Homologs in group_1766

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12055 FBDBKF_12055 88.9 Morganella morganii S1 trmH tRNA (guanosine(18)-2'-O)-methyltransferase TrmH
EHELCC_14250 EHELCC_14250 88.9 Morganella morganii S2 trmH tRNA (guanosine(18)-2'-O)-methyltransferase TrmH
NLDBIP_15345 NLDBIP_15345 88.9 Morganella morganii S4 trmH tRNA (guanosine(18)-2'-O)-methyltransferase TrmH
LHKJJB_15265 LHKJJB_15265 88.9 Morganella morganii S3 trmH tRNA (guanosine(18)-2'-O)-methyltransferase TrmH
HKOGLL_14385 HKOGLL_14385 88.9 Morganella morganii S5 trmH tRNA (guanosine(18)-2'-O)-methyltransferase TrmH
PMI_RS14160 PMI_RS14160 68.4 Proteus mirabilis HI4320 trmH tRNA (guanosine(18)-2'-O)-methyltransferase TrmH

Distribution of the homologs in the orthogroup group_1766

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1766

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AGJ4 2.73e-110 319 65 1 226 3 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Shigella flexneri
P0AGJ2 2.73e-110 319 65 1 226 1 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Escherichia coli (strain K12)
P0AGJ3 2.73e-110 319 65 1 226 3 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Escherichia coli O157:H7
Q5SM16 9.82e-56 179 54 1 160 1 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72GI1 9.82e-56 179 54 1 160 1 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
O67577 3.49e-48 160 42 2 190 1 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Aquifex aeolicus (strain VF5)
O51081 2.86e-25 101 31 1 156 3 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q6FF50 1.05e-18 85 36 3 152 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q06753 7.67e-18 82 33 5 157 3 yacO Putative TrmH family tRNA/rRNA methyltransferase YacO Bacillus subtilis (strain 168)
Q8Y016 1.93e-17 81 37 6 156 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q87VK2 5.73e-17 80 36 3 155 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P74261 1.08e-16 80 32 4 158 3 slr1673 Uncharacterized tRNA/rRNA methyltransferase slr1673 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q49V41 1.13e-16 79 32 3 152 3 SSP2224 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q83CW6 1.15e-16 79 34 4 156 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q82XD1 2.88e-16 78 32 5 175 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q9AGT0 4.49e-16 78 30 4 169 3 NWMN_0494 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain Newman)
Q5HIE3 4.49e-16 78 30 4 169 3 SACOL0578 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain COL)
Q7A1Q9 6.88e-16 77 32 3 152 3 MW0487 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain MW2)
Q6GBV6 6.88e-16 77 32 3 152 3 SAS0489 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain MSSA476)
Q6GJD7 6.88e-16 77 32 3 152 3 SAR0535 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain MRSA252)
Q7A794 6.88e-16 77 32 3 152 1 SA0490 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain N315)
Q99W72 6.88e-16 77 32 3 152 3 SAV0531 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q4L3J1 1.37e-15 76 32 3 153 3 SH2477 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus haemolyticus (strain JCSC1435)
Q8CTT9 3.07e-15 75 32 3 149 3 SE_0294 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRM1 3.07e-15 75 32 3 149 3 SERP0172 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q87L11 3.3e-15 75 35 3 162 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9CCW4 3.74e-15 76 31 4 154 3 ML0324 Uncharacterized tRNA/rRNA methyltransferase ML0324 Mycobacterium leprae (strain TN)
B8ZUB0 3.74e-15 76 31 4 154 3 MLBr00324 Uncharacterized tRNA/rRNA methyltransferase MLBr00324 Mycobacterium leprae (strain Br4923)
Q9JUU8 5.22e-15 75 33 4 157 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A4T5L0 6.35e-15 75 30 4 153 3 Mflv_1447 Uncharacterized tRNA/rRNA methyltransferase Mflv_1447 Mycolicibacterium gilvum (strain PYR-GCK)
Q7VTK4 1.04e-14 74 34 5 156 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W7I7 1.04e-14 74 34 5 156 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WKX5 1.04e-14 74 34 5 156 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8EAG8 1.07e-14 74 31 3 160 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q88DE7 2.82e-14 73 34 3 154 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q7VQP0 3.09e-14 73 33 3 151 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Blochmanniella floridana
Q7NYX3 5.48e-14 72 34 4 157 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9JZR3 1.08e-13 71 32 4 157 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q7MH13 1.13e-13 71 35 3 154 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Vibrio vulnificus (strain YJ016)
Q8DCT8 1.13e-13 71 35 3 154 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Vibrio vulnificus (strain CMCP6)
A1TG08 1.49e-13 72 30 4 156 3 Mvan_5337 Uncharacterized tRNA/rRNA methyltransferase Mvan_5337 Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q7MYU6 2.08e-13 70 31 3 160 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P74328 2.52e-13 71 33 3 148 3 slr0955 Uncharacterized tRNA/rRNA methyltransferase slr0955 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9KNY2 2.64e-13 70 34 3 161 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6LM40 2.99e-13 70 33 3 151 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Photobacterium profundum (strain SS9)
B1MGY6 3.13e-13 70 29 4 162 3 MAB_0572 Uncharacterized tRNA/rRNA methyltransferase MAB_0572 Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
B2HJ20 3.5e-13 70 29 4 153 3 MMAR_5079 Uncharacterized tRNA/rRNA methyltransferase MMAR_5079 Mycobacterium marinum (strain ATCC BAA-535 / M)
A0PV26 3.74e-13 70 29 4 153 3 MUL_4155 Uncharacterized tRNA/rRNA methyltransferase MUL_4155 Mycobacterium ulcerans (strain Agy99)
P63180 4.06e-13 69 33 4 156 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Shigella flexneri
P63177 4.06e-13 69 33 4 156 1 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Escherichia coli (strain K12)
P63178 4.06e-13 69 33 4 156 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63179 4.06e-13 69 33 4 156 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Escherichia coli O157:H7
Q6D127 4.64e-13 69 32 3 150 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9RED7 5.17e-13 69 33 5 156 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Burkholderia sp.
Q9HUM8 7.34e-13 69 33 3 151 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8ZIV4 8.58e-13 68 33 5 153 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Yersinia pestis
O51468 1.34e-12 68 25 4 163 3 BB_0516 Uncharacterized tRNA/rRNA methyltransferase BB_0516 Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
A0R557 1.57e-12 68 31 4 153 3 MSMEG_6073 Uncharacterized tRNA/rRNA methyltransferase MSMEG_6073/MSMEI_5913 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0QAB6 2.11e-12 68 28 4 155 3 MAV_0574 Uncharacterized tRNA/rRNA methyltransferase MAV_0574 Mycobacterium avium (strain 104)
Q8ZKA2 2.13e-12 67 31 3 158 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z182 2.22e-12 67 31 3 158 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Salmonella typhi
Q743W2 3.17e-12 68 28 4 155 3 MAP_0479 Uncharacterized tRNA/rRNA methyltransferase MAP_0479 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P44906 7.21e-12 66 32 5 162 1 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9F5K6 1.63e-11 65 32 4 167 1 aviRb 23S rRNA (uridine(2479)-2'-O)-methyltransferase Streptomyces viridochromogenes
P75424 9.66e-11 63 29 5 161 3 MPN_355 Uncharacterized tRNA/rRNA methyltransferase MG252 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q7VP36 2.37e-10 62 31 3 152 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P47494 2.76e-10 62 26 3 157 3 MG252 Uncharacterized tRNA/rRNA methyltransferase MG252 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P94538 6.05e-10 60 27 5 166 1 rlmP 23S rRNA (guanosine(2553)-2'-O)-methyltransferase RlmP Bacillus subtilis (strain 168)
O30272 8.55e-10 60 27 4 164 3 AF_2399 Uncharacterized tRNA/rRNA methyltransferase AF_2399 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9CJP3 1.1e-09 60 33 4 154 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Pasteurella multocida (strain Pm70)
Q9PC00 3.1e-09 58 31 3 150 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Xylella fastidiosa (strain 9a5c)
A5U8Q4 4.24e-09 59 26 3 147 3 MRA_3618 Uncharacterized tRNA/rRNA methyltransferase MRA_3618 Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P9WFY5 4.24e-09 59 26 3 147 1 Rv3579c Uncharacterized tRNA/rRNA methyltransferase Rv3579c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFY4 4.24e-09 59 26 3 147 3 MT3685 Uncharacterized tRNA/rRNA methyltransferase MT3685 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8PM64 1.01e-08 57 33 4 155 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Xanthomonas axonopodis pv. citri (strain 306)
P74516 1.04e-08 55 27 5 144 3 slr0992 Putative tRNA (cytidine(34)-2'-O)-methyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q87D65 1.1e-08 57 32 4 152 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q8PAG5 1.4e-08 57 33 4 155 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
O31590 1.9e-08 55 28 4 145 3 cspR Putative tRNA (cytidine(34)-2'-O)-methyltransferase Bacillus subtilis (strain 168)
A1KPR5 2.09e-08 57 26 3 145 3 BCG_3644c Uncharacterized tRNA/rRNA methyltransferase BCG_3644c Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7TW55 3.5e-08 56 26 3 145 3 BQ2027_MB3610C Uncharacterized tRNA/rRNA methyltransferase Mb3610c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q13395 1.96e-07 54 25 2 143 1 TARBP1 Probable methyltransferase TARBP1 Homo sapiens
Q76NT0 2.49e-07 54 29 8 155 3 mrm1 rRNA methyltransferase 1, mitochondrial Dictyostelium discoideum
A1UMF4 3.98e-07 53 29 3 154 3 Mkms_4822 Uncharacterized tRNA/rRNA methyltransferase Mkms_4822 Mycobacterium sp. (strain KMS)
Q1B2P4 3.98e-07 53 29 3 154 3 Mmcs_4736 Uncharacterized tRNA/rRNA methyltransferase Mmcs_4736 Mycobacterium sp. (strain MCS)
A3Q6V9 4.02e-07 53 29 3 154 3 Mjls_5122 Uncharacterized tRNA/rRNA methyltransferase Mjls_5122 Mycobacterium sp. (strain JLS)
P32813 1.4e-06 50 29 7 148 3 None Putative tRNA (cytidine(34)-2'-O)-methyltransferase Geobacillus stearothermophilus
A1L2E4 7.01e-06 49 24 8 210 2 rnmtl1b rRNA methyltransferase 3B, mitochondrial Danio rerio
B2IBT9 7.47e-06 48 28 7 176 3 trmL tRNA (cytidine(34)-2'-O)-methyltransferase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
D7A3L6 1.48e-05 47 29 8 153 3 trmL tRNA (cytidine(34)-2'-O)-methyltransferase Ancylobacter novellus (strain ATCC 8093 / DSM 506 / JCM 20403 / CCM 1077 / IAM 12100 / NBRC 12443 / NCIMB 10456)
Q9HC36 2.79e-05 48 36 2 61 1 MRM3 rRNA methyltransferase 3, mitochondrial Homo sapiens
A2RKW7 2.98e-05 46 31 6 131 3 llmg_1343 Putative tRNA (cytidine(34)-2'-O)-methyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
P69001 3.76e-05 46 28 8 153 3 lin0934 Putative tRNA (cytidine(34)-2'-O)-methyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q566V3 4.13e-05 47 35 1 57 2 mrm3a rRNA methyltransferase 3A, mitochondrial Danio rerio
P44868 9.35e-05 45 26 5 163 1 trmL tRNA (cytidine(34)-2'-O)-methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5ND52 0.000195 45 33 1 56 2 Mrm3 rRNA methyltransferase 3, mitochondrial Mus musculus
Q6IN84 0.000273 45 25 6 185 1 MRM1 rRNA methyltransferase 1, mitochondrial Homo sapiens
Q6D257 0.00054 43 23 6 205 3 trmJ tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q12E50 0.000601 42 27 7 166 3 trmL tRNA (cytidine(34)-2'-O)-methyltransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
P0AGJ5 0.000627 43 24 2 150 1 yfiF Uncharacterized tRNA/rRNA methyltransferase YfiF Escherichia coli (strain K12)
P0AGJ6 0.000627 43 24 2 150 3 yfiF Uncharacterized tRNA/rRNA methyltransferase YfiF Escherichia coli O157:H7
P52393 0.000892 43 28 3 101 3 tsnR 23S rRNA (adenosine(1067)-2'-O)-methyltransferase Streptomyces laurentii

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14590
Feature type CDS
Gene trmH
Product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH
Location 151659 - 152363 (strand: -1)
Length 705 (nucleotides) / 234 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000004
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1766
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00588 SpoU rRNA Methylase family
PF12105 SpoU, rRNA methylase, C-terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0566 Translation, ribosomal structure and biogenesis (J) J tRNA G18 (ribose-2'-O)-methylase SpoU

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00556 tRNA (guanosine-2'-O-)-methyltransferase [EC:2.1.1.34] - -

Protein Sequence

MNPQRYERICRMMAMRQPDLTLCLEEVHKPHNVSAVIRSADAVGIHDLHAIWPEKIRTRISSAAGSNSWVNVHNHATLNDAVGMLKSQGMQILATHLSDSAVDFRTVDFTRPTCIIMGSEKYGISPDAINIADKHIMIPMSGMVQSLNVSVAAAVILYEAQRQREAAGLYTHPRGALPQDEQQRLLFERGYPVLAQVALEKKLPRPQIDVNGHIIAPDSWWALMQQKKTSASKQ

Flanking regions ( +/- flanking 50bp)

ATCCGGATTATGCCGGATGTCCTGCGCGTCAGCCGCAACCGGAATTAAGCATGAATCCCCAACGTTATGAGCGCATCTGCCGGATGATGGCGATGCGCCAGCCAGACCTTACACTGTGCCTTGAAGAAGTTCATAAACCCCACAACGTCTCTGCGGTTATCCGCAGTGCCGATGCGGTCGGTATTCATGATTTACATGCCATCTGGCCGGAAAAAATCAGAACCCGGATCTCTTCGGCCGCCGGCAGTAACAGCTGGGTCAATGTCCATAACCACGCCACGCTCAATGATGCTGTCGGTATGCTGAAATCACAGGGGATGCAGATACTGGCAACCCATCTGTCTGACAGTGCGGTGGATTTTCGTACCGTCGATTTTACCCGGCCGACCTGCATTATCATGGGATCAGAAAAATACGGTATTTCACCGGATGCCATTAATATTGCCGATAAGCATATTATGATCCCGATGTCCGGTATGGTGCAGTCTCTGAATGTGTCCGTTGCTGCTGCCGTGATCCTGTATGAAGCCCAGCGTCAGCGTGAAGCCGCAGGTTTATATACCCATCCCCGCGGTGCATTACCGCAGGATGAACAGCAGCGCCTGCTCTTTGAGCGCGGTTATCCGGTTCTGGCTCAGGTTGCGCTTGAGAAAAAACTTCCCCGCCCGCAGATTGACGTGAACGGCCATATTATTGCGCCGGACAGTTGGTGGGCTTTGATGCAACAGAAAAAAACATCCGCCTCAAAACAATAAACGGAGCAGAGAATGAAAGGGCAACTGCTTGATGCTATCCCGCTCACGAC