Homologs in group_1138

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06515 FBDBKF_06515 90.7 Morganella morganii S1 yaaA peroxide stress protein YaaA
EHELCC_09560 EHELCC_09560 90.7 Morganella morganii S2 yaaA peroxide stress protein YaaA
NLDBIP_09940 NLDBIP_09940 90.7 Morganella morganii S4 yaaA peroxide stress protein YaaA
LHKJJB_07815 LHKJJB_07815 90.7 Morganella morganii S3 yaaA peroxide stress protein YaaA
HKOGLL_07365 HKOGLL_07365 90.7 Morganella morganii S5 yaaA peroxide stress protein YaaA
PMI_RS00025 PMI_RS00025 74.3 Proteus mirabilis HI4320 yaaA peroxide stress protein YaaA

Distribution of the homologs in the orthogroup group_1138

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1138

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A9R023 5.69e-150 421 77 0 257 3 YpAngola_A0805 UPF0246 protein YpAngola_A0805 Yersinia pestis bv. Antiqua (strain Angola)
B2K3L4 5.69e-150 421 77 0 257 3 YPTS_0629 UPF0246 protein YPTS_0629 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q66ET6 5.69e-150 421 77 0 257 3 YPTB0605 UPF0246 protein YPTB0605 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZIN3 5.69e-150 421 77 0 257 3 YPO0462 UPF0246 protein YPO0462/y3714/YP_3720 Yersinia pestis
Q1C0K7 5.69e-150 421 77 0 257 3 YPA_4054 UPF0246 protein YPA_4054 Yersinia pestis bv. Antiqua (strain Antiqua)
B1JL10 5.69e-150 421 77 0 257 3 YPK_3600 UPF0246 protein YPK_3600 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FMF0 5.69e-150 421 77 0 257 3 YpsIP31758_3473 UPF0246 protein YpsIP31758_3473 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q1CMW4 5.69e-150 421 77 0 257 3 YPN_0334 UPF0246 protein YPN_0334 Yersinia pestis bv. Antiqua (strain Nepal516)
A1JJC9 1.88e-148 417 77 0 257 3 YE0603 UPF0246 protein YE0603 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6DF16 9.37e-147 413 78 0 257 3 PC1_3665 UPF0246 protein PC1_3665 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D0B1 1.3e-146 413 77 0 257 3 ECA3888 UPF0246 protein ECA3888 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7N8Z3 5.13e-146 411 77 0 257 3 plu0566 UPF0246 protein plu0566 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8FLD3 2.11e-145 410 76 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MNL4 2.11e-145 410 76 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli O81 (strain ED1a)
B7NHA9 2.11e-145 410 76 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UI51 6.25e-145 409 76 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1IRG7 6.32e-145 409 76 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZVU9 6.32e-145 409 76 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli O9:H4 (strain HS)
Q8XA76 6.32e-145 409 76 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli O157:H7
B5YYA0 7.05e-145 409 76 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q3Z608 8.49e-145 408 76 0 257 3 yaaA UPF0246 protein YaaA Shigella sonnei (strain Ss046)
B7M0A3 1.14e-144 408 76 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli O8 (strain IAI1)
B7L4D1 1.44e-144 408 76 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli (strain 55989 / EAEC)
A7ZH96 1.44e-144 408 76 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0TLY2 2.49e-144 407 75 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q32KB2 2.87e-144 407 75 0 257 3 yaaA UPF0246 protein YaaA Shigella dysenteriae serotype 1 (strain Sd197)
B7N7N1 4.25e-144 406 75 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q1RGJ7 4.39e-144 406 75 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli (strain UTI89 / UPEC)
Q326L6 5.07e-144 406 75 0 257 3 yaaA UPF0246 protein YaaA Shigella boydii serotype 4 (strain Sb227)
B2U221 5.07e-144 406 75 0 257 3 yaaA UPF0246 protein YaaA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P0A8I4 1.14e-143 405 75 0 257 3 yaaA UPF0246 protein YaaA Shigella flexneri
P0A8I3 1.14e-143 405 75 0 257 1 yaaA DNA-binding and peroxide stress resistance protein YaaA Escherichia coli (strain K12)
A1A759 1.14e-143 405 75 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli O1:K1 / APEC
B1XBD1 1.14e-143 405 75 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli (strain K12 / DH10B)
C4ZPT3 1.14e-143 405 75 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli (strain K12 / MC4100 / BW2952)
B7M9R9 1.14e-143 405 75 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LFT7 2.48e-143 404 75 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli (strain SMS-3-5 / SECEC)
B6HZ03 3.34e-143 404 75 0 257 3 yaaA UPF0246 protein YaaA Escherichia coli (strain SE11)
Q0T8I2 4.02e-143 404 75 0 257 3 yaaA UPF0246 protein YaaA Shigella flexneri serotype 5b (strain 8401)
B4F2V1 1.12e-141 400 74 1 258 3 PMI0005 UPF0246 protein PMI0005 Proteus mirabilis (strain HI4320)
Q8Z9R5 4.13e-141 399 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella typhi
A7MIJ5 1.5e-140 397 72 0 257 3 ESA_03332 UPF0246 protein ESA_03332 Cronobacter sakazakii (strain ATCC BAA-894)
Q8ZS17 2.14e-140 397 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BLH1 2.14e-140 397 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella paratyphi A (strain AKU_12601)
C0Q4E5 2.14e-140 397 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella paratyphi C (strain RKS4594)
A9MXH3 2.14e-140 397 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PDM7 2.14e-140 397 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T6C8 2.14e-140 397 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella newport (strain SL254)
B4TIA6 2.14e-140 397 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella heidelberg (strain SL476)
B5RF01 2.14e-140 397 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R5H7 2.14e-140 397 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella enteritidis PT4 (strain P125109)
B5FH99 2.14e-140 397 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella dublin (strain CT_02021853)
Q57TQ0 2.14e-140 397 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella choleraesuis (strain SC-B67)
B4TVY7 2.41e-140 397 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella schwarzengrund (strain CVM19633)
A8G9K2 2.46e-140 397 74 0 257 3 Spro_0686 UPF0246 protein Spro_0686 Serratia proteamaculans (strain 568)
B5F6C4 2.84e-140 397 74 0 257 3 yaaA UPF0246 protein YaaA Salmonella agona (strain SL483)
A9MR84 5.78e-139 394 73 0 257 3 yaaA UPF0246 protein YaaA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8ALV0 1.54e-138 392 72 0 257 3 CKO_03380 UPF0246 protein CKO_03380 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B2VGR2 1.87e-138 392 72 0 256 3 ETA_07010 UPF0246 protein ETA_07010 Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4W6C5 2.27e-138 392 72 0 257 3 Ent638_0568 UPF0246 protein Ent638_0568 Enterobacter sp. (strain 638)
C5B7K7 5.27e-137 389 74 2 256 3 NT01EI_0662 UPF0246 protein NT01EI_0662 Edwardsiella ictaluri (strain 93-146)
B5Y250 1.34e-136 387 71 0 257 3 KPK_4750 UPF0246 protein KPK_4750 Klebsiella pneumoniae (strain 342)
A0A0H3GRF3 3.04e-136 387 72 0 257 3 yaaA DNA-binding and peroxide stress resistance protein YaaA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
A6T4E6 3.04e-136 387 72 0 257 3 KPN78578_00060 UPF0246 protein KPN78578_00060 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q6LUP1 3.57e-136 387 70 0 257 3 PBPRA0561 UPF0246 protein PBPRA0561 Photobacterium profundum (strain SS9)
B7LWR4 1.08e-133 380 71 0 257 3 yaaA UPF0246 protein YaaA Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q7MNQ6 3.65e-133 379 66 0 257 3 VV0659 UPF0246 protein VV0659 Vibrio vulnificus (strain YJ016)
Q8DEQ1 1.55e-132 377 66 0 257 3 VV1_0535 UPF0246 protein VV1_0535 Vibrio vulnificus (strain CMCP6)
Q2NVZ3 9.24e-131 373 69 0 257 3 SG0407 UPF0246 protein SG0407 Sodalis glossinidius (strain morsitans)
Q87SC0 9.32e-131 373 66 0 257 3 VP0504 UPF0246 protein VP0504 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A5F5T1 1.83e-130 372 66 0 257 3 VC0395_A1934 UPF0246 protein VC0395_A1934/VC395_2470 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KPL2 1.83e-130 372 66 0 257 3 VC_2355 UPF0246 protein VC_2355 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
C3LQC7 1.83e-130 372 66 0 257 3 VCM66_2278 UPF0246 protein VCM66_2278 Vibrio cholerae serotype O1 (strain M66-2)
B7VJ56 3.51e-130 371 66 0 257 3 VS_0505 UPF0246 protein VS_0505 Vibrio atlanticus (strain LGP32)
A0KPC2 1.84e-127 364 67 0 256 3 AHA_3667 UPF0246 protein AHA_3667 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q4KHX7 7.58e-127 363 67 0 254 3 PFL_1025 UPF0246 protein PFL_1025 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A4SRS3 1.12e-124 357 65 0 256 3 ASA_3634 UPF0246 protein ASA_3634 Aeromonas salmonicida (strain A449)
C4LCN2 1.39e-124 357 64 0 256 3 Tola_0968 UPF0246 protein Tola_0968 Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q3KHQ2 1.95e-124 357 65 0 254 3 Pfl01_0961 UPF0246 protein Pfl01_0961 Pseudomonas fluorescens (strain Pf0-1)
B6EKX9 3.56e-124 356 64 0 257 3 VSAL_I2547 UPF0246 protein VSAL_I2547 Aliivibrio salmonicida (strain LFI1238)
Q9CPH5 1.57e-122 352 65 0 254 3 PM0066 UPF0246 protein PM0066 Pasteurella multocida (strain Pm70)
A6V1Q6 4.58e-121 348 64 0 254 3 PSPA7_1607 UPF0246 protein PSPA7_1607 Pseudomonas aeruginosa (strain PA7)
A4XR34 8.64e-121 347 65 0 256 3 Pmen_1032 UPF0246 protein Pmen_1032 Pseudomonas mendocina (strain ymp)
Q88NC3 9.13e-121 347 65 0 254 3 PP_1289 UPF0246 protein PP_1289 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5UIC3 9.21e-121 347 64 0 254 3 CGSHiGG_08495 UPF0246 protein CGSHiGG_08495 Haemophilus influenzae (strain PittGG)
A5UD87 1.29e-120 347 64 0 254 3 CGSHiEE_07045 UPF0246 protein CGSHiEE_07045 Haemophilus influenzae (strain PittEE)
Q65VM9 2.21e-120 347 64 0 254 3 MS0374 UPF0246 protein MS0374 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4QLS6 3.28e-120 346 64 0 254 3 NTHI1156 UPF0246 protein NTHI1156 Haemophilus influenzae (strain 86-028NP)
B5FAJ2 4.46e-120 346 62 0 257 3 VFMJ11_2214 UPF0246 protein VFMJ11_2214 Aliivibrio fischeri (strain MJ11)
Q48MI5 7.07e-120 345 64 0 255 3 PSPPH_1119 UPF0246 protein PSPPH_1119 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A1S418 1e-119 345 62 0 257 3 Sama_0917 UPF0246 protein Sama_0917 Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q5E2Z2 1e-119 345 62 0 257 3 VF_2109 UPF0246 protein VF_2109 Aliivibrio fischeri (strain ATCC 700601 / ES114)
P43908 1.01e-119 345 64 0 254 3 HI_0984 UPF0246 protein HI_0984 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q15PR6 1.09e-119 345 64 0 257 3 Patl_3620 UPF0246 protein Patl_3620 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q4ZXK2 1.12e-119 345 64 0 255 3 Psyr_1064 UPF0246 protein Psyr_1064 Pseudomonas syringae pv. syringae (strain B728a)
C3KE01 1.28e-119 345 64 0 254 3 PFLU_0992 UPF0246 protein PFLU_0992 Pseudomonas fluorescens (strain SBW25)
A5W8U6 1.35e-119 345 64 0 254 3 Pput_4436 UPF0246 protein Pput_4436 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B7GZV3 2.36e-119 344 63 0 257 3 ABBFA_001173 UPF0246 protein ABBFA_001173 Acinetobacter baumannii (strain AB307-0294)
B0KGQ1 2.97e-119 343 64 0 254 3 PputGB1_4560 UPF0246 protein PputGB1_4560 Pseudomonas putida (strain GB-1)
B2HUV1 4.94e-119 343 63 0 257 3 ACICU_02469 UPF0246 protein ACICU_02469 Acinetobacter baumannii (strain ACICU)
A6VLV3 6.8e-119 343 64 0 254 3 Asuc_0575 UPF0246 protein Asuc_0575 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0UWA6 7.93e-119 342 63 0 254 3 HSM_1789 UPF0246 protein HSM_1789 Histophilus somni (strain 2336)
A3QBW6 1.15e-118 342 61 0 257 3 Shew_1093 UPF0246 protein Shew_1093 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q887P7 1.69e-118 342 63 0 255 3 PSPTO_1244 UPF0246 protein PSPTO_1244 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4VIR4 1.75e-118 342 62 0 254 3 PST_1170 UPF0246 protein PST_1170 Stutzerimonas stutzeri (strain A1501)
B1J173 2.2e-118 342 64 0 254 3 PputW619_0896 UPF0246 protein PputW619_0896 Pseudomonas putida (strain W619)
Q0I270 2.37e-118 341 63 0 254 3 HS_0482 UPF0246 protein HS_0482 Histophilus somni (strain 129Pt)
Q9HY72 4.62e-118 340 63 0 254 3 PA3539 UPF0246 protein PA3539 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UUV7 4.62e-118 340 63 0 254 3 PLES_14941 UPF0246 protein PLES_14941 Pseudomonas aeruginosa (strain LESB58)
Q47WR5 6.33e-118 340 61 0 256 3 CPS_4102 UPF0246 protein CPS_4102 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B8CSC8 6.33e-118 340 61 0 257 3 swp_3736 UPF0246 protein swp_3736 Shewanella piezotolerans (strain WP3 / JCM 13877)
A3M6Z6 1e-117 340 63 0 257 3 A1S_2267 UPF0246 protein A1S_2267 Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q1I571 1.06e-117 340 64 0 256 3 PSEEN4534 UPF0246 protein PSEEN4534 Pseudomonas entomophila (strain L48)
Q07Z29 1.79e-117 339 61 0 257 3 Sfri_2896 UPF0246 protein Sfri_2896 Shewanella frigidimarina (strain NCIMB 400)
B8F3R6 1.85e-117 339 61 0 257 3 HAPS_0280 UPF0246 protein HAPS_0280 Glaesserella parasuis serovar 5 (strain SH0165)
Q02R10 8.88e-117 337 63 0 254 3 PA14_18590 UPF0246 protein PA14_18590 Pseudomonas aeruginosa (strain UCBPP-PA14)
A8H1G8 5.68e-116 335 61 0 257 3 Spea_1078 UPF0246 protein Spea_1078 Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B8EFD3 1.35e-115 334 59 0 257 3 Sbal223_3241 UPF0246 protein Sbal223_3241 Shewanella baltica (strain OS223)
A9L4U0 1.49e-115 334 59 0 257 3 Sbal195_1149 UPF0246 protein Sbal195_1149 Shewanella baltica (strain OS195)
Q3IG50 6.76e-115 333 62 1 258 3 PSHAa2558 UPF0246 protein PSHAa2558 Pseudoalteromonas translucida (strain TAC 125)
A3D1F9 1.9e-114 331 58 0 256 3 Sbal_1048 UPF0246 protein Sbal_1048 Shewanella baltica (strain OS155 / ATCC BAA-1091)
A6WKC8 6.14e-114 330 58 0 257 3 Shew185_1115 UPF0246 protein Shew185_1115 Shewanella baltica (strain OS185)
B1KIS8 7.8e-114 330 59 0 256 3 Swoo_1284 UPF0246 protein Swoo_1284 Shewanella woodyi (strain ATCC 51908 / MS32)
Q12KL8 9.85e-114 330 60 0 257 3 Sden_2729 UPF0246 protein Sden_2729 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
C1DPC0 3.47e-113 328 63 0 254 3 Avin_11220 UPF0246 protein Avin_11220 Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B0BUG1 4.1e-113 328 60 1 259 3 APJL_0596 UPF0246 protein APJL_0596 Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A1U3K5 4.39e-113 328 62 1 257 3 Maqu_2499 UPF0246 protein Maqu_2499 Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A8FSH6 1.08e-112 327 58 0 257 3 Ssed_1188 UPF0246 protein Ssed_1188 Shewanella sediminis (strain HAW-EB3)
B4RX37 1.11e-112 327 59 0 257 3 MADE_1015435 UPF0246 protein MADE_1015435 Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q6FA99 1.15e-112 327 61 0 257 3 ACIAD2218 UPF0246 protein ACIAD2218 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B3H131 1.32e-112 327 59 1 259 3 APP7_0648 UPF0246 protein APP7_0648 Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0TJA4 2.17e-112 326 59 0 257 3 Shal_1126 UPF0246 protein Shal_1126 Shewanella halifaxensis (strain HAW-EB4)
A3MZW8 2.46e-112 326 59 1 259 3 APL_0602 UPF0246 protein APL_0602 Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A1RMN2 2.62e-112 326 58 0 257 3 Sputw3181_3112 UPF0246 protein Sputw3181_3112 Shewanella sp. (strain W3-18-1)
A4Y498 2.62e-112 326 58 0 257 3 Sputcn32_1053 UPF0246 protein Sputcn32_1053 Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1SZ24 1.66e-111 324 59 0 256 3 Ping_3037 UPF0246 protein Ping_3037 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A0KZZ8 1.45e-110 322 57 0 257 3 Shewana3_3143 UPF0246 protein Shewana3_3143 Shewanella sp. (strain ANA-3)
Q5QVF3 1.93e-110 321 61 0 257 3 IL2146 UPF0246 protein IL2146 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q0HFY3 2.53e-110 321 57 0 257 3 Shewmr4_2963 UPF0246 protein Shewmr4_2963 Shewanella sp. (strain MR-4)
Q8EBH6 1.11e-109 319 56 0 257 3 SO_3540 UPF0246 protein SO_3540 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HS76 1.97e-108 316 56 0 257 3 Shewmr7_3045 UPF0246 protein Shewmr7_3045 Shewanella sp. (strain MR-7)
B2U7L1 4.28e-108 315 57 0 254 3 Rpic_2164 UPF0246 protein Rpic_2164 Ralstonia pickettii (strain 12J)
B4RKH3 6.46e-107 312 57 0 257 3 NGK_0633 UPF0246 protein NGK_0633 Neisseria gonorrhoeae (strain NCCP11945)
Q9JZU5 8.78e-107 312 57 0 257 3 NMB0895 UPF0246 protein NMB0895 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9M441 1.15e-105 309 57 0 257 3 NMCC_0856 UPF0246 protein NMCC_0856 Neisseria meningitidis serogroup C (strain 053442)
Q5F9D8 3e-105 308 56 0 257 3 NGO0461 UPF0246 protein NGO0461 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9JUV9 3.13e-105 308 57 0 257 3 NMA1114 UPF0246 protein NMA1114 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q21E00 1.27e-104 306 57 0 256 3 Sde_3824 UPF0246 protein Sde_3824 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A1KTD5 2.1e-104 306 56 0 257 3 NMC0835 UPF0246 protein NMC0835 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B3PGD6 3.7e-104 305 57 0 256 3 CJA_0191 UPF0246 protein CJA_0191 Cellvibrio japonicus (strain Ueda107)
Q8XXV4 8.13e-104 305 56 0 254 3 RSc2009 UPF0246 protein RSc2009 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1QT18 7.94e-103 302 57 0 256 3 Csal_3046 UPF0246 protein Csal_3046 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A6SXS8 1.56e-102 301 55 0 254 3 mma_1385 UPF0246 protein mma_1385 Janthinobacterium sp. (strain Marseille)
Q5NZF3 3.32e-102 300 56 1 258 3 AZOSEA34360 UPF0246 protein AZOSEA34360 Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
C5BJT4 3.6e-102 300 56 0 256 3 TERTU_4575 UPF0246 protein TERTU_4575 Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q0VPW2 6.1e-102 300 58 0 257 3 ABO_1338 UPF0246 protein ABO_1338 Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A4JGA4 1.26e-101 299 54 1 256 3 Bcep1808_2308 UPF0246 protein Bcep1808_2308 Burkholderia vietnamiensis (strain G4 / LMG 22486)
B2T2H9 6.48e-101 297 54 1 256 3 Bphyt_1375 UPF0246 protein Bphyt_1375 Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A6W1C0 7.89e-101 297 58 2 256 3 Mmwyl1_3597 UPF0246 protein Mmwyl1_3597 Marinomonas sp. (strain MWYL1)
Q47C08 8.87e-101 297 55 0 256 3 Daro_2893 UPF0246 protein Daro_2893 Dechloromonas aromatica (strain RCB)
A9AG13 1.12e-100 296 53 1 256 3 Bmul_1054 UPF0246 protein Bmul_1054/BMULJ_02209 Burkholderia multivorans (strain ATCC 17616 / 249)
A0K8Z7 1.69e-100 296 53 1 256 3 Bcen2424_2223 UPF0246 protein Bcen2424_2223 Burkholderia cenocepacia (strain HI2424)
Q1BV39 1.69e-100 296 53 1 256 3 Bcen_1611 UPF0246 protein Bcen_1611 Burkholderia orbicola (strain AU 1054)
Q39EH1 1.81e-100 296 55 1 256 3 Bcep18194_A5551 UPF0246 protein Bcep18194_A5551 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BDF6 2.51e-100 296 53 1 256 3 Bamb_2261 UPF0246 protein Bamb_2261 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A9IGI5 4.46e-100 295 53 0 254 3 Bpet1601 UPF0246 protein Bpet1601 Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B1YTN1 6.09e-100 295 53 1 256 3 BamMC406_2140 UPF0246 protein BamMC406_2140 Burkholderia ambifaria (strain MC40-6)
Q7NYM4 8.61e-100 294 55 0 257 3 CV_1250 UPF0246 protein CV_1250 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B4EEQ6 9.32e-100 294 54 1 256 3 BceJ2315_22780 UPF0246 protein BceJ2315_22780 Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q2SCX8 1.93e-99 293 54 0 254 3 HCH_04801 UPF0246 protein HCH_04801 Hahella chejuensis (strain KCTC 2396)
Q142D9 5.12e-99 292 53 1 256 3 Bxeno_A1262 UPF0246 protein Bxeno_A1262 Paraburkholderia xenovorans (strain LB400)
B1JVL5 7.85e-99 292 53 1 256 3 Bcenmc03_2247 UPF0246 protein Bcenmc03_2247 Burkholderia orbicola (strain MC0-3)
A1K6P9 1.03e-98 291 55 1 260 3 azo1887 UPF0246 protein azo1887 Azoarcus sp. (strain BH72)
B2JDJ8 1.77e-97 288 52 1 256 3 Bphy_1979 UPF0246 protein Bphy_1979 Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q1LPR2 8.24e-97 287 52 1 257 3 Rmet_0978 UPF0246 protein Rmet_0978 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A1TLC6 5.94e-96 285 54 1 257 3 Aave_1172 UPF0246 protein Aave_1172 Paracidovorax citrulli (strain AAC00-1)
Q473P0 1.96e-95 283 52 1 257 3 Reut_A1014 UPF0246 protein Reut_A1014 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B1XV66 4.06e-95 282 50 0 257 3 Pnec_1068 UPF0246 protein Pnec_1068 Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A4SWV7 7.26e-94 279 50 0 257 3 Pnuc_0753 UPF0246 protein Pnuc_0753 Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A3N7P8 9.24e-94 279 51 1 256 3 BURPS668_1321 UPF0246 protein BURPS668_1321 Burkholderia pseudomallei (strain 668)
A9BNL7 1.28e-93 279 55 2 257 3 Daci_5283 UPF0246 protein Daci_5283 Delftia acidovorans (strain DSM 14801 / SPH-1)
Q2SZK6 4.03e-93 277 51 1 256 3 BTH_I1090 UPF0246 protein BTH_I1090 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A2S430 6.24e-93 277 51 1 256 3 BMA10229_A0708 UPF0246 protein BMA10229_A0708 Burkholderia mallei (strain NCTC 10229)
A1V2P7 6.24e-93 277 51 1 256 3 BMASAVP1_A1161 UPF0246 protein BMASAVP1_A1161 Burkholderia mallei (strain SAVP1)
A3MID2 6.24e-93 277 51 1 256 3 BMA10247_0444 UPF0246 protein BMA10247_0444 Burkholderia mallei (strain NCTC 10247)
Q3JU77 6.24e-93 277 51 1 256 3 BURPS1710b_1467 UPF0246 protein BURPS1710b_1467 Burkholderia pseudomallei (strain 1710b)
A3NTD7 6.24e-93 277 51 1 256 3 BURPS1106A_1330 UPF0246 protein BURPS1106A_1330 Burkholderia pseudomallei (strain 1106a)
Q63VK4 6.24e-93 277 51 1 256 3 BPSL1241 UPF0246 protein BPSL1241 Burkholderia pseudomallei (strain K96243)
Q21VW4 1.48e-92 276 51 0 256 3 Rfer_2372 UPF0246 protein Rfer_2372 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q126C9 4.26e-92 275 52 0 256 3 Bpro_3713 UPF0246 protein Bpro_3713 Polaromonas sp. (strain JS666 / ATCC BAA-500)
A1VS36 5.07e-92 275 52 0 256 3 Pnap_3166 UPF0246 protein Pnap_3166 Polaromonas naphthalenivorans (strain CJ2)
C1DAG4 8.85e-92 274 51 2 256 3 LHK_02295 UPF0246 protein LHK_02295 Laribacter hongkongensis (strain HLHK9)
Q2KWH2 1.94e-91 273 50 0 254 3 BAV2675 UPF0246 protein BAV2675 Bordetella avium (strain 197N)
A1WS74 3.04e-91 273 54 1 255 3 Veis_4789 UPF0246 protein Veis_4789 Verminephrobacter eiseniae (strain EF01-2)
Q7WCP1 2.76e-90 270 51 0 256 3 BB3890 UPF0246 protein BB3890 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W561 2.76e-90 270 51 0 256 3 BPP3440 UPF0246 protein BPP3440 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7VW21 2.76e-90 270 51 0 256 3 BP2452 UPF0246 protein BP2452 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q31F31 3.66e-88 265 51 2 257 3 Tcr_1650 UPF0246 protein Tcr_1650 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B0CDQ3 6.24e-88 264 52 2 255 3 AM1_4276 UPF0246 protein AM1_4276 Acaryochloris marina (strain MBIC 11017)
B8H5B6 4.4e-87 262 51 1 256 3 CCNA_03496 UPF0246 protein CCNA_03496 Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A321 4.4e-87 262 51 1 256 3 CC_3385 UPF0246 protein CC_3385 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
C5CRM0 1.39e-86 261 50 2 258 3 Vapar_1301 UPF0246 protein Vapar_1301 Variovorax paradoxus (strain S110)
A5WD51 7.19e-82 249 49 5 268 3 PsycPRwf_0637 UPF0246 protein PsycPRwf_0637 Psychrobacter sp. (strain PRwf-1)
B1Y847 8.14e-82 249 48 1 254 3 Lcho_2652 UPF0246 protein Lcho_2652 Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A0LCB4 6.75e-81 246 47 0 255 3 Mmc1_3117 UPF0246 protein Mmc1_3117 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q1QDC8 8.63e-81 246 49 3 263 3 Pcryo_0542 UPF0246 protein Pcryo_0542 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A8LNH2 2.92e-80 245 50 1 254 3 Dshi_3333 UPF0246 protein Dshi_3333 Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A2SHK9 5.51e-79 241 48 0 254 3 Mpe_A2092 UPF0246 protein Mpe_A2092 Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q0ARG6 1.77e-77 238 46 1 256 3 Mmar10_0828 UPF0246 protein Mmar10_0828 Maricaulis maris (strain MCS10)
B0T0V2 3.04e-77 237 48 1 254 3 Caul_4480 UPF0246 protein Caul_4480 Caulobacter sp. (strain K31)
A0M4U0 1.01e-76 236 49 2 255 3 GFO_2679 UPF0246 protein GFO_2679 Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A6GXJ8 6.93e-76 233 46 1 254 3 FP0718 UPF0246 protein FP0718 Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
A5FA67 1.79e-75 232 47 1 254 3 Fjoh_4905 UPF0246 protein Fjoh_4905 Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
B4REY7 1.37e-74 231 45 1 252 3 PHZ_c0561 UPF0246 protein PHZ_c0561 Phenylobacterium zucineum (strain HLK1)
Q4FU93 1.53e-74 231 47 4 265 3 Psyc_0554 UPF0246 protein Psyc_0554 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q16D64 5.19e-74 229 48 4 259 3 RD1_0358 UPF0246 protein RD1_0358 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q5LWQ9 9.11e-73 226 46 2 258 3 SPO0106 UPF0246 protein SPO0106 Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B2V479 3.34e-71 221 43 2 256 3 CLH_2088 UPF0246 protein CLH_2088 Clostridium botulinum (strain Alaska E43 / Type E3)
B2TQW1 1.02e-70 220 44 3 256 3 CLL_A2361 UPF0246 protein CLL_A2361 Clostridium botulinum (strain Eklund 17B / Type B)
A4WNG4 9.2e-70 218 45 2 258 3 Rsph17025_0016 UPF0246 protein Rsph17025_0016 Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A3PFN0 9.94e-69 215 45 3 261 3 Rsph17029_0026 UPF0246 protein Rsph17029_0026 Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B9KQL7 1.26e-68 215 45 3 261 3 RSKD131_2757 UPF0246 protein RSKD131_2757 Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q28VA1 1.33e-68 215 45 3 257 3 Jann_0444 UPF0246 protein Jann_0444 Jannaschia sp. (strain CCS1)
Q3IY46 2.2e-68 214 45 3 261 3 RHOS4_29700 UPF0246 protein RHOS4_29700 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B1WY59 3.91e-68 214 41 1 254 3 cce_3295 UPF0246 protein cce_3295 Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q5WWY2 1.34e-67 213 43 1 255 3 lpl1317 UPF0246 protein lpl1317 Legionella pneumophila (strain Lens)
B0TX40 3.1e-67 211 42 2 255 3 Fphi_1075 UPF0246 protein Fphi_1075 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A6LU81 4.74e-67 211 42 3 256 3 Cbei_1739 UPF0246 protein Cbei_1739 Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q5ZVS4 6.46e-66 208 42 1 255 3 lpg1366 UPF0246 protein lpg1366 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IBK8 9.44e-66 207 42 1 255 3 LPC_0782 UPF0246 protein LPC_0782 Legionella pneumophila (strain Corby)
Q5X5K0 6.85e-65 205 42 1 253 3 lpp1320 UPF0246 protein lpp1320 Legionella pneumophila (strain Paris)
A0Q841 9.29e-65 205 42 2 255 3 FTN_1542 UPF0246 protein FTN_1542 Francisella tularensis subsp. novicida (strain U112)
Q2A1Q4 1.82e-64 204 41 2 255 3 FTL_1717 UPF0246 protein FTL_1717 Francisella tularensis subsp. holarctica (strain LVS)
Q0BKF2 1.82e-64 204 41 2 255 3 FTH_1656 UPF0246 protein FTH_1656 Francisella tularensis subsp. holarctica (strain OSU18)
Q5NEE4 3.61e-64 204 41 2 255 3 FTT_1693c UPF0246 protein FTT_1693c Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14FU7 3.61e-64 204 41 2 255 3 FTF1693c UPF0246 protein FTF1693c Francisella tularensis subsp. tularensis (strain FSC 198)
A5VF37 7.81e-64 202 43 2 256 3 Swit_4565 UPF0246 protein Swit_4565 Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B2SFG1 8.14e-64 202 41 2 255 3 FTM_0239 UPF0246 protein FTM_0239 Francisella tularensis subsp. mediasiatica (strain FSC147)
A4IWC7 1.08e-63 202 41 2 255 3 FTW_0267 UPF0246 protein FTW_0267 Francisella tularensis subsp. tularensis (strain WY96-3418)
Q8XIG8 1.33e-63 202 41 3 256 3 CPE2152 UPF0246 protein CPE2152 Clostridium perfringens (strain 13 / Type A)
Q0TNG0 1.96e-63 202 40 1 254 3 CPF_2407 UPF0246 protein CPF_2407 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SR29 4.52e-62 198 40 1 254 3 CPR_2119 UPF0246 protein CPR_2119 Clostridium perfringens (strain SM101 / Type A)
B0BXU8 2.8e-56 183 38 2 255 3 RrIowa_0836 UPF0246 protein RrIowa_0836 Rickettsia rickettsii (strain Iowa)
O68452 2.8e-56 183 38 2 255 3 A1G_03985 UPF0246 protein A1G_03985 Rickettsia rickettsii (strain Sheila Smith)
Q6ARD7 4.76e-56 183 39 6 259 3 DP0358 UPF0246 protein DP0358 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
C4K0C5 1.07e-55 182 38 2 255 3 RPR_00055 UPF0246 protein RPR_00055 Rickettsia peacockii (strain Rustic)
C3PNN8 2.01e-55 181 38 2 255 3 RAF_ORF0648 UPF0246 protein RAF_ORF0648 Rickettsia africae (strain ESF-5)
Q92HL7 7.84e-55 179 38 2 255 3 RC0754 UPF0246 protein RC0754 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q1GD76 8.66e-55 179 40 3 256 3 TM1040_2658 UPF0246 protein TM1040_2658 Ruegeria sp. (strain TM1040)
Q4ULF3 9.35e-53 174 38 5 259 3 RF_0769 UPF0246 protein RF_0769 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1RI57 2.69e-51 171 37 2 254 3 RBE_0876 UPF0246 protein RBE_0876 Rickettsia bellii (strain RML369-C)
A8GVJ9 2.69e-51 171 37 2 254 3 A1I_02510 UPF0246 protein A1I_02510 Rickettsia bellii (strain OSU 85-389)
A6LBC3 9.39e-47 159 36 4 256 3 BDI_1226 UPF0246 protein BDI_1226 Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q8A102 8.77e-45 154 34 3 254 3 BT_3869 UPF0246 protein BT_3869 Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q187D2 9.4e-44 151 34 5 256 3 CD630_18230 UPF0246 protein CD630_18230 Clostridioides difficile (strain 630)
Q036P0 1.91e-43 150 41 8 257 3 LSEI_2080 UPF0246 protein LSEI_2080 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q64P19 5.42e-43 149 35 3 255 3 BF4021 UPF0246 protein BF4021 Bacteroides fragilis (strain YCH46)
Q5L8V7 1.38e-42 148 34 3 255 3 BF3795 UPF0246 protein BF3795 Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
B3W9F8 3.22e-42 147 40 8 257 3 LCABL_22600 UPF0246 protein LCABL_22600 Lacticaseibacillus casei (strain BL23)
A4X915 7.1e-42 147 34 4 258 3 Strop_2927 UPF0246 protein Strop_2927 Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
A6KXG4 3.13e-41 145 33 4 255 3 BVU_0413 UPF0246 protein BVU_0413 Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q03D61 9.15e-39 138 36 5 259 3 PEPE_1842 UPF0246 protein PEPE_1842 Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q251F6 2.92e-37 134 34 6 257 3 DSY0297 UPF0246 protein DSY0297 Desulfitobacterium hafniense (strain Y51)
Q5FI29 4.67e-36 131 35 7 257 3 LBA1843 UPF0246 protein LBA1843 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
C0QD10 6.92e-36 131 33 7 266 3 HRM2_41860 UPF0246 protein HRM2_41860 Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q890D7 2.1e-35 129 37 7 255 3 lp_0089 UPF0246 protein lp_0089 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A5VIT7 3.13e-35 129 35 7 257 3 Lreu_0493 UPF0246 protein Lreu_0493 Limosilactobacillus reuteri (strain DSM 20016)
B2G6B4 3.13e-35 129 35 7 257 3 LAR_0480 UPF0246 protein LAR_0480 Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
Q1WRH7 3.69e-35 129 33 6 259 3 LSL_1719 UPF0246 protein LSL_1719 Ligilactobacillus salivarius (strain UCC118)
Q1G889 4.93e-35 128 34 7 268 3 Ldb2075 UPF0246 protein Ldb2075 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q74HK4 6.64e-34 125 33 7 257 3 LJ_0535 UPF0246 protein LJ_0535 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A8YXF1 7.03e-34 125 33 6 256 3 lhv_1883 UPF0246 protein lhv_1883 Lactobacillus helveticus (strain DPC 4571)
B2GCV4 9.69e-34 125 37 7 257 3 LAF_1150 UPF0246 protein LAF_1150 Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q047Q7 1.31e-33 125 34 7 268 3 LBUL_1917 UPF0246 protein LBUL_1917 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
A9KQM9 7.39e-33 123 30 6 260 3 Cphy_1568 UPF0246 protein Cphy_1568 Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
C4ZHH4 2.57e-31 119 30 7 260 3 EUBREC_1226 UPF0246 protein EUBREC_1226 Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
B0S296 1.13e-27 109 30 9 261 3 FMG_1068 UPF0246 protein FMG_1068 Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q8RI57 2.77e-27 108 27 7 257 3 FN1762 UPF0246 protein FN1762 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q7MUH3 8.21e-25 102 28 5 257 3 PG_1544 UPF0246 protein PG_1544 Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A8AXS8 1.99e-23 98 30 7 255 3 SGO_1307 UPF0246 protein SGO_1307 Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8E2T1 3.23e-20 89 27 6 240 3 gbs2036 UPF0246 protein gbs2036 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYP3 5.46e-20 89 26 6 241 3 SAK_2020 UPF0246 protein SAK_2020 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8DWY0 6.51e-20 89 26 6 241 3 SAG2081 UPF0246 protein SAG2081 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
A3CNN8 2.45e-18 84 29 8 234 3 SSA_1395 UPF0246 protein SSA_1395 Streptococcus sanguinis (strain SK36)
C1CSG8 2.04e-16 79 29 3 176 3 SPT_1488 UPF0246 protein SPT_1488 Streptococcus pneumoniae (strain Taiwan19F-14)
B5E6B3 2.04e-16 79 29 3 176 3 SPG_1474 UPF0246 protein SPG_1474 Streptococcus pneumoniae serotype 19F (strain G54)
Q8DP23 2.04e-16 79 29 3 176 3 spr1405 UPF0246 protein spr1405 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04JK0 2.04e-16 79 29 3 176 3 SPD_1378 UPF0246 protein SPD_1378 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B2IR66 2.1e-16 79 29 3 176 3 SPCG_1533 UPF0246 protein SPCG_1533 Streptococcus pneumoniae (strain CGSP14)
C1C8D9 3.06e-16 79 29 3 176 3 SP70585_1589 UPF0246 protein SP70585_1589 Streptococcus pneumoniae (strain 70585)
Q8EVD7 6.04e-16 78 25 6 217 3 MYPE6270 UPF0246 protein MYPE6270 Malacoplasma penetrans (strain HF-2)
C1CLP7 6.67e-16 77 29 3 176 3 SPP_1571 UPF0246 protein SPP_1571 Streptococcus pneumoniae (strain P1031)
B1ICW8 8.76e-16 77 29 3 176 3 SPH_1662 UPF0246 protein SPH_1662 Streptococcus pneumoniae (strain Hungary19A-6)
Q97PQ6 9.59e-16 77 29 3 176 3 SP_1547 UPF0246 protein SP_1547 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZLE9 2.58e-14 73 28 3 176 3 SPN23F15130 UPF0246 protein SPN23F15130 Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1CFD1 2.58e-14 73 28 3 176 3 SPJ_1454 UPF0246 protein SPJ_1454 Streptococcus pneumoniae (strain JJA)
C0MGA5 5.75e-13 69 24 4 231 3 SZO_18530 UPF0246 protein SZO_18530 Streptococcus equi subsp. zooepidemicus (strain H70)
Q8NZ37 3.55e-12 67 23 6 242 3 spyM18_2163 UPF0246 protein spyM18_2163 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5X9J1 6.11e-12 67 23 6 242 3 M6_Spy1787 UPF0246 protein M6_Spy1787 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A2RGT7 6.88e-12 67 23 6 242 3 SpyM51747 UPF0246 protein SpyM51747 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q48QX8 1.27e-11 66 23 6 236 3 M28_Spy1772 UPF0246 protein M28_Spy1772 Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0DG97 1.79e-11 65 23 7 243 3 SPs1787 UPF0246 protein SPs1787 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DG96 1.79e-11 65 23 7 243 3 SpyM3_1790 UPF0246 protein SpyM3_1790 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B4U0H0 2.07e-11 65 25 3 174 3 Sez_1855 UPF0246 protein Sez_1855 Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0MAQ5 2.11e-11 65 25 3 174 3 SEQ_2141 UPF0246 protein SEQ_2141 Streptococcus equi subsp. equi (strain 4047)
Q99XQ1 2.98e-11 65 23 6 242 3 SPy_2104 UPF0246 protein SPy_2104/M5005_Spy1788 Streptococcus pyogenes serotype M1
Q1J4A6 3.22e-11 65 24 7 235 3 MGAS10750_Spy1880 UPF0246 protein MGAS10750_Spy1880 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q8FP96 4.73e-11 64 28 6 224 3 CE1889 UPF0246 protein CE1889 Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B9DW54 5.35e-11 64 29 4 174 3 SUB1767 UPF0246 protein SUB1767 Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q1JEI8 6.38e-11 63 23 6 236 3 MGAS10270_Spy1856 UPF0246 protein MGAS10270_Spy1856 Streptococcus pyogenes serotype M2 (strain MGAS10270)
B5XIZ3 6.38e-11 63 23 6 236 3 Spy49_1742 UPF0246 protein Spy49_1742 Streptococcus pyogenes serotype M49 (strain NZ131)
Q1J9D8 7.39e-11 63 23 6 234 3 MGAS2096_Spy1821 UPF0246 protein MGAS2096_Spy1821 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1JJI7 7.39e-11 63 23 6 234 3 MGAS9429_Spy1799 UPF0246 protein MGAS9429_Spy1799 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q8DRY6 1.55e-10 63 26 4 183 3 SMU_2070 UPF0246 protein SMU_2070 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5M285 1.22e-07 54 24 6 230 3 stu1967 UPF0246 protein stu1967 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q8NP30 1.8e-07 54 25 7 225 3 Cgl1995 UPF0246 protein Cgl1995/cg2186 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q5LXN3 3.42e-07 53 23 5 230 3 str1967 UPF0246 protein str1967 Streptococcus thermophilus (strain CNRZ 1066)
A4QF02 3.49e-07 53 25 7 225 3 cgR_1824 UPF0246 protein cgR_1824 Corynebacterium glutamicum (strain R)
Q9L016 4.18e-06 50 26 8 232 3 SCO2297 UPF0246 protein SCO2297 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15415
Feature type CDS
Gene yaaA
Product peroxide stress protein YaaA
Location 70226 - 70999 (strand: -1)
Length 774 (nucleotides) / 257 (amino acids)

Contig

Accession term accessions NZ_VXKB01000005 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1138
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03883 Peroxide stress protein YaaA

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3022 Replication, recombination and repair (L) L DNA-binding protein YaaA associated with the oxidative stress response

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K09861 uncharacterized protein - -

Protein Sequence

MLLTISPAKTLDYDSPLTTQRYTQPELLAQSEELMQTCRKLTPADIGSLMHISDKLAGLNAARFGEWQPDFTPENARQAILAFKGDVYTGMQADTFSEADFDFAQQHLRMLSGLYGVLRPLDLMRPYRLEMGTKLVNPRGNNLYTFWGDIITENLNQALAAQGDNVLVNLASDEYFKAVNLKKLDAVMIKPVFLDEKNGKYKVISFYAKKARGLMSRFIIQNRLTQPSQLPDFDLDGYRFDESQSTERELVFTRSEQ

Flanking regions ( +/- flanking 50bp)

TTTGATAGAGTAGACCACATAATGATGAAAACAGACCGGAGCCGACTATTATGCTGCTGACGATTTCCCCTGCCAAAACACTCGACTATGACAGCCCGCTGACCACACAGCGCTATACACAGCCGGAGTTGCTCGCACAATCAGAAGAACTGATGCAAACCTGCCGCAAACTGACCCCGGCGGATATCGGCTCTCTGATGCATATCAGCGATAAACTCGCCGGTCTGAACGCCGCCCGTTTCGGGGAATGGCAGCCGGATTTCACGCCGGAAAATGCGCGCCAGGCGATCCTTGCCTTTAAAGGGGATGTCTACACCGGTATGCAGGCTGATACCTTCAGTGAGGCAGATTTTGATTTTGCCCAGCAGCATCTGCGGATGCTTTCGGGGCTTTACGGTGTGCTGCGCCCGCTGGATTTAATGCGTCCGTACCGCCTGGAAATGGGCACAAAGCTGGTCAATCCGCGCGGAAATAATCTCTATACGTTCTGGGGGGATATCATCACAGAGAATCTCAATCAGGCGCTGGCGGCACAGGGTGATAATGTCCTGGTGAACCTGGCATCTGATGAGTATTTCAAAGCCGTGAATCTGAAGAAACTGGATGCCGTCATGATTAAACCGGTCTTTCTCGATGAGAAAAACGGCAAATACAAAGTGATCAGTTTCTATGCAAAAAAAGCGCGCGGGCTGATGAGCCGCTTTATTATTCAGAACCGCCTGACGCAGCCGTCTCAGTTGCCTGATTTTGACCTGGATGGCTACCGTTTTGATGAAAGTCAGTCCACAGAGCGGGAGCTGGTGTTTACCCGTTCGGAACAGTGATTATCGATTCCGGCATGCAAATTAATAAAAACAGCCGCGCTGATAATTAC