Homologs in group_2755

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07685 FBDBKF_07685 92.5 Morganella morganii S1 ssnA putative aminohydrolase SsnA
EHELCC_13515 EHELCC_13515 92.5 Morganella morganii S2 ssnA putative aminohydrolase SsnA
NLDBIP_13960 NLDBIP_13960 92.5 Morganella morganii S4 ssnA putative aminohydrolase SsnA
LHKJJB_08890 LHKJJB_08890 92.5 Morganella morganii S3 ssnA putative aminohydrolase SsnA
HKOGLL_08440 HKOGLL_08440 92.5 Morganella morganii S5 ssnA putative aminohydrolase SsnA

Distribution of the homologs in the orthogroup group_2755

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2755

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q46812 0.0 702 75 0 441 1 ssnA Putative aminohydrolase SsnA Escherichia coli (strain K12)
Q8PUQ3 1.5e-43 161 28 11 452 3 dadD 5'-deoxyadenosine deaminase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8R9L4 7.06e-41 154 28 12 449 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
C6A048 1.25e-40 153 27 12 445 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus sibiricus (strain DSM 12597 / MM 739)
Q8TRA4 5.97e-39 149 27 11 452 3 dadD 5'-deoxyadenosine deaminase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q466Q9 2.66e-38 147 28 11 452 3 dadD 5'-deoxyadenosine deaminase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q24UA2 2.69e-38 147 27 12 422 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain Y51)
B8FRL9 8.14e-38 145 27 12 422 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B6YUF8 7.8e-37 142 29 13 444 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus onnurineus (strain NA1)
A5D1G6 2.04e-36 142 27 12 451 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B0K2W0 1.16e-35 139 26 14 454 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter sp. (strain X514)
B0K8R8 1.16e-35 139 26 14 454 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q2RJW1 1.02e-33 134 27 15 447 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q5JER0 1.24e-33 134 26 13 449 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
B1I2P4 4.84e-33 132 25 11 446 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforudis audaxviator (strain MP104C)
Q58936 1.46e-32 130 26 13 424 1 dadD 5'-deoxyadenosine deaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8TYD4 2.57e-31 127 26 10 437 3 dadD 5'-deoxyadenosine deaminase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q2NHL6 8.48e-31 126 26 11 396 3 dadD 5'-deoxyadenosine deaminase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
A7I6C5 9.05e-31 126 28 12 421 3 dadD 5'-deoxyadenosine deaminase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q2FRU6 1.44e-30 125 28 12 410 3 dadD 5'-deoxyadenosine deaminase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q3AC64 5.23e-30 124 27 18 451 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A4J675 1.08e-29 123 26 15 451 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q8U0P7 1.34e-29 122 26 11 425 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
O29265 1.45e-29 122 26 13 401 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q0AYV2 2.46e-29 122 25 11 399 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q6LX61 3.67e-29 121 26 15 450 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A9A9H3 7.23e-29 120 26 13 425 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A6UQD4 2.11e-28 119 26 14 427 3 dadD 5'-deoxyadenosine deaminase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A6VH76 2.15e-28 119 26 14 429 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
O27549 6.04e-28 118 27 13 415 3 dadD 5'-deoxyadenosine deaminase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A6UUG9 7.95e-28 117 27 15 406 3 dadD 5'-deoxyadenosine deaminase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
O29701 8.71e-28 117 27 12 429 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q12WS1 1.26e-27 117 25 16 456 3 dadD 5'-deoxyadenosine deaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q5WGA8 6.72e-27 115 24 15 450 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Shouchella clausii (strain KSM-K16)
Q9V0Y5 1.38e-26 114 25 10 408 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus abyssi (strain GE5 / Orsay)
A4FW32 2.04e-26 114 25 14 425 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
B5YDN9 3.44e-26 113 27 11 393 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A0LMI3 4.64e-26 112 25 13 449 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
O66851 7.81e-26 112 27 19 461 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Aquifex aeolicus (strain VF5)
Q891Y7 1.29e-25 111 24 14 452 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Clostridium tetani (strain Massachusetts / E88)
Q2LUH4 2.01e-25 111 25 13 459 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Syntrophus aciditrophicus (strain SB)
A3DEQ2 2.93e-25 110 26 14 449 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A5UMN6 2.38e-24 108 24 15 451 3 dadD 5'-deoxyadenosine deaminase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
O59184 1.71e-23 105 23 11 413 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q2LTB7 8.71e-23 103 27 16 451 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Syntrophus aciditrophicus (strain SB)
B8E183 1.14e-22 103 25 11 397 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
A1VD37 3.88e-22 101 26 12 446 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DP4)
Q9KC82 1.18e-21 100 24 18 458 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q72B14 1.71e-21 99 26 12 446 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B7JJI0 4.77e-21 98 25 12 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH820)
Q81S14 4.77e-21 98 25 12 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis
C3L6N3 4.77e-21 98 25 12 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P768 4.77e-21 98 25 12 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain A0248)
Q5UYR3 6.24e-21 97 26 9 404 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q92342 1.34e-20 97 25 19 476 3 SPAC1F8.04c Uncharacterized protein C1F8.04c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B8CX03 1.4e-20 97 24 19 445 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
O31352 2.45e-20 96 25 12 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 10987 / NRS 248)
C1EPN0 2.48e-20 96 25 13 450 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain 03BB102)
B7IS56 2.52e-20 96 25 12 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain G9842)
A0RCM7 2.96e-20 95 25 13 450 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis (strain Al Hakam)
Q3ITF7 3.59e-20 95 26 9 406 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q9HN51 3.63e-20 95 26 13 430 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q81F14 4.22e-20 95 25 12 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6HK87 6.85e-20 95 25 12 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63CU1 6.85e-20 95 25 12 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ZK / E33L)
Q67NQ5 7.78e-20 94 23 13 451 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B7HMN9 8.64e-20 94 25 12 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH187)
B7HIQ2 1.33e-19 94 25 12 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain B4264)
Q9X034 4.82e-19 92 25 18 423 1 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A7GNR9 3e-18 90 24 14 450 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
C5BSJ0 4.16e-18 89 27 11 356 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Teredinibacter turnerae (strain ATCC 39867 / T7901)
A0B7V2 3.35e-17 86 23 14 426 3 dadD 5'-deoxyadenosine deaminase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q9I6Z0 7.38e-17 85 24 15 442 1 PA0142 8-oxoguanine deaminase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1MR44 1.01e-16 85 22 12 431 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Lawsonia intracellularis (strain PHE/MN1-00)
Q18EV7 2.5e-16 84 23 7 402 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
B8DKS6 9.22e-16 82 22 11 431 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q21IS0 3.37e-15 80 24 17 454 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B8J2Q8 5.26e-15 80 24 11 377 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
B5YLB7 5.29e-13 73 22 10 379 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A4XJI3 1.4e-12 72 21 12 447 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
P72156 5.56e-11 67 23 13 426 1 atzA Atrazine chlorohydrolase Pseudomonas sp. (strain ADP)
Q9EYU0 6.1e-10 64 22 14 433 1 triA Melamine deaminase Paracidovorax citrulli
Q52725 8.7e-07 54 23 8 252 1 trzA S-triazine hydrolase Gordonia rubripertincta
P95442 1.1e-05 51 20 7 290 1 atzB Hydroxydechloroatrazine ethylaminohydrolase Pseudomonas sp. (strain ADP)
Q58110 5.01e-05 48 29 6 158 3 MJ0699 Uncharacterized protein MJ0699 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8RFG1 0.000584 45 46 2 52 3 hutI Imidazolonepropionase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS13415
Feature type CDS
Gene ssnA
Product putative aminohydrolase SsnA
Location 315216 - 316544 (strand: 1)
Length 1329 (nucleotides) / 442 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2755
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01979 Amidohydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0402 Nucleotide transport and metabolism (F)
General function prediction only (R)		 FR Cytosine/adenosine deaminase or related metal-dependent hydrolase

Protein Sequence

MLILKNATIVEFEPTSVREGTDIAIDGDKIVATGSGLSSRYPGSETKEMNGRLVMPGIVCSHNHFYSGLSRGIMANIAPSPDFISTLKNLWWRLDRALDEESLYYSGLICSLEAIKSGCTAVVDHHASPDYIAGSLKTLRDGFLKAGLRGITCYETTDRNGGLKELEAGVAENIAFAELIDSERKSGKSRYLVEAHIGAHAPFTVADEGLAMLRDAIKKTGRGLHIHAAEDSYDVSFSHDKYGKDLLIRLDEFDLIDEKTLVAHGLYLSSADIDLLNKKDGFLVHNARSNMNNHVGYNHRLGDYNNVVLGTDGIGSDMFEELKFAFFKHRDAGGSMWPDSFTRFLWNGNRLLARNFGKQFGRVEAGYQADLTICDYMPPTPFVGDNLPGHLAFGLGSSSVHSVMVDGVMVYEDRQFPFDIEPIFADARKAAKKMWARMDALK

Flanking regions ( +/- flanking 50bp)

ACGTCAACAAGCACTATCACTATCTGTTAGGCCGGGTGGAGGTATAAACCATGCTGATCCTGAAAAATGCCACTATTGTTGAGTTTGAACCAACATCTGTCCGCGAAGGGACAGATATCGCCATCGACGGCGACAAAATTGTCGCCACCGGCAGCGGGCTGAGCTCCCGCTATCCGGGGTCGGAAACCAAAGAGATGAACGGGCGCCTGGTGATGCCCGGGATTGTCTGCTCCCATAACCATTTTTATTCCGGTTTATCCCGCGGGATCATGGCGAATATCGCACCAAGCCCGGATTTTATTTCCACACTGAAAAATCTGTGGTGGCGGCTGGATCGCGCGCTGGATGAAGAGTCTCTTTATTACAGCGGGCTTATCTGCTCACTCGAGGCGATTAAAAGCGGCTGTACCGCGGTGGTCGATCACCATGCGTCACCTGATTATATCGCCGGTTCCCTGAAAACCCTGCGTGACGGCTTCCTGAAAGCCGGTTTGCGCGGCATAACCTGTTATGAAACCACTGATCGCAACGGCGGACTGAAAGAACTGGAAGCCGGTGTGGCAGAAAATATCGCCTTCGCAGAGCTTATCGACAGTGAGCGCAAAAGCGGTAAATCCCGCTATCTGGTGGAAGCGCACATCGGGGCGCACGCGCCGTTCACCGTTGCTGATGAAGGTCTGGCAATGCTGCGCGATGCGATTAAAAAGACCGGGCGCGGGCTGCACATTCATGCGGCGGAAGACAGCTACGATGTCTCATTCAGTCATGACAAATACGGCAAAGACCTGCTGATCCGCCTGGATGAGTTTGATCTTATTGATGAAAAAACTCTTGTCGCACACGGACTGTATTTATCTTCCGCAGATATTGACCTGCTGAATAAAAAAGATGGCTTCCTTGTTCACAACGCCCGCTCCAATATGAATAACCATGTCGGCTATAACCACCGCCTGGGTGATTACAACAATGTGGTGCTCGGCACAGACGGTATCGGCTCTGATATGTTTGAAGAGCTTAAATTCGCCTTCTTCAAACACCGCGATGCAGGTGGTTCTATGTGGCCGGATAGCTTTACCCGCTTCCTGTGGAACGGCAACAGATTGCTGGCACGCAACTTCGGTAAACAGTTTGGTCGGGTGGAAGCCGGTTATCAGGCAGATTTAACCATTTGCGATTACATGCCGCCGACCCCGTTTGTCGGTGACAATCTGCCGGGTCATCTGGCGTTCGGATTAGGATCGTCAAGCGTTCACAGTGTGATGGTGGATGGTGTGATGGTCTATGAAGACAGACAGTTCCCGTTTGATATCGAACCAATTTTTGCCGATGCGCGCAAAGCCGCGAAGAAAATGTGGGCCCGGATGGACGCACTGAAATAAATAAAACCATGGCCTGCGGTTATACCGCAGGCCTGAAGAGCAATGTAGGG