Homologs in group_2310

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17735 FBDBKF_17735 89.0 Morganella morganii S1 yddA ABC-type uncharacterized transport system, permease and ATPase components
EHELCC_09760 EHELCC_09760 89.0 Morganella morganii S2 yddA ABC-type uncharacterized transport system, permease and ATPase components
NLDBIP_10140 NLDBIP_10140 89.0 Morganella morganii S4 yddA ABC-type uncharacterized transport system, permease and ATPase components
LHKJJB_07615 LHKJJB_07615 89.0 Morganella morganii S3 yddA ABC-type uncharacterized transport system, permease and ATPase components
HKOGLL_07165 HKOGLL_07165 89.0 Morganella morganii S5 yddA ABC-type uncharacterized transport system, permease and ATPase components
PMI_RS18435 PMI_RS18435 66.6 Proteus mirabilis HI4320 - ABC transporter ATP-binding protein/permease

Distribution of the homologs in the orthogroup group_2310

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2310

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P31826 3.75e-116 358 35 5 554 1 yddA Inner membrane ABC transporter ATP-binding protein YddA Escherichia coli (strain K12)
Q57335 2.42e-82 271 30 7 536 3 HI_0036 Uncharacterized ABC transporter ATP-binding protein HI_0036 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45221 2.67e-76 255 30 7 543 3 HI_1467 Uncharacterized ABC transporter ATP-binding protein HI_1467 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WQI9 1.38e-71 244 30 10 543 1 bacA Hydrophilic compounds import ATP-binding/permease protein BacA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI8 1.38e-71 244 30 10 543 3 bacA Hydrophilic compounds import ATP-binding/permease protein BacA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q55774 4.35e-63 222 33 5 445 3 sll0182 Uncharacterized ABC transporter ATP-binding protein sll0182 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6NLC1 2.49e-61 218 26 11 634 1 ABCC2 ABC transporter D family member 2, chloroplastic Arabidopsis thaliana
Q94FB9 6.4e-30 129 24 17 553 1 ABCD1 ABC transporter D family member 1 Arabidopsis thaliana
Q94FB9 6.07e-19 94 22 13 555 1 ABCD1 ABC transporter D family member 1 Arabidopsis thaliana
O14678 5.58e-26 115 26 17 500 1 ABCD4 Lysosomal cobalamin transporter ABCD4 Homo sapiens
O89016 1.1e-25 115 25 22 591 1 Abcd4 Lysosomal cobalamin transporter ABCD4 Mus musculus
Q8T8P3 7.28e-25 112 23 17 565 3 abcD2 ABC transporter D family member 2 Dictyostelium discoideum
P16970 1.46e-24 111 25 18 471 1 Abcd3 ATP-binding cassette sub-family D member 3 Rattus norvegicus
P55096 3.77e-24 110 25 18 471 1 Abcd3 ATP-binding cassette sub-family D member 3 Mus musculus
Q9UBJ2 2.86e-23 107 22 16 549 1 ABCD2 ATP-binding cassette sub-family D member 2 Homo sapiens
P28288 5.08e-23 107 24 17 469 1 ABCD3 ATP-binding cassette sub-family D member 3 Homo sapiens
Q61285 8.71e-23 106 22 15 550 1 Abcd2 ATP-binding cassette sub-family D member 2 Mus musculus
Q9QY44 2.27e-22 105 23 17 551 1 Abcd2 ATP-binding cassette sub-family D member 2 Rattus norvegicus
Q54W19 7.18e-21 100 25 11 358 3 abcD1 ABC transporter D family member 1 Dictyostelium discoideum
Q7JUN3 4.07e-20 98 34 5 170 2 Abcd1 ATP-binding cassette sub-family D member 1 Drosophila melanogaster
Q1CJG3 4.44e-19 90 36 8 188 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 4.44e-19 90 36 8 188 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 4.44e-19 90 36 8 188 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AT7 4.79e-19 90 36 8 188 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
P0AFY6 1.23e-18 91 23 9 339 1 sbmA Peptide antibiotic transporter SbmA Escherichia coli (strain K12)
P0AFY7 1.23e-18 91 23 9 339 3 sbmA Peptide antibiotic transporter SbmA Escherichia coli O157:H7
F1RBC8 1.37e-18 93 23 20 576 2 abcd1 ATP-binding cassette sub-family D member 1 Danio rerio
Q54W20 2.48e-18 92 31 6 218 3 abcD3 ABC transporter D family member 3 Dictyostelium discoideum
D3ZHR2 6.77e-18 91 26 7 250 1 Abcd1 ATP-binding cassette sub-family D member 1 Rattus norvegicus
P33897 1.1e-17 90 26 9 272 1 ABCD1 ATP-binding cassette sub-family D member 1 Homo sapiens
A1JRI2 1.44e-17 85 35 7 187 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q08120 2.26e-17 88 23 6 326 3 bacA Bacteroid development protein BacA Rhizobium meliloti (strain 1021)
P41909 2.79e-17 89 33 4 157 1 PXA1 Peroxisomal long-chain fatty acid import protein 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8Z5W6 3.47e-17 84 34 7 187 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
P23886 4.66e-17 88 34 3 192 1 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Escherichia coli (strain K12)
Q1GL85 4.8e-17 84 31 8 195 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q32HA3 4.93e-17 84 33 7 187 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z2L6 5.12e-17 84 33 7 187 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 5.12e-17 84 33 7 187 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 5.12e-17 84 33 7 187 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 5.12e-17 84 33 7 187 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 5.12e-17 84 33 7 187 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 5.12e-17 84 33 7 187 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 5.12e-17 84 33 7 187 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 5.12e-17 84 33 7 187 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q5PIA5 6.07e-17 84 34 7 187 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 6.07e-17 84 34 7 187 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
P48410 6.44e-17 88 25 8 272 1 Abcd1 ATP-binding cassette sub-family D member 1 Mus musculus
Q83KR7 1.32e-16 83 33 7 187 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 1.32e-16 83 33 7 187 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q68W42 1.76e-16 86 28 6 213 3 RT0691 Putative export ATP-binding/permease protein RT0691 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8ZNV7 3.12e-16 82 33 7 187 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9ZCM8 3.39e-16 85 27 6 213 3 RP696 Putative export ATP-binding/permease protein RP696 Rickettsia prowazekii (strain Madrid E)
Q9X2W0 4.26e-16 85 30 6 203 1 mcjD Microcin-J25 export ATP-binding/permease protein McjD Escherichia coli
Q4UMZ3 5.75e-16 84 28 4 198 3 RF_0214 Putative export ATP-binding/permease protein RF_0214 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q6D4A8 8.02e-16 80 34 8 188 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q895C4 8.5e-16 82 31 6 190 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
P45861 1.46e-15 83 32 6 204 1 ywjA Uncharacterized ABC transporter ATP-binding protein YwjA Bacillus subtilis (strain 168)
Q4L8L7 1.59e-15 79 30 6 200 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
Q9LZJ5 1.94e-15 84 29 4 188 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q9LZJ5 5.83e-08 59 24 7 231 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q7DM58 3.55e-15 82 30 4 188 1 ABCC4 ABC transporter C family member 4 Arabidopsis thaliana
Q7DM58 7.62e-09 62 25 6 227 1 ABCC4 ABC transporter C family member 4 Arabidopsis thaliana
Q1QE80 4.1e-15 80 34 9 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q8DQH4 4.39e-15 78 31 6 191 1 ftsE Cell division ATP-binding protein FtsE Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM82 4.39e-15 78 31 6 191 1 ftsE Cell division ATP-binding protein FtsE Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A0LCH8 5.28e-15 78 33 9 215 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q3IWB5 5.97e-15 78 36 7 185 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q92GP9 6.99e-15 81 27 4 198 3 RC1073 Putative export ATP-binding/permease protein RC1073 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q5E6M2 7.35e-15 78 29 6 187 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8T9W2 1.03e-14 80 24 15 431 3 abcB5 ABC transporter B family member 5 Dictyostelium discoideum
P78966 1.32e-14 81 31 5 197 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 5.94e-05 50 27 6 199 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5LUR8 1.34e-14 77 32 7 192 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q21XJ9 1.52e-14 77 36 6 192 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q0K9I2 1.53e-14 78 38 5 181 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1LQF6 1.76e-14 78 33 7 202 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P45171 1.8e-14 79 32 7 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87RE5 1.85e-14 77 30 7 206 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2G2M9 1.88e-14 79 25 14 388 3 SAOUHSC_02003 Putative multidrug export ATP-binding/permease protein SAOUHSC_02003 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GFJ1 1.88e-14 79 25 14 388 3 SAR1956 Putative multidrug export ATP-binding/permease protein SAR1956 Staphylococcus aureus (strain MRSA252)
Q5HEQ8 1.88e-14 79 25 14 388 3 SACOL1924 Putative multidrug export ATP-binding/permease protein SACOL1924 Staphylococcus aureus (strain COL)
Q99T13 1.88e-14 79 25 14 388 1 SAV1866 Putative multidrug export ATP-binding/permease protein SAV1866 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FFM9 1.88e-14 79 25 14 388 3 SAUSA300_1847 Putative multidrug export ATP-binding/permease protein SAUSA300_1847 Staphylococcus aureus (strain USA300)
Q7A0J1 1.88e-14 79 25 14 388 3 MW1806 Putative multidrug export ATP-binding/permease protein MW1806 Staphylococcus aureus (strain MW2)
Q6G868 1.88e-14 79 25 14 388 3 SAS1788 Putative multidrug export ATP-binding/permease protein SAS1788 Staphylococcus aureus (strain MSSA476)
Q7A4T3 1.88e-14 79 25 14 388 1 SA1683 Putative multidrug export ATP-binding/permease protein SA1683 Staphylococcus aureus (strain N315)
Q03EE4 2.19e-14 77 28 7 199 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q4QK57 2.3e-14 78 32 7 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q9KQB8 2.43e-14 76 31 5 197 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P45081 2.61e-14 79 29 3 200 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q92NU9 2.89e-14 79 32 7 198 3 macB Macrolide export ATP-binding/permease protein MacB Rhizobium meliloti (strain 1021)
Q2YU20 3.26e-14 79 26 15 386 3 SAB1799c Putative multidrug export ATP-binding/permease protein SAB1799c Staphylococcus aureus (strain bovine RF122 / ET3-1)
O53645 3.54e-14 79 30 5 210 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O53645 1.07e-09 65 30 4 195 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A1KF14 3.57e-14 79 30 5 210 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A1KF14 1.05e-09 65 30 4 195 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q8NSN2 3.64e-14 77 30 6 205 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q160Y9 4.16e-14 75 31 7 188 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q6FAN3 4.22e-14 77 31 5 200 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8FRX8 4.53e-14 77 28 8 228 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P47705 4.66e-14 76 29 5 202 3 MG467 Putative ABC transporter ATP-binding protein MG467 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P77279 4.77e-14 75 31 5 209 1 fetA Probable iron export ATP-binding protein FetA Escherichia coli (strain K12)
Q03PY5 4.77e-14 76 30 7 195 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q7VNG4 4.81e-14 77 32 6 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q18C09 6.21e-14 76 30 6 203 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q9WXX8 6.31e-14 75 29 4 172 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8DZJ0 6.52e-14 77 32 7 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 6.52e-14 77 32 7 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 6.52e-14 77 32 7 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8LGU1 7.15e-14 79 27 4 190 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q8LGU1 1.76e-07 58 25 4 202 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q46ZU5 8.17e-14 75 36 6 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q73EL7 8.23e-14 76 31 5 192 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
B5X0E4 8.26e-14 78 26 6 283 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
B5X0E4 6.85e-05 49 24 5 198 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
O34677 8.9e-14 74 29 7 203 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q89AJ0 9.15e-14 74 31 5 188 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8XZQ4 9.53e-14 75 35 5 190 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q4KJB2 9.57e-14 77 23 22 590 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q81ZF5 9.61e-14 76 31 5 192 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q6HP89 1.01e-13 76 31 5 192 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
P75110 1.04e-13 76 30 5 202 3 MPN_683 Putative ABC transporter ATP-binding protein MG467 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q0KDG3 1.11e-13 76 33 8 212 3 metN Methionine import ATP-binding protein MetN Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P34230 1.31e-13 77 21 10 424 1 PXA2 Peroxisomal long-chain fatty acid import protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7MKU3 1.63e-13 75 32 9 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 1.63e-13 75 32 9 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
P0A4W5 1.64e-13 77 26 8 345 3 BQ2027_MB1304C Uncharacterized ABC transporter ATP-binding protein Mb1304c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ1 1.64e-13 77 26 8 345 1 Rv1273c Uncharacterized ABC transporter ATP-binding protein Rv1273c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q63GR8 1.68e-13 75 31 5 192 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
P9WQJ0 1.74e-13 77 25 7 345 3 MT1311 Uncharacterized ABC transporter ATP-binding protein MT1311 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q46Y69 1.84e-13 75 34 8 202 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q7MMN0 1.88e-13 73 29 5 187 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 1.88e-13 73 29 5 187 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q67SV5 1.92e-13 75 32 9 231 3 metN Methionine import ATP-binding protein MetN Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q7NQN5 2.02e-13 75 33 6 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1LNM0 2.07e-13 74 36 4 173 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A1URR2 2.09e-13 75 30 7 198 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
A3CMQ7 2.14e-13 75 31 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
A0KPH6 2.31e-13 73 34 6 187 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q13VD7 2.51e-13 75 34 6 200 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q03203 2.55e-13 76 23 9 339 3 nisT Nisin transport ATP-binding protein NisT Lactococcus lactis subsp. lactis
Q6GE75 2.56e-13 72 30 7 208 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MRSA252)
P27675 2.58e-13 73 28 6 203 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q4KC87 2.61e-13 75 37 11 200 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0A4U4 2.92e-13 76 32 3 203 3 msbA ATP-dependent lipid A-core flippase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q87PH3 2.96e-13 75 32 9 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6ME20 3.12e-13 74 32 6 208 3 metN Methionine import ATP-binding protein MetN Protochlamydia amoebophila (strain UWE25)
Q9KS33 3.3e-13 75 30 6 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q0AGF4 3.42e-13 74 34 8 181 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A1B9K8 3.42e-13 73 32 8 189 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q9CP06 3.5e-13 74 30 6 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q2M3G0 3.5e-13 76 30 6 202 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q2M3G0 5.12e-05 50 33 0 72 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q58903 3.52e-13 72 30 6 203 3 MJ1508 Uncharacterized ABC transporter ATP-binding protein MJ1508 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q14Q07 3.59e-13 74 29 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q9PEE7 4.08e-13 75 26 10 333 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain 9a5c)
Q7N545 4.19e-13 73 31 7 187 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q0I4A9 4.22e-13 73 32 5 171 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q4WT65 4.34e-13 76 29 5 194 2 abcB ABC multidrug transporter B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT65 4.3e-10 66 30 8 192 2 abcB ABC multidrug transporter B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q6F0V4 4.51e-13 74 31 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q8NV47 4.83e-13 72 31 7 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MW2)
Q6G6W1 4.83e-13 72 31 7 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MSSA476)
A6QJK1 4.83e-13 72 31 7 203 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Newman)
Q5HDJ6 4.83e-13 72 31 7 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain COL)
Q2FVR1 4.83e-13 72 31 7 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED7 4.83e-13 72 31 7 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain USA300)
P71082 4.91e-13 75 24 13 412 3 ygaD Putative multidrug export ATP-binding/permease protein YgaD Bacillus subtilis (strain 168)
K0E4D9 5.09e-13 75 32 5 193 1 ecdL ABC transporter ecdL Aspergillus rugulosus
K0E4D9 4.32e-08 60 32 5 161 1 ecdL ABC transporter ecdL Aspergillus rugulosus
Q7A3X3 5.11e-13 72 31 7 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain N315)
Q99RR8 5.11e-13 72 31 7 203 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YZ26 5.16e-13 72 30 7 208 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8RI39 5.24e-13 74 33 4 158 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q65UE1 5.47e-13 74 33 10 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0S0X2 5.75e-13 72 34 6 189 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q81IN8 5.75e-13 73 31 5 192 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q0SK28 5.8e-13 72 32 7 214 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q5FA19 5.81e-13 73 33 6 203 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
O85818 5.84e-13 74 31 9 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q1R155 6.05e-13 72 32 8 187 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q65F80 6.3e-13 73 31 6 187 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q2SIN5 6.33e-13 75 30 5 197 3 msbA ATP-dependent lipid A-core flippase Hahella chejuensis (strain KCTC 2396)
Q325N3 6.5e-13 72 32 6 180 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
Q4W575 6.6e-13 73 34 6 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 6.6e-13 73 34 6 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q52815 6.82e-13 72 30 8 205 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q6FFL0 7.16e-13 72 31 5 173 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q1RJ91 7.28e-13 74 27 4 200 3 RBE_0492 Putative export ATP-binding/permease protein RBE_0492 Rickettsia bellii (strain RML369-C)
Q87EF0 7.33e-13 74 25 10 333 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
O34946 7.76e-13 71 27 6 198 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q08D64 8.01e-13 75 26 7 284 2 abcb6 ATP-binding cassette sub-family B member 6 Xenopus tropicalis
Q48CA0 8.04e-13 72 36 4 174 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q0I4C5 8.48e-13 74 26 7 298 3 msbA ATP-dependent lipid A-core flippase Histophilus somni (strain 129Pt)
Q8ELQ6 8.59e-13 73 30 6 201 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q02QT1 8.64e-13 72 37 4 174 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q57538 8.75e-13 74 31 5 197 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8Z7H7 8.88e-13 73 31 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q73P93 8.92e-13 74 28 8 207 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 4.93e-05 49 27 6 196 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P21630 9.33e-13 71 35 5 153 3 braG High-affinity branched-chain amino acid transport ATP-binding protein BraG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4ZLS1 9.5e-13 72 36 4 174 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q5PMK1 1.01e-12 73 31 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q6G2E2 1.01e-12 73 32 9 214 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q6BXD7 1.05e-12 74 26 13 337 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P40790 1.06e-12 73 31 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 1.06e-12 73 31 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q5PB72 1.1e-12 71 27 6 200 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
S3D778 1.12e-12 75 24 6 261 3 gloK ABC transporter gloK Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3D778 4.11e-06 53 25 7 205 3 gloK ABC transporter gloK Glarea lozoyensis (strain ATCC 20868 / MF5171)
Q0P9X7 1.16e-12 71 27 5 204 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q0I3Y9 1.17e-12 73 31 8 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q8DPC2 1.21e-12 73 31 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 1.21e-12 73 31 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 1.21e-12 73 31 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q1QBW0 1.22e-12 74 27 7 244 3 msbA ATP-dependent lipid A-core flippase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
O06967 1.26e-12 74 25 7 278 1 bmrA Multidrug resistance ABC transporter ATP-binding/permease protein BmrA Bacillus subtilis (strain 168)
Q03ZQ0 1.3e-12 73 34 9 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q4JTG9 1.33e-12 73 32 7 203 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q28VN1 1.41e-12 71 28 6 188 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q57QD7 1.44e-12 70 35 6 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q5X627 1.48e-12 72 32 8 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q8X5I6 1.51e-12 71 32 6 181 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q87UN0 1.52e-12 71 32 6 184 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8U648 1.58e-12 71 34 7 202 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4ZZS2 1.75e-12 71 32 9 204 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q3Z542 1.75e-12 71 32 6 180 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q47538 1.75e-12 71 32 6 180 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
Q92UV5 1.78e-12 72 28 8 244 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q6LR20 1.87e-12 72 32 9 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q2YAD6 1.91e-12 72 31 7 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q18KE1 2.03e-12 71 35 6 177 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q4K9A4 2.12e-12 73 31 7 195 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8P8W4 2.17e-12 73 25 10 341 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV65 2.17e-12 73 25 10 341 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain 8004)
Q5ZWE4 2.18e-12 72 32 8 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q6FFZ1 2.19e-12 71 31 7 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P61482 2.22e-12 70 35 6 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61481 2.22e-12 70 35 6 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
Q5PGR6 2.22e-12 70 35 6 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9HYG4 2.29e-12 71 37 4 174 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P37774 2.31e-12 70 30 7 206 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q0RKH4 2.34e-12 70 36 6 186 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
P0DKX6 2.37e-12 73 30 6 206 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
P0DKX5 2.39e-12 73 30 6 206 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q12C33 2.47e-12 73 26 11 330 3 msbA ATP-dependent lipid A-core flippase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q9A9P4 2.48e-12 70 32 9 208 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A1VZQ5 2.49e-12 70 26 5 204 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q87UI3 2.62e-12 70 36 4 174 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q03P57 2.66e-12 72 28 8 204 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q7NWX3 2.9e-12 72 34 5 196 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q5FQN4 2.9e-12 69 38 4 147 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Gluconobacter oxydans (strain 621H)
Q933I3 2.98e-12 73 24 18 453 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia glucosida
Q5P6D5 3.19e-12 72 30 7 199 3 macB Macrolide export ATP-binding/permease protein MacB Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q7RX59 3.31e-12 73 24 15 438 3 fes-4 Iron-sulfur clusters transporter atm1, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q2GFZ6 3.33e-12 70 28 9 194 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q4FS42 3.35e-12 72 28 5 212 3 msbA ATP-dependent lipid A-core flippase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q6LTB1 3.38e-12 70 29 5 182 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q8UBB7 3.51e-12 71 30 6 204 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q32EY4 3.52e-12 71 30 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q9HT73 3.69e-12 70 32 7 188 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 3.69e-12 70 32 7 188 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1M7A6 3.77e-12 70 36 5 169 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q7NZI7 3.88e-12 70 31 8 221 3 pstB Phosphate import ATP-binding protein PstB Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8PUE7 3.89e-12 72 27 5 196 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q00564 4e-12 72 30 7 199 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
Q2UPC0 4.11e-12 72 28 6 230 3 aclQ ABC transporter aclQ Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q1RD28 4.45e-12 71 30 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 4.45e-12 71 30 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q1RFH8 4.47e-12 70 31 6 180 3 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain UTI89 / UPEC)
Q0TKS1 4.47e-12 70 31 6 180 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69877 4.49e-12 71 30 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 4.49e-12 71 30 7 204 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 4.49e-12 71 30 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 4.49e-12 71 30 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 4.49e-12 71 30 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q66FK0 4.56e-12 70 35 6 168 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CE65 4.56e-12 70 35 6 168 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Nepal516)
Q56993 4.56e-12 70 35 6 168 1 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis
Q1C0Q8 4.56e-12 70 35 6 168 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Antiqua)
Q3Z2Z3 4.57e-12 71 30 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 4.57e-12 71 30 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
P44986 4.69e-12 68 32 9 212 1 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8FKF5 4.82e-12 69 31 6 180 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q65UG3 4.92e-12 70 31 9 190 3 znuC Zinc import ATP-binding protein ZnuC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
F9X9V4 5.15e-12 72 29 4 189 3 MYCGRDRAFT_41235 ABC-type transporter MYCGRDRAFT_41235 Zymoseptoria tritici (strain CBS 115943 / IPO323)
F9X9V4 3.03e-05 50 23 3 210 3 MYCGRDRAFT_41235 ABC-type transporter MYCGRDRAFT_41235 Zymoseptoria tritici (strain CBS 115943 / IPO323)
Q1GZI0 5.23e-12 72 26 15 360 3 msbA ATP-dependent lipid A-core flippase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q2LVL0 5.37e-12 72 26 7 238 3 msbA ATP-dependent lipid A-core flippase Syntrophus aciditrophicus (strain SB)
Q04473 5.45e-12 72 27 5 206 3 apxIIIB Toxin RTX-III translocation ATP-binding protein Actinobacillus pleuropneumoniae
Q8FV85 5.51e-12 71 31 7 205 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 5.51e-12 71 31 7 205 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 5.51e-12 71 31 7 205 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 5.51e-12 71 31 7 205 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q38WL5 5.52e-12 70 32 5 186 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q1DDP4 5.59e-12 70 33 7 187 3 metN Methionine import ATP-binding protein MetN Myxococcus xanthus (strain DK1622)
Q21PQ7 5.64e-12 69 30 8 191 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9Z3R9 6.02e-12 70 29 7 198 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q50966 6.08e-12 70 33 8 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q0A9E2 6.14e-12 69 30 6 202 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q5E586 6.25e-12 70 30 8 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q3J1N0 6.35e-12 70 33 6 190 3 metN Methionine import ATP-binding protein MetN Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q54NL1 6.49e-12 72 27 3 195 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q54NL1 6.03e-08 59 25 5 188 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q5WXF0 6.5e-12 70 32 8 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q2ULH4 6.54e-12 72 24 15 436 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q81GC1 6.84e-12 70 27 7 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q48PV0 7.3e-12 69 31 6 184 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q2K4V4 7.34e-12 70 30 5 195 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q0T5R2 7.36e-12 70 30 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q0BH79 7.51e-12 70 32 7 202 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q6MCV4 7.53e-12 70 31 6 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q9SKX0 7.54e-12 72 28 3 189 2 ABCC13 ABC transporter C family member 13 Arabidopsis thaliana
Q9SKX0 4.45e-06 53 23 9 293 2 ABCC13 ABC transporter C family member 13 Arabidopsis thaliana
O07550 7.57e-12 71 27 6 217 1 yheI Probable multidrug resistance ABC transporter ATP-binding/permease protein YheI Bacillus subtilis (strain 168)
A0A125QXJ1 7.59e-12 72 30 5 201 2 ABCB6 ATP-binding cassette sub-family B member 6 Mesocricetus auratus
Q6A6X6 7.69e-12 70 30 6 202 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q1BY14 7.72e-12 70 32 7 203 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 7.72e-12 70 32 7 203 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
B2KWH4 7.75e-12 72 27 4 199 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
B2KWH4 1.37e-06 55 33 0 72 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
A0A0D1CZ63 7.9e-12 72 25 4 259 2 fer6 Multidrug resistance protein fer6 Ustilago maydis (strain 521 / FGSC 9021)
A0A0D1CZ63 2.38e-06 54 29 3 150 2 fer6 Multidrug resistance protein fer6 Ustilago maydis (strain 521 / FGSC 9021)
Q3BTC8 8.02e-12 71 26 9 314 3 msbA ATP-dependent lipid A-core flippase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
O67154 8.05e-12 69 28 5 200 3 pstB Phosphate import ATP-binding protein PstB Aquifex aeolicus (strain VF5)
Q82B58 8.15e-12 71 30 9 211 3 SAV_5847 Putative ABC transporter ATP-binding protein SAV_5847 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82B58 1.7e-06 54 33 6 190 3 SAV_5847 Putative ABC transporter ATP-binding protein SAV_5847 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q981Y8 8.16e-12 68 38 6 176 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q3KCC5 8.23e-12 70 32 7 198 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q9X196 8.66e-12 70 29 4 159 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q0S6U9 8.69e-12 68 33 6 189 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Rhodococcus jostii (strain RHA1)
Q6CYU2 8.74e-12 69 35 6 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q39HM4 8.85e-12 69 30 8 196 3 pstB Phosphate import ATP-binding protein PstB Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9CMG7 8.97e-12 71 28 5 194 3 msbA ATP-dependent lipid A-core flippase Pasteurella multocida (strain Pm70)
Q8YK28 9.36e-12 68 31 7 210 3 phnC3 Phosphonates import ATP-binding protein PhnC 3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O32169 9.46e-12 70 29 6 187 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q483B6 9.65e-12 71 30 5 206 3 msbA1 ATP-dependent lipid A-core flippase 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A3PRY1 9.7e-12 70 32 7 202 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q6XYT0 9.7e-12 69 27 7 229 3 pstB Phosphate import ATP-binding protein PstB Spiroplasma kunkelii
Q2KVS6 9.97e-12 71 31 7 198 3 macB Macrolide export ATP-binding/permease protein MacB Bordetella avium (strain 197N)
Q13LD8 9.99e-12 70 30 7 202 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q9I1C8 1.04e-11 70 32 8 204 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02ME3 1.05e-11 70 32 8 204 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q32IZ6 1.06e-11 68 31 6 180 3 tauB Taurine import ATP-binding protein TauB Shigella dysenteriae serotype 1 (strain Sd197)
Q7N9U4 1.06e-11 68 30 8 197 3 pstB Phosphate import ATP-binding protein PstB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q83F44 1.08e-11 70 30 5 204 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
O80725 1.08e-11 71 29 8 229 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
O80725 1.38e-07 58 26 4 193 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
Q9A502 1.11e-11 69 31 7 203 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q1RGL1 1.12e-11 68 29 7 191 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q8PKS5 1.15e-11 71 25 7 310 3 msbA ATP-dependent lipid A-core flippase Xanthomonas axonopodis pv. citri (strain 306)
Q831K6 1.18e-11 70 31 6 187 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q21WN9 1.23e-11 70 29 4 197 3 msbA ATP-dependent lipid A-core flippase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
P21441 1.26e-11 71 30 5 184 3 PGPA Multidrug resistance protein Leishmania tarentolae
Q9KXJ6 1.27e-11 70 31 9 202 3 SCO2324 Putative ABC transporter ATP-binding protein SCO2324 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P44407 1.28e-11 70 29 5 201 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q31ZH4 1.29e-11 68 33 5 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q3M4H5 1.31e-11 68 28 5 188 3 pstB5 Phosphate import ATP-binding protein PstB 5 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YYE2 1.31e-11 68 28 5 188 3 pstB2 Phosphate import ATP-binding protein PstB 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q65VG9 1.33e-11 69 29 6 197 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q66CI3 1.35e-11 70 29 4 198 3 msbA ATP-dependent lipid A-core flippase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGH0 1.35e-11 70 29 4 198 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGA9 1.35e-11 70 29 4 198 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis
Q1CA68 1.35e-11 70 29 4 198 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Antiqua)
Q4QLQ1 1.35e-11 67 31 9 212 3 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain 86-028NP)
Q0RT43 1.36e-11 68 33 6 188 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q1R5D8 1.38e-11 68 30 7 207 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 1.38e-11 68 30 7 207 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 1.38e-11 68 30 7 207 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q55196 1.38e-11 68 28 7 214 3 pstB1 Phosphate import ATP-binding protein PstB 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q24QI5 1.44e-11 69 30 7 212 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q31VE6 1.44e-11 68 29 7 222 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
A1B9Q7 1.46e-11 69 29 6 208 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
Q4QPI4 1.53e-11 70 30 5 199 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain 86-028NP)
Q2SPI3 1.55e-11 68 30 9 205 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q61102 1.56e-11 70 31 5 199 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Mus musculus
Q1MCN6 1.56e-11 69 29 5 198 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MQ44 1.6e-11 69 31 10 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q88RL1 1.64e-11 68 31 6 184 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q54P13 1.68e-11 71 22 8 288 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
Q54P13 5.54e-05 50 23 3 195 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
A0A0S6XH62 1.68e-11 71 25 6 277 1 frbG ABC-type transporter frbG Fungal sp. (strain No.11243)
A0A0S6XH62 4.01e-07 57 27 6 210 1 frbG ABC-type transporter frbG Fungal sp. (strain No.11243)
Q3Z300 1.7e-11 67 33 5 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 1.7e-11 67 33 5 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 1.7e-11 67 33 5 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 1.7e-11 67 33 5 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q48HD9 1.71e-11 68 29 6 199 3 pstB1 Phosphate import ATP-binding protein PstB 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P59852 1.72e-11 70 27 4 194 1 lagD Lactococcin-G-processing and transport ATP-binding protein LagD Lactococcus lactis subsp. lactis
Q8X4L6 1.72e-11 68 29 7 222 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q49ZT6 1.72e-11 67 28 6 207 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5H0H0 1.73e-11 70 24 6 310 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E7 1.73e-11 70 24 6 310 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8XXB6 1.78e-11 70 29 4 215 3 msbA ATP-dependent lipid A-core flippase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q32EX7 1.81e-11 67 33 6 190 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q8EPK1 1.83e-11 69 29 5 189 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q83MA0 1.87e-11 68 32 5 178 3 tauB Taurine import ATP-binding protein TauB Shigella flexneri
Q3IX40 1.89e-11 69 32 7 198 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q2S3A3 1.96e-11 68 33 6 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salinibacter ruber (strain DSM 13855 / M31)
Q02R79 1.99e-11 69 32 7 180 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q39IE7 2.02e-11 69 32 7 202 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1WSB8 2.03e-11 68 28 8 205 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ligilactobacillus salivarius (strain UCC118)
Q32AQ1 2.07e-11 68 29 7 222 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q54JR2 2.08e-11 70 27 5 190 3 abcC3 ABC transporter C family member 3 Dictyostelium discoideum
Q54JR2 4.64e-06 53 27 4 199 3 abcC3 ABC transporter C family member 3 Dictyostelium discoideum
Q81J16 2.1e-11 68 29 5 198 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q1CI46 2.16e-11 67 35 6 178 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZFR4 2.16e-11 67 35 6 178 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis
Q1C6Q8 2.16e-11 67 35 6 178 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Antiqua)
Q0P9C4 2.2e-11 70 26 4 192 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q704E8 2.24e-11 70 31 5 199 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Rattus norvegicus
Q9HY19 2.3e-11 69 32 7 180 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5FMM1 2.33e-11 67 29 5 183 3 phnC Phosphonates import ATP-binding protein PhnC Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8NR42 2.33e-11 67 34 2 139 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P33594 2.45e-11 67 29 7 222 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
P75957 2.45e-11 67 33 6 190 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q5PFQ7 2.45e-11 69 29 5 192 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8DUF7 2.46e-11 69 32 9 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q1I7I9 2.48e-11 70 31 7 195 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas entomophila (strain L48)
Q8Z8W8 2.5e-11 68 29 5 192 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q63H62 2.53e-11 68 29 5 198 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q9AML4 2.53e-11 67 31 7 196 3 pstB Phosphate import ATP-binding protein PstB Edwardsiella tarda
P37608 2.55e-11 70 22 10 369 3 lcnDR3 Lacticin-481/lactococcin-DR transport/processing ATP-binding protein lcnDR3 Lactococcus lactis subsp. lactis
P97046 2.56e-11 70 27 10 276 3 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. cremoris (strain MG1363)
Q6HPN0 2.58e-11 68 29 5 198 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 2.58e-11 68 29 5 198 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 2.58e-11 68 29 5 198 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
O34362 2.63e-11 69 29 6 191 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 0.000389 47 25 6 196 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q3SJQ8 2.64e-11 67 29 6 197 3 pstB Phosphate import ATP-binding protein PstB Thiobacillus denitrificans (strain ATCC 25259)
Q3KJ31 2.79e-11 70 26 16 404 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain Pf0-1)
Q2KVN7 2.79e-11 67 30 8 198 3 pstB Phosphate import ATP-binding protein PstB Bordetella avium (strain 197N)
Q54BU4 2.83e-11 70 26 5 198 3 abcB1 ABC transporter B family member 1 Dictyostelium discoideum
Q6D4E2 2.83e-11 68 29 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P44785 2.84e-11 68 29 5 197 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q82TL6 2.87e-11 68 33 9 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0BTP1 2.97e-11 68 32 9 197 3 pstB Phosphate import ATP-binding protein PstB Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q3YW48 2.97e-11 67 29 7 207 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q5E0F2 3.02e-11 69 27 4 194 3 msbA ATP-dependent lipid A-core flippase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9NP78 3.07e-11 70 26 3 196 1 ABCB9 ABC-type oligopeptide transporter ABCB9 Homo sapiens
Q8FVT0 3.08e-11 68 29 7 195 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q2YKZ7 3.08e-11 68 29 7 195 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 3.08e-11 68 29 7 195 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q73F67 3.13e-11 67 29 5 198 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q82MV1 3.18e-11 67 33 4 173 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9QYJ4 3.19e-11 70 26 3 196 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Rattus norvegicus
Q663R5 3.37e-11 67 30 6 196 3 pstB2 Phosphate import ATP-binding protein PstB 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CCI2 3.37e-11 67 30 6 196 3 pstB2 Phosphate import ATP-binding protein PstB 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8Z9T1 3.37e-11 67 30 6 196 3 pstB2 Phosphate import ATP-binding protein PstB 2 Yersinia pestis
Q1C0A2 3.37e-11 67 30 6 196 3 pstB2 Phosphate import ATP-binding protein PstB 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q83RS0 3.37e-11 67 32 6 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
A1WXT0 3.39e-11 67 30 6 186 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q88ZJ6 3.46e-11 68 31 10 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
F2RPA4 3.49e-11 70 31 7 205 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RPA4 6.22e-05 50 34 2 73 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
Q7VL52 3.5e-11 69 21 20 607 3 msbA ATP-dependent lipid A-core flippase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A0A059JK44 3.5e-11 70 31 7 205 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JK44 6.17e-05 50 34 2 73 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
Q9NP58 3.51e-11 69 31 6 203 1 ABCB6 ATP-binding cassette sub-family B member 6 Homo sapiens
Q7W8Q6 3.53e-11 67 30 8 198 3 pstB Phosphate import ATP-binding protein PstB Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WMC3 3.53e-11 67 30 8 198 3 pstB Phosphate import ATP-binding protein PstB Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
O15439 3.53e-11 70 30 4 186 1 ABCC4 ATP-binding cassette sub-family C member 4 Homo sapiens
O15439 9.49e-05 49 23 6 200 1 ABCC4 ATP-binding cassette sub-family C member 4 Homo sapiens
Q13ZK7 3.53e-11 68 34 5 173 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
F2Q5G0 3.53e-11 70 31 7 205 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2Q5G0 6.28e-05 50 34 2 73 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
P77265 3.54e-11 69 28 3 198 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Escherichia coli (strain K12)
Q9SYI3 3.55e-11 70 28 5 198 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q9SYI3 1.11e-06 55 26 4 188 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q8FW07 3.55e-11 68 28 5 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella suis biovar 1 (strain 1330)
Q578E9 3.55e-11 68 28 5 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus biovar 1 (strain 9-941)
Q6HLQ9 3.59e-11 68 27 7 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q9FWX7 3.62e-11 70 28 5 198 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q9FWX7 5.04e-09 63 27 4 193 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q4QMH4 3.66e-11 68 29 6 216 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q7VZ66 3.73e-11 67 30 8 198 3 pstB Phosphate import ATP-binding protein PstB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q13W55 3.81e-11 67 29 6 196 3 pstB Phosphate import ATP-binding protein PstB Paraburkholderia xenovorans (strain LB400)
Q9NRK6 3.83e-11 69 24 8 341 1 ABCB10 ATP-binding cassette sub-family B member 10, mitochondrial Homo sapiens
Q6LPK6 3.83e-11 69 30 6 199 3 msbA ATP-dependent lipid A-core flippase Photobacterium profundum (strain SS9)
Q6CYN3 3.91e-11 67 30 6 196 3 pstB2 Phosphate import ATP-binding protein PstB 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P96063 3.91e-11 68 28 7 218 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q63E84 3.93e-11 68 27 7 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 3.93e-11 68 27 7 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 3.93e-11 68 27 7 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q9X0Y8 3.94e-11 67 28 6 188 3 pstB Phosphate import ATP-binding protein PstB Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P91660 4.02e-11 70 28 6 215 2 l(2)03659 Probable multidrug resistance-associated protein lethal(2)03659 Drosophila melanogaster
P91660 1.13e-05 52 24 5 199 2 l(2)03659 Probable multidrug resistance-associated protein lethal(2)03659 Drosophila melanogaster
Q2YKR8 4.06e-11 68 28 5 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus (strain 2308)
Q6N6K5 4.1e-11 67 33 6 186 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q9DC29 4.1e-11 69 29 5 201 1 Abcb6 ATP-binding cassette sub-family B member 6 Mus musculus
Q1IGY7 4.15e-11 67 30 6 184 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q9I190 4.18e-11 69 30 6 194 1 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02MI4 4.18e-11 69 30 6 194 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas aeruginosa (strain UCBPP-PA14)
E7F6F7 4.19e-11 69 27 6 222 3 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Danio rerio
Q63S19 4.2e-11 68 32 6 200 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 4.2e-11 68 32 6 200 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 4.2e-11 68 32 6 200 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
P0CU83 4.22e-11 69 31 7 205 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P0CU83 9.87e-05 49 34 2 73 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q81TH8 4.22e-11 68 27 7 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q046T0 4.42e-11 67 29 5 195 3 phnC Phosphonates import ATP-binding protein PhnC Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q2KYS6 4.52e-11 69 30 4 196 3 msbA ATP-dependent lipid A-core flippase Bordetella avium (strain 197N)
Q8D385 4.61e-11 66 32 2 140 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q7GB25 4.71e-11 69 24 7 284 2 ABCC5 ABC transporter C family member 5 Arabidopsis thaliana
Q2RM86 4.73e-11 67 29 6 194 3 pstB Phosphate import ATP-binding protein PstB Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q0VTB6 4.77e-11 67 33 6 185 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8GDV4 4.77e-11 67 30 7 195 3 pstB Phosphate import ATP-binding protein PstB (Fragment) Heliobacterium mobile
Q5LBT4 4.8e-11 68 27 9 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q9TLX1 4.81e-11 67 27 8 223 3 ycf16 Probable ATP-dependent transporter ycf16 Cyanidium caldarium
Q3AAA4 4.84e-11 67 30 6 195 3 pstB Phosphate import ATP-binding protein PstB Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q4ZRT7 4.95e-11 67 29 6 199 3 pstB1 Phosphate import ATP-binding protein PstB 1 Pseudomonas syringae pv. syringae (strain B728a)
Q880A6 4.95e-11 67 29 6 199 3 pstB1 Phosphate import ATP-binding protein PstB 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4KKK4 5.03e-11 67 31 9 206 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0S0Z3 5.1e-11 67 31 6 200 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q5NQX0 5.15e-11 66 30 5 191 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q46ZM0 5.21e-11 68 30 7 199 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q6D664 5.3e-11 66 33 4 174 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q4WSI1 5.38e-11 69 28 6 202 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WSI1 0.000336 47 25 7 210 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q87R16 5.41e-11 68 28 4 198 3 msbA ATP-dependent lipid A-core flippase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3ZWN4 5.41e-11 66 29 6 198 3 pstB Phosphate import ATP-binding protein PstB Dehalococcoides mccartyi (strain CBDB1)
Q7VR44 5.46e-11 68 27 6 201 3 msbA ATP-dependent lipid A-core flippase Blochmanniella floridana
Q9QYM0 5.68e-11 69 25 8 284 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
Q9QYM0 8.08e-11 68 27 7 229 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
Q9JJ59 5.91e-11 68 26 3 196 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Mus musculus
Q64SQ6 5.92e-11 68 27 9 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q8X5N2 5.95e-11 66 33 5 168 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
A0A0D1BUH6 6.03e-11 69 29 4 200 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
A0A0D1BUH6 3.09e-09 63 29 5 204 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
Q8YCB1 6.05e-11 67 28 5 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q32AY3 6.06e-11 66 33 5 168 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q8FCJ1 6.18e-11 66 33 5 168 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBU8 6.18e-11 66 33 5 168 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q38UT9 6.37e-11 67 28 6 203 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Latilactobacillus sakei subsp. sakei (strain 23K)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15225
Feature type CDS
Gene -
Product ABC transporter ATP-binding protein/permease
Location 28102 - 29802 (strand: -1)
Length 1701 (nucleotides) / 566 (amino acids)

Contig

Accession term accessions NZ_VXKB01000005 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2310
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF06472 ABC transporter transmembrane region 2

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4178 General function prediction only (R) R ABC-type uncharacterized transport system, permease and ATPase components

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02471 vitamin B12/bleomycin/antimicrobial peptide transport system ATP-binding/permease protein ABC transporters -

Protein Sequence

MKTIKHFFWLVKPFWGQRAALFCWFLLLLSLGLTLSSVWFNIRMNQWNGDFYNALQKLDGAALYQLIKFFVILVSGLILVVVLGTYFRQKLAIRWREGMTEQILSRWLSPQSRHYLLRLTAQEPDNPDQRIAEDVRLLVESTLSLLITFLHSLLTLVSFAAILWQLSGSILLSVAGHDWRIDGYMFWACIAYTLVGIALTQLIGGPLRKLNMEKQQREADYRAALITRKQHGDAIAGQRGENQDKQQLLSRFARIAANWNQLIRCERNLSFYTVGYQQVTALAPILFALPKFLAGELMLGGLMQLRQAFSSVATSLGWFIFSYKEIAAWQATVTRLYHFVRLLDNDTTSDITQTNHASVRLEATTDILLQDNTLLLQDISLSLRAGEFAIISGRSGLGKSTLLRTLSGHWPYYRGSIRREQDVLWVPQSVYLPSGTLQSLLAYPLPAAQFTTASYHDVLAAVGLEKLQPQLDVDTDWRQRLSGGEQQRLLFARLLLNKPRLMLLDEVTSALDDDYAIRMIRLLRQRLPDSTILLVSHQRFLQQEADQVIILSAPAATRTSGVSYAL

Flanking regions ( +/- flanking 50bp)

ATTTTTAATCTGAGCATGTGAGCAATGTCTCTTAACTTTATGAATAATAAATGAAAACAATAAAACATTTTTTCTGGTTGGTAAAACCGTTCTGGGGGCAGCGCGCTGCCCTGTTTTGCTGGTTCTTACTGTTACTCTCCCTCGGGCTGACGCTCTCTTCCGTCTGGTTCAATATCCGCATGAACCAGTGGAACGGGGATTTCTATAATGCACTGCAAAAGCTGGACGGCGCAGCGCTGTATCAGCTAATCAAATTCTTTGTGATCCTGGTCAGCGGGCTGATACTCGTGGTGGTGCTCGGCACTTATTTCCGGCAAAAACTGGCTATCCGCTGGCGGGAAGGCATGACAGAGCAGATCCTCAGCCGCTGGTTGTCGCCACAGAGCCGTCACTATCTGCTGCGTCTTACCGCACAGGAGCCGGATAACCCGGATCAGCGTATCGCTGAAGATGTGCGGTTGCTGGTGGAGTCCACACTCAGCCTGCTGATTACCTTTCTGCACTCGCTGCTGACCCTGGTCTCTTTTGCCGCTATTCTCTGGCAGCTTTCCGGCAGCATTTTGCTGTCTGTTGCCGGTCATGACTGGCGGATAGACGGTTATATGTTCTGGGCCTGTATCGCTTATACCCTGGTGGGGATCGCGCTGACACAGCTTATCGGCGGTCCGCTGCGCAAACTGAATATGGAAAAACAGCAGCGCGAAGCGGATTACCGTGCGGCGCTGATCACCCGTAAACAGCATGGTGATGCCATCGCAGGTCAGCGGGGCGAAAACCAGGATAAACAACAATTGCTGTCACGCTTTGCCCGCATCGCGGCAAACTGGAATCAACTGATCCGCTGTGAGCGGAATCTGTCATTCTATACGGTGGGTTATCAGCAGGTTACCGCACTTGCGCCGATCCTGTTTGCACTGCCGAAATTTCTTGCCGGTGAACTGATGCTGGGCGGGCTGATGCAGCTGCGCCAGGCATTCAGCAGTGTTGCCACATCGCTCGGCTGGTTTATTTTTTCCTATAAAGAGATTGCCGCCTGGCAGGCAACCGTGACCCGTTTGTATCATTTTGTCCGTCTGCTGGACAATGACACAACATCTGATATCACGCAGACAAATCACGCCTCTGTACGGCTGGAAGCTACCACTGATATTCTGCTTCAGGACAATACCCTGCTGTTGCAGGATATCTCTCTGTCACTGCGCGCAGGTGAATTTGCCATTATCAGCGGACGCTCCGGTCTGGGGAAATCCACCCTTTTGCGCACCCTGAGCGGGCACTGGCCATATTACCGGGGTTCAATCCGCCGTGAGCAGGATGTGCTGTGGGTTCCGCAATCGGTTTATCTGCCATCAGGCACTCTGCAATCTCTGCTTGCCTATCCGCTGCCGGCGGCACAATTCACAACAGCGTCTTACCATGATGTGCTGGCTGCCGTCGGGCTGGAAAAACTACAGCCACAGCTCGATGTTGATACGGACTGGCGTCAGCGTCTGTCCGGCGGAGAACAACAGCGCCTGCTGTTTGCCCGCCTGTTACTGAATAAACCCCGGCTGATGCTGCTCGATGAAGTGACTTCCGCTTTAGATGATGACTATGCCATCCGCATGATCCGTCTGCTCAGACAGCGCCTGCCTGACAGCACTATTTTACTGGTCAGCCACCAGCGTTTTCTTCAGCAGGAGGCCGATCAGGTGATCATACTCAGCGCCCCTGCCGCAACCCGCACATCAGGAGTCAGTTATGCGTTATAAATTTATTATGGCAGGTGTGGCACTGACCCTTACCGGCTGTGCTGTGGTTA