144 416 56 5 384 3 dnaJ Chaperone protein DnaJ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q4FVQ7 6.57e-144 416 57 3 380 3 dnaJ Chaperone protein DnaJ Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q6RSN5 9.6e-144 416 57 4 382 1 dnaJ Chaperone protein DnaJ Rhizobium radiobacter
Q1QET5 1.02e-143 415 58 3 380 3 dnaJ Chaperone protein DnaJ Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A1VMG1 1.39e-143 415 55 4 382 3 dnaJ Chaperone protein DnaJ Polaromonas naphthalenivorans (strain CJ2)
Q128K1 4.15e-143 414 55 4 381 3 dnaJ Chaperone protein DnaJ Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q0K758 4.34e-143 414 55 5 383 3 dnaJ Chaperone protein DnaJ Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q6G1F8 7.65e-143 413 52 4 380 3 dnaJ Chaperone protein DnaJ Bartonella quintana (strain Toulouse)
A6UEY1 8.1e-143 413 56 5 382 3 dnaJ Chaperone protein DnaJ Sinorhizobium medicae (strain WSM419)
Q1LJ82 8.42e-143 413 56 3 380 3 dnaJ Chaperone protein DnaJ Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A4WW88 1.19e-142 413 55 5 387 3 dnaJ Chaperone protein DnaJ Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
P50018 1.42e-142 412 56 4 380 2 dnaJ Chaperone protein DnaJ Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92T07 1.75e-142 412 55 5 384 3 dnaJ Chaperone protein DnaJ Rhizobium meliloti (strain 1021)
P48207 2.53e-142 411 54 4 379 3 dnaJ Chaperone protein DnaJ Francisella tularensis
Q2A327 2.53e-142 411 54 4 379 3 dnaJ Chaperone protein DnaJ Francisella tularensis subsp. holarctica (strain LVS)
A5CX57 3.59e-142 411 53 4 376 3 dnaJ Chaperone protein DnaJ Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A4G8D1 4.79e-142 411 55 3 377 3 dnaJ Chaperone protein DnaJ Herminiimonas arsenicoxydans
A4IX29 1.71e-141 409 54 4 379 3 dnaJ Chaperone protein DnaJ Francisella tularensis subsp. tularensis (strain WY96-3418)
A6T225 1.87e-141 409 55 4 378 3 dnaJ Chaperone protein DnaJ Janthinobacterium sp. (strain Marseille)
A1KR91 8.72e-141 408 58 3 376 3 dnaJ Chaperone protein DnaJ Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P63969 8.72e-141 408 58 3 376 3 dnaJ Chaperone protein DnaJ Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P63968 8.72e-141 408 58 3 376 3 dnaJ Chaperone protein DnaJ Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9LZV9 8.72e-141 408 58 3 376 3 dnaJ Chaperone protein DnaJ Neisseria meningitidis serogroup C (strain 053442)
Q2KDW7 1.08e-140 407 57 4 380 3 dnaJ Chaperone protein DnaJ Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3PXH2 1.21e-140 407 57 4 380 3 dnaJ Chaperone protein DnaJ Rhizobium etli (strain CIAT 652)
Q1MN12 2.09e-140 407 57 4 380 3 dnaJ Chaperone protein DnaJ Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q98DD2 2.17e-140 407 55 5 380 3 dnaJ Chaperone protein DnaJ Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A5WBF8 5.55e-140 406 57 3 378 3 dnaJ Chaperone protein DnaJ Psychrobacter sp. (strain PRwf-1)
B5ZWQ1 9.66e-140 405 56 4 380 3 dnaJ Chaperone protein DnaJ Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q5F5M1 1.05e-139 405 57 3 376 3 dnaJ Chaperone protein DnaJ Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q31HA6 1.87e-138 402 54 2 375 3 dnaJ Chaperone protein DnaJ Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5NFG8 2.43e-138 401 54 3 379 3 dnaJ Chaperone protein DnaJ Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14GX0 2.43e-138 401 54 3 379 3 dnaJ Chaperone protein DnaJ Francisella tularensis subsp. tularensis (strain FSC 198)
B9JZ89 2.74e-138 402 54 4 388 3 dnaJ Chaperone protein DnaJ Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
B0TYF3 9.63e-138 400 53 3 379 3 dnaJ Chaperone protein DnaJ Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q11KJ5 6.57e-137 398 53 5 379 3 dnaJ Chaperone protein DnaJ Chelativorans sp. (strain BNC1)
A1AW21 1.12e-136 397 53 3 375 3 dnaJ Chaperone protein DnaJ Ruthia magnifica subsp. Calyptogena magnifica
Q1GKS4 2.05e-136 397 52 4 387 3 dnaJ Chaperone protein DnaJ Ruegeria sp. (strain TM1040)
A1TLH8 2.24e-136 397 56 4 379 3 dnaJ Chaperone protein DnaJ Paracidovorax citrulli (strain AAC00-1)
Q16D44 2.69e-136 397 54 4 372 3 dnaJ Chaperone protein DnaJ Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B0VA24 2.7e-136 396 60 3 375 3 dnaJ Chaperone protein DnaJ Acinetobacter baumannii (strain AYE)
A3MA88 2.7e-136 396 60 3 375 3 dnaJ Chaperone protein DnaJ Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VQ00 2.7e-136 396 60 3 375 3 dnaJ Chaperone protein DnaJ Acinetobacter baumannii (strain SDF)
B2I2G6 2.7e-136 396 60 3 375 3 dnaJ Chaperone protein DnaJ Acinetobacter baumannii (strain ACICU)
B7I2B2 2.7e-136 396 60 3 375 3 dnaJ Chaperone protein DnaJ Acinetobacter baumannii (strain AB0057)
B7GV08 2.7e-136 396 60 3 375 3 dnaJ Chaperone protein DnaJ Acinetobacter baumannii (strain AB307-0294)
A6WX07 4.55e-136 396 56 3 378 3 dnaJ Chaperone protein DnaJ Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q52702 1.04e-135 395 52 4 387 3 dnaJ Chaperone protein DnaJ Rhodobacter capsulatus
Q8FXX1 1.09e-135 395 56 3 376 3 dnaJ Chaperone protein DnaJ Brucella suis biovar 1 (strain 1330)
B0CJX5 1.09e-135 395 56 3 376 3 dnaJ Chaperone protein DnaJ Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8YE77 1.09e-135 395 56 3 376 3 dnaJ Chaperone protein DnaJ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RG11 1.09e-135 395 56 3 376 3 dnaJ Chaperone protein DnaJ Brucella melitensis biotype 2 (strain ATCC 23457)
A9M9V9 1.09e-135 395 56 3 376 3 dnaJ Chaperone protein DnaJ Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
B9JGW2 3.12e-135 394 55 4 385 3 dnaJ Chaperone protein DnaJ Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q57AD6 4.9e-135 393 56 3 376 3 dnaJ Chaperone protein DnaJ Brucella abortus biovar 1 (strain 9-941)
Q2YQV1 4.9e-135 393 56 3 376 3 dnaJ Chaperone protein DnaJ Brucella abortus (strain 2308)
B2S9C2 4.9e-135 393 56 3 376 3 dnaJ Chaperone protein DnaJ Brucella abortus (strain S19)
Q05980 1.11e-134 392 56 3 376 2 dnaJ Chaperone protein DnaJ Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
B2IBR5 3.51e-134 391 51 5 381 3 dnaJ Chaperone protein DnaJ Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B8IHL2 5.65e-134 391 54 4 389 3 dnaJ Chaperone protein DnaJ Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
B0U833 5.77e-134 391 53 4 390 3 dnaJ Chaperone protein DnaJ Methylobacterium sp. (strain 4-46)
Q5LWJ5 8.57e-134 390 54 3 384 3 dnaJ Chaperone protein DnaJ Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A8IPT0 2.03e-133 389 52 5 381 3 dnaJ Chaperone protein DnaJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q28VY4 1.06e-132 387 50 4 387 3 dnaJ Chaperone protein DnaJ Jannaschia sp. (strain CCS1)
A7HZ38 3.14e-131 384 51 4 385 3 dnaJ Chaperone protein DnaJ Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q2VYT0 4.79e-131 383 53 4 381 3 dnaJ Chaperone protein DnaJ Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B1LZ52 1.41e-130 382 52 4 384 3 dnaJ Chaperone protein DnaJ Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q2J319 2.08e-130 382 53 3 374 3 dnaJ Chaperone protein DnaJ Rhodopseudomonas palustris (strain HaA2)
A7IC67 2.12e-130 382 52 4 380 3 dnaJ Chaperone protein DnaJ Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q5NPS5 6.16e-130 380 52 4 377 3 dnaJ Chaperone protein DnaJ Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A1B4F0 6.42e-130 380 52 6 390 3 dnaJ Chaperone protein DnaJ Paracoccus denitrificans (strain Pd 1222)
A9W6R8 7.73e-130 380 51 4 387 3 dnaJ Chaperone protein DnaJ Methylorubrum extorquens (strain PA1)
B1ZGR2 1.08e-129 380 51 4 385 3 dnaJ Chaperone protein DnaJ Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
P22305 1.22e-129 380 50 4 386 3 dnaJ Chaperone protein DnaJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B5ENA2 2.06e-129 379 54 3 378 3 dnaJ Chaperone protein DnaJ Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J7X8 2.06e-129 379 54 3 378 3 dnaJ Chaperone protein DnaJ Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A8LQ63 8.58e-129 377 51 5 386 3 dnaJ Chaperone protein DnaJ Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
B7KSZ5 1.15e-128 377 51 4 387 3 dnaJ Chaperone protein DnaJ Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q21CI1 1.19e-127 374 53 3 373 3 dnaJ Chaperone protein DnaJ Rhodopseudomonas palustris (strain BisB18)
O08356 2.89e-127 374 52 3 374 3 dnaJ Chaperone protein DnaJ Rhodopseudomonas sp. (strain No.7)
B3Q973 2.89e-127 374 52 3 374 3 dnaJ Chaperone protein DnaJ Rhodopseudomonas palustris (strain TIE-1)
Q6NCY3 2.89e-127 374 52 3 374 3 dnaJ Chaperone protein DnaJ Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q9ZDY0 4.82e-126 370 51 4 347 3 dnaJ Chaperone protein DnaJ Rickettsia prowazekii (strain Madrid E)
Q93S23 3.82e-125 366 57 3 330 3 dnaJ Chaperone protein DnaJ (Fragment) Rhizobium tropici
Q68XI3 1.04e-124 367 50 4 347 3 dnaJ Chaperone protein DnaJ Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A8GMF8 3.61e-124 365 51 5 348 3 dnaJ Chaperone protein DnaJ Rickettsia akari (strain Hartford)
Q1RHG9 3.99e-124 365 50 5 357 3 dnaJ Chaperone protein DnaJ Rickettsia bellii (strain RML369-C)
Q0C454 4.48e-124 365 52 5 381 3 dnaJ Chaperone protein DnaJ Hyphomonas neptunium (strain ATCC 15444)
A8GV67 5.91e-124 365 50 5 357 3 dnaJ Chaperone protein DnaJ Rickettsia bellii (strain OSU 85-389)
C5D4U0 8.87e-124 365 53 6 380 3 dnaJ Chaperone protein DnaJ Geobacillus sp. (strain WCH70)
Q4FNQ0 2.54e-123 363 50 6 381 3 dnaJ Chaperone protein DnaJ Pelagibacter ubique (strain HTCC1062)
P94319 4.02e-123 363 52 3 374 3 dnaJ Chaperone protein DnaJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q75WD2 6.65e-123 362 51 6 377 3 dnaJ Chaperone protein DnaJ Acetobacter pasteurianus (strain NBRC 105184 / IFO 3283-01)
A8EXP6 4.41e-122 360 49 5 351 3 dnaJ Chaperone protein DnaJ Rickettsia canadensis (strain McKiel)
Q9KWS6 4.62e-122 360 53 6 380 3 dnaJ Chaperone protein DnaJ Parageobacillus thermoglucosidasius
Q92J37 2e-121 358 49 3 349 3 dnaJ Chaperone protein DnaJ Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PMM6 2e-121 358 49 3 349 3 dnaJ Chaperone protein DnaJ Rickettsia africae (strain ESF-5)
Q3A8C3 4.15e-121 358 50 3 376 3 dnaJ Chaperone protein DnaJ Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q24SS4 6.79e-121 357 52 4 378 3 dnaJ Chaperone protein DnaJ Desulfitobacterium hafniense (strain Y51)
B8FUN3 6.79e-121 357 52 4 378 3 dnaJ Chaperone protein DnaJ Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q0AKB3 7.62e-121 358 51 4 390 3 dnaJ Chaperone protein DnaJ Maricaulis maris (strain MCS10)
C4K111 8.34e-121 357 49 3 349 3 dnaJ Chaperone protein DnaJ Rickettsia peacockii (strain Rustic)
A8F0U0 8.34e-121 357 49 3 352 3 dnaJ Chaperone protein DnaJ Rickettsia massiliae (strain Mtu5)
B0BWH0 1.17e-120 357 49 3 349 3 dnaJ Chaperone protein DnaJ Rickettsia rickettsii (strain Iowa)
Q74H58 2.08e-120 356 53 1 372 3 dnaJ Chaperone protein DnaJ Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A8GR21 3.75e-120 355 49 3 349 3 dnaJ Chaperone protein DnaJ Rickettsia rickettsii (strain Sheila Smith)
Q4UJK6 5.16e-119 352 49 3 347 3 dnaJ Chaperone protein DnaJ Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B8CXL0 4.18e-118 350 51 5 376 3 dnaJ Chaperone protein DnaJ Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A4IR30 4.82e-118 350 53 7 382 3 dnaJ Chaperone protein DnaJ Geobacillus thermodenitrificans (strain NG80-2)
Q8RB67 5.74e-118 350 50 5 386 3 dnaJ Chaperone protein DnaJ Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A7GT07 9.95e-118 349 54 5 355 3 dnaJ Chaperone protein DnaJ Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B8I304 5.76e-117 347 50 4 379 3 dnaJ Chaperone protein DnaJ Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A0LJ41 3.83e-116 345 48 3 372 3 dnaJ Chaperone protein DnaJ Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A7Z6W0 6.38e-116 345 52 5 379 3 dnaJ Chaperone protein DnaJ Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q5KWZ8 1.28e-115 344 52 6 382 3 dnaJ Chaperone protein DnaJ Geobacillus kaustophilus (strain HTA426)
Q9LCQ4 2.28e-115 343 49 6 378 3 dnaJ Chaperone protein DnaJ Brevibacillus choshinensis
Q2GLU9 6.84e-115 342 47 6 386 3 dnaJ Chaperone protein DnaJ Anaplasma phagocytophilum (strain HZ)
B0SRF0 1.37e-114 341 51 6 361 3 dnaJ Chaperone protein DnaJ Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SHT0 1.37e-114 341 51 6 361 3 dnaJ Chaperone protein DnaJ Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
A5CD86 1.51e-114 341 45 4 379 3 dnaJ Chaperone protein DnaJ Orientia tsutsugamushi (strain Boryong)
Q65H55 2.39e-114 340 52 5 379 3 dnaJ Chaperone protein DnaJ Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A4XKA5 2.97e-114 341 48 6 387 3 dnaJ Chaperone protein DnaJ Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B9MJZ0 5.06e-114 340 49 6 388 3 dnaJ Chaperone protein DnaJ Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A8FFD1 5.06e-114 340 51 6 381 3 dnaJ Chaperone protein DnaJ Bacillus pumilus (strain SAFR-032)
Q182E7 9.61e-114 339 48 4 386 3 dnaJ Chaperone protein DnaJ Clostridioides difficile (strain 630)
Q5P9E0 1.28e-113 339 44 6 385 3 dnaJ Chaperone protein DnaJ Anaplasma marginale (strain St. Maries)
B9KH92 1.28e-113 339 44 6 385 3 dnaJ Chaperone protein DnaJ Anaplasma marginale (strain Florida)
B3CVD9 1.42e-113 338 44 4 379 3 dnaJ Chaperone protein DnaJ Orientia tsutsugamushi (strain Ikeda)
Q2GI75 2.01e-113 338 47 4 382 3 dnaJ Chaperone protein DnaJ Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
P17631 3.66e-113 337 52 5 379 2 dnaJ Chaperone protein DnaJ Bacillus subtilis (strain 168)
Q6AN63 6.81e-113 337 47 5 379 3 dnaJ Chaperone protein DnaJ Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A0Q1R3 8.55e-113 337 51 2 354 3 dnaJ Chaperone protein DnaJ Clostridium novyi (strain NT)
B1ZUS0 1.31e-112 336 48 4 388 3 dnaJ Chaperone protein DnaJ Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
B1HUD0 1.37e-112 336 50 6 380 3 dnaJ Chaperone protein DnaJ Lysinibacillus sphaericus (strain C3-41)
Q8CXD3 1.63e-112 336 51 5 355 3 dnaJ Chaperone protein DnaJ Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A9KKT9 1.89e-112 336 48 4 360 3 dnaJ Chaperone protein DnaJ Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A5FZ18 6.12e-112 335 51 4 385 3 dnaJ Chaperone protein DnaJ Acidiphilium cryptum (strain JF-5)
Q5FSL4 7.21e-112 334 50 6 378 3 dnaJ Chaperone protein DnaJ Gluconobacter oxydans (strain 621H)
Q5HCG4 2.05e-111 333 46 6 383 3 dnaJ Chaperone protein DnaJ Ehrlichia ruminantium (strain Welgevonden)
A3DF24 2.71e-111 333 50 3 364 3 dnaJ Chaperone protein DnaJ Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
P61441 3.1e-111 332 48 7 373 3 dnaJ Chaperone protein DnaJ Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P61440 3.1e-111 332 48 7 373 3 dnaJ Chaperone protein DnaJ Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
O27352 3.3e-111 332 48 7 382 3 dnaJ Chaperone protein DnaJ Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q634M8 4.43e-111 332 53 2 352 3 dnaJ Chaperone protein DnaJ Bacillus cereus (strain ZK / E33L)
C1ESK7 4.43e-111 332 53 2 352 3 dnaJ Chaperone protein DnaJ Bacillus cereus (strain 03BB102)
B9IY80 4.58e-111 332 54 2 352 3 dnaJ Chaperone protein DnaJ Bacillus cereus (strain Q1)
B7HPL2 4.58e-111 332 54 2 352 3 dnaJ Chaperone protein DnaJ Bacillus cereus (strain AH187)
Q730M2 4.58e-111 332 54 2 352 3 dnaJ Chaperone protein DnaJ Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HDK8 4.68e-111 332 53 2 352 3 dnaJ Chaperone protein DnaJ Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81LS3 4.68e-111 332 53 2 352 3 dnaJ Chaperone protein DnaJ Bacillus anthracis
C3L5R6 4.68e-111 332 53 2 352 3 dnaJ Chaperone protein DnaJ Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P8L9 4.68e-111 332 53 2 352 3 dnaJ Chaperone protein DnaJ Bacillus anthracis (strain A0248)
Q5FGQ8 5.68e-111 332 46 6 383 3 dnaJ Chaperone protein DnaJ Ehrlichia ruminantium (strain Gardel)
B7HCT9 7.39e-111 332 54 2 352 3 dnaJ Chaperone protein DnaJ Bacillus cereus (strain B4264)
B7IYG6 7.39e-111 332 54 2 352 3 dnaJ Chaperone protein DnaJ Bacillus cereus (strain G9842)
Q5WHG0 1.08e-110 331 50 6 378 3 dnaJ Chaperone protein DnaJ Shouchella clausii (strain KSM-K16)
B7JN38 2.75e-110 330 53 2 352 3 dnaJ Chaperone protein DnaJ Bacillus cereus (strain AH820)
B1YKT0 4.95e-110 329 51 4 355 3 dnaJ Chaperone protein DnaJ Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q3YT99 1.76e-109 328 46 5 384 3 dnaJ Chaperone protein DnaJ Ehrlichia canis (strain Jake)
Q818F0 3.5e-109 327 53 2 352 3 dnaJ Chaperone protein DnaJ Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
O69269 4.08e-109 327 49 7 380 3 dnaJ Chaperone protein DnaJ Lysinibacillus sphaericus
Q5L6F7 1.3e-108 327 46 4 394 3 dnaJ Chaperone protein DnaJ Chlamydia abortus (strain DSM 27085 / S26/3)
A9VHU0 1.34e-108 325 54 3 352 3 dnaJ Chaperone protein DnaJ Bacillus mycoides (strain KBAB4)
Q892R1 3.25e-108 325 47 4 382 3 dnaJ Chaperone protein DnaJ Clostridium tetani (strain Massachusetts / E88)
Q8XIT1 3.98e-108 325 50 3 370 3 dnaJ Chaperone protein DnaJ Clostridium perfringens (strain 13 / Type A)
B8DQW8 7.03e-108 324 49 3 356 3 dnaJ Chaperone protein DnaJ Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B9E6X0 9.03e-108 323 49 6 379 3 dnaJ Chaperone protein DnaJ Macrococcus caseolyticus (strain JCSC5402)
Q8TQR1 9.2e-108 324 47 5 359 3 dnaJ Chaperone protein DnaJ Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q5HNW7 9.23e-108 323 47 5 381 3 dnaJ Chaperone protein DnaJ Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CP18 9.33e-108 323 48 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q67S53 4.39e-107 322 49 4 381 3 dnaJ Chaperone protein DnaJ Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q2YT48 1.75e-106 320 48 7 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q70WY6 2.06e-106 321 44 7 398 3 dnaJ Chaperone protein DnaJ Fusobacterium nucleatum subsp. polymorphum
Q6GGC1 2.42e-106 320 47 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain MRSA252)
P63972 3.62e-106 320 47 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain MW2)
A8Z4B8 3.62e-106 320 47 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8Y8 3.62e-106 320 47 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain MSSA476)
P63971 3.62e-106 320 47 6 380 1 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain N315)
P63970 3.62e-106 320 47 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHC2 3.62e-106 320 47 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain Newman)
Q5HFI1 3.62e-106 320 47 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain COL)
A5ITA7 3.62e-106 320 47 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain JH9)
Q2FXZ3 3.62e-106 320 47 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGE4 3.62e-106 320 47 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain USA300)
A6U251 3.62e-106 320 47 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain JH1)
A7X2Y0 3.62e-106 320 47 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q73Q15 3.95e-106 320 45 5 372 3 dnaJ Chaperone protein DnaJ Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P0CW06 5.68e-106 320 46 5 352 3 dnaJ Chaperone protein DnaJ Methanosarcina mazei
P0CW07 5.68e-106 320 46 5 352 3 dnaJ Chaperone protein DnaJ Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8RH03 7.51e-106 319 46 5 369 3 dnaJ Chaperone protein DnaJ Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A5N6M3 1.11e-105 318 47 3 357 3 dnaJ Chaperone protein DnaJ Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
P30725 1.49e-105 318 48 4 382 2 dnaJ Chaperone protein DnaJ Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A0AIS3 1.55e-105 318 49 5 381 3 dnaJ Chaperone protein DnaJ Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q316U7 2e-105 318 47 1 349 3 dnaJ Chaperone protein DnaJ Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A1V9Q3 7.51e-105 316 48 2 351 3 dnaJ Chaperone protein DnaJ Nitratidesulfovibrio vulgaris (strain DP4)
Q725M6 7.51e-105 316 48 2 351 3 dnaJ Chaperone protein DnaJ Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q9KD71 1.43e-104 315 50 5 378 3 dnaJ Chaperone protein DnaJ Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q6MNG0 1.76e-104 315 45 3 359 3 dnaJ Chaperone protein DnaJ Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q9UXR9 2.3e-104 315 45 9 394 3 dnaJ Chaperone protein DnaJ Methanosarcina thermophila
C0ZB49 2.89e-104 315 48 6 378 3 dnaJ Chaperone protein DnaJ Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A6LRN5 3.51e-104 315 47 3 374 3 dnaJ Chaperone protein DnaJ Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P45555 5.53e-104 314 47 6 380 3 dnaJ Chaperone protein DnaJ Staphylococcus aureus
Q8DWH2 1.55e-103 313 47 6 384 3 dnaJ Chaperone protein DnaJ Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A9HEA1 1.62e-103 313 52 5 376 3 dnaJ Chaperone protein DnaJ Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q71ZJ8 2.98e-103 312 49 5 381 3 dnaJ Chaperone protein DnaJ Listeria monocytogenes serotype 4b (strain F2365)
C1KVB9 2.98e-103 312 49 5 381 3 dnaJ Chaperone protein DnaJ Listeria monocytogenes serotype 4b (strain CLIP80459)
B8DE39 4.55e-103 312 49 5 381 3 dnaJ Chaperone protein DnaJ Listeria monocytogenes serotype 4a (strain HCC23)
Q92BN9 4.55e-103 312 49 5 381 3 dnaJ Chaperone protein DnaJ Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5M6D0 7.25e-103 311 48 7 385 3 dnaJ Chaperone protein DnaJ Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M1T7 7.25e-103 311 48 7 385 3 dnaJ Chaperone protein DnaJ Streptococcus thermophilus (strain CNRZ 1066)
Q49Y21 1.58e-102 310 46 5 381 3 dnaJ Chaperone protein DnaJ Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P0DJM1 1.69e-102 310 49 5 381 3 dnaJ Chaperone protein DnaJ Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
G2K045 1.69e-102 310 49 5 381 3 dnaJ Chaperone protein DnaJ Listeria monocytogenes serotype 1/2a (strain 10403S)
Q044A8 1.85e-102 311 44 6 389 3 dnaJ Chaperone protein DnaJ Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q253T6 2.84e-102 310 45 4 397 3 dnaJ Chaperone protein DnaJ Chlamydia felis (strain Fe/C-56)
Q74IT7 3.04e-102 310 45 6 389 3 dnaJ Chaperone protein DnaJ Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A5UYW4 1.79e-101 307 44 4 355 3 dnaJ Chaperone protein DnaJ Roseiflexus sp. (strain RS-1)
Q8E298 2.78e-101 307 47 4 381 3 dnaJ Chaperone protein DnaJ Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7Q7 3.16e-101 307 47 4 381 3 dnaJ Chaperone protein DnaJ Streptococcus agalactiae serotype III (strain NEM316)
Q3K3T1 3.32e-101 307 48 6 380 3 dnaJ Chaperone protein DnaJ Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B9DNJ9 3.42e-101 307 46 5 380 3 dnaJ Chaperone protein DnaJ Staphylococcus carnosus (strain TM300)
Q9Z9E9 4.13e-101 307 44 3 394 3 dnaJ Chaperone protein DnaJ Chlamydia pneumoniae
Q823T2 5.25e-101 307 44 3 394 3 dnaJ Chaperone protein DnaJ Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q73IV4 6.44e-101 306 47 5 349 3 dnaJ Chaperone protein DnaJ Wolbachia pipientis wMel
Q6ME07 6.78e-101 306 44 4 389 3 dnaJ Chaperone protein DnaJ Protochlamydia amoebophila (strain UWE25)
Q1G9R3 2.93e-100 305 46 6 379 3 dnaJ Chaperone protein DnaJ Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q049W7 3.37e-100 305 46 6 379 3 dnaJ Chaperone protein DnaJ Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
C6BYN5 6.01e-100 304 45 2 353 3 dnaJ Chaperone protein DnaJ Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q7UM96 7.74e-100 304 45 6 388 3 dnaJ Chaperone protein DnaJ Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q84BU3 8.32e-100 304 45 6 384 3 dnaJ Chaperone protein DnaJ Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q3AF07 1.27e-99 303 49 5 359 3 dnaJ Chaperone protein DnaJ Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
C4L424 3.5e-99 301 49 8 377 3 dnaJ Chaperone protein DnaJ Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q835R5 7.81e-99 301 45 5 386 3 dnaJ Chaperone protein DnaJ Enterococcus faecalis (strain ATCC 700802 / V583)
Q8L397 2.66e-98 299 43 5 381 3 dnaJ Chaperone protein DnaJ Acholeplasma laidlawii
Q8DKR7 8.46e-98 298 46 3 349 3 dnaJ Chaperone protein DnaJ Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A7NS65 8.48e-98 298 42 4 361 3 dnaJ Chaperone protein DnaJ Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B2TLZ8 8.55e-98 298 45 5 380 3 dnaJ Chaperone protein DnaJ Clostridium botulinum (strain Eklund 17B / Type B)
B2V2I6 1.15e-97 298 45 5 380 3 dnaJ Chaperone protein DnaJ Clostridium botulinum (strain Alaska E43 / Type E3)
B2G6W4 3.17e-97 297 45 6 387 3 dnaJ Chaperone protein DnaJ Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VJE8 3.17e-97 297 45 6 387 3 dnaJ Chaperone protein DnaJ Limosilactobacillus reuteri (strain DSM 20016)
O87778 2.51e-96 295 47 5 378 2 dnaJ Chaperone protein DnaJ Latilactobacillus sakei
Q38W94 2.99e-96 295 47 5 378 3 dnaJ Chaperone protein DnaJ Latilactobacillus sakei subsp. sakei (strain 23K)
Q45552 3.65e-96 294 46 11 389 3 dnaJ Chaperone protein DnaJ Geobacillus stearothermophilus
Q8NLY8 8.3e-96 294 42 8 390 3 dnaJ2 Chaperone protein DnaJ 2 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q5YNI2 2.57e-95 292 45 3 364 3 dnaJ2 Chaperone protein DnaJ 2 Nocardia farcinica (strain IFM 10152)
B0CAZ0 3.7e-95 291 43 6 362 3 dnaJ Chaperone protein DnaJ Acaryochloris marina (strain MBIC 11017)
A1BHL1 8.7e-95 291 40 5 396 3 dnaJ Chaperone protein DnaJ Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B9DVF2 1.27e-94 290 46 4 382 3 dnaJ Chaperone protein DnaJ Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q6A662 1.52e-94 290 43 8 365 3 dnaJ2 Chaperone protein DnaJ 2 Cutibacterium acnes (strain DSM 16379 / KPA171202)
B5YAR4 1.77e-94 290 47 11 390 3 dnaJ Chaperone protein DnaJ Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
O33529 1.89e-94 285 62 2 235 3 dnaJ Chaperone protein DnaJ (Fragment) Rhizobium leguminosarum
Q93R26 3.2e-94 290 45 7 386 3 dnaJ Chaperone protein DnaJ Tetragenococcus halophilus
P0C0B5 3.21e-94 289 48 4 382 3 dnaJ Chaperone protein DnaJ Streptococcus pyogenes
Q02VR5 4.34e-94 289 45 4 362 3 dnaJ Chaperone protein DnaJ Lactococcus lactis subsp. cremoris (strain SK11)
Q8NZM7 5.34e-94 289 47 4 382 3 dnaJ Chaperone protein DnaJ Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XAD7 5.34e-94 289 47 4 382 3 dnaJ Chaperone protein DnaJ Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DA71 5.89e-94 288 47 4 382 3 dnaJ Chaperone protein DnaJ Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DA70 5.89e-94 288 47 4 382 3 dnaJ Chaperone protein DnaJ Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0C0B6 5.89e-94 288 47 4 382 3 dnaJ Chaperone protein DnaJ Streptococcus pyogenes serotype M1
A2RP20 9.47e-94 288 45 4 362 3 dnaJ Chaperone protein DnaJ Lactococcus lactis subsp. cremoris (strain MG1363)
Q114R3 4.35e-93 286 43 7 358 3 dnaJ Chaperone protein DnaJ Trichodesmium erythraeum (strain IMS101)
Q93Q66 4.5e-93 286 45 4 362 3 dnaJ Chaperone protein DnaJ Lactococcus lactis subsp. cremoris
P35514 5.18e-93 286 46 4 362 3 dnaJ Chaperone protein DnaJ Lactococcus lactis subsp. lactis (strain IL1403)
Q03FR6 7e-93 286 48 5 374 3 dnaJ Chaperone protein DnaJ Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q3B2T5 8.4e-93 286 44 4 382 3 dnaJ Chaperone protein DnaJ Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B0S1F7 9.5e-93 285 39 5 382 3 dnaJ Chaperone protein DnaJ Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q7M9T3 2.95e-92 284 41 6 363 3 dnaJ Chaperone protein DnaJ Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8CWT2 3.09e-92 284 45 4 379 3 dnaJ Chaperone protein DnaJ Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
C0R562 5.26e-92 283 47 5 349 3 dnaJ Chaperone protein DnaJ Wolbachia sp. subsp. Drosophila simulans (strain wRi)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15445
Feature type CDS
Gene dnaJ
Product molecular chaperone DnaJ
Location 76957 - 78096 (strand: 1)
Length 1140 (nucleotides) / 379 (amino acids)

Contig

Accession term accessions NZ_VXKB01000005 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_182
Orthogroup size 9
N. genomes 7

Actions

Genomic region

Domains

PF00226 DnaJ domain
PF00684 DnaJ central domain
PF01556 DnaJ C terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0484 Posttranslational modification, protein turnover, chaperones (O) O DnaJ-class molecular chaperone with C-terminal Zn finger domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03686 molecular chaperone DnaJ - -

Protein Sequence

MAKKDYYEVLGVSKSADEKEIKKAYKRLAMKYHPDRNQGDKGAEDQFKEVKEAYEILIDSQKRAAYDQYGHAAFEQGGMGGGGQGGGFGGADFGDIFGDVFGDIFGGGRRQQRASRGADLRYSIELTLEEAVRGVTKEIRIPTLETCDKCHGSGAKEGTDPQTCPTCHGMGQVQMRQGFFAVQQACPTCQGRGQIIKDPCSKCHGHGRVERYKTLSVKIPAGMDSGDRIRLTGEGEAGEMGAPAGDLYVEVHVRQHNIFEREGSNLYCEVPIGFSVAALGGEIEVPTLDGRVKLKIPAETQTGKQFRMKGKGVRPARGGMQGDLMCRVVVETPVKLSEKQKELLREFGESVEGQSGHNNSPKAKRFLDGVKKFFDDLTK

Flanking regions ( +/- flanking 50bp)

CGTTGAGGAAACTCTGCGCCCGTGTGCGTGTGTGTTAAGGGACAAAACGGATGGCAAAAAAAGATTACTACGAGGTGTTGGGCGTCTCTAAATCAGCAGATGAAAAAGAGATTAAAAAAGCCTATAAACGCCTTGCGATGAAATATCACCCTGACCGTAATCAGGGCGATAAAGGCGCAGAAGATCAATTCAAAGAAGTTAAAGAAGCTTACGAAATTCTCATCGACAGCCAGAAGCGTGCAGCGTATGACCAGTATGGTCATGCAGCATTTGAACAAGGCGGTATGGGCGGAGGCGGACAAGGCGGCGGTTTCGGCGGTGCAGATTTCGGTGATATTTTTGGTGACGTCTTCGGTGATATTTTTGGTGGCGGACGCCGTCAGCAACGTGCATCGCGCGGGGCAGACCTGCGTTACAGCATAGAGCTGACACTGGAAGAAGCGGTTCGTGGTGTGACCAAAGAGATCCGTATTCCGACGCTGGAAACCTGTGATAAATGCCACGGCAGCGGCGCGAAAGAAGGCACTGATCCACAGACGTGTCCGACCTGTCATGGTATGGGCCAGGTGCAGATGCGCCAGGGGTTCTTTGCGGTTCAGCAGGCGTGTCCGACGTGTCAGGGACGCGGTCAGATTATCAAAGATCCGTGCAGCAAATGCCATGGTCATGGTCGTGTTGAGCGCTATAAAACCTTGTCAGTCAAAATTCCGGCAGGGATGGACAGCGGTGACCGTATCCGTCTGACCGGTGAAGGTGAAGCAGGCGAAATGGGGGCACCGGCGGGCGATCTGTACGTTGAAGTCCACGTTCGTCAGCATAATATCTTTGAGCGTGAAGGCAGCAACCTCTATTGCGAAGTGCCGATTGGTTTTTCCGTTGCAGCACTGGGCGGTGAAATTGAAGTACCGACACTGGACGGGCGCGTTAAGCTCAAAATACCGGCTGAAACCCAGACCGGTAAGCAGTTCCGCATGAAAGGCAAAGGTGTCAGACCTGCGCGCGGCGGAATGCAGGGCGACCTGATGTGCCGTGTTGTGGTCGAAACCCCGGTTAAACTGAGCGAAAAACAGAAAGAACTGTTACGTGAGTTCGGTGAGTCGGTGGAAGGCCAGAGTGGTCACAACAACAGCCCGAAAGCGAAACGCTTCCTTGACGGGGTGAAAAAATTCTTTGATGACCTGACGAAGTAAGTCAGCTTCATATAAGAACTGAACCGGCCGGAATACTCTTTCCGGCCGGT