Homologs in group_2779

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_13515 EHELCC_13515 100.0 Morganella morganii S2 ssnA putative aminohydrolase SsnA
NLDBIP_13960 NLDBIP_13960 100.0 Morganella morganii S4 ssnA putative aminohydrolase SsnA
LHKJJB_08890 LHKJJB_08890 100.0 Morganella morganii S3 ssnA putative aminohydrolase SsnA
HKOGLL_08440 HKOGLL_08440 100.0 Morganella morganii S5 ssnA putative aminohydrolase SsnA
F4V73_RS13415 F4V73_RS13415 92.5 Morganella psychrotolerans ssnA putative aminohydrolase SsnA

Distribution of the homologs in the orthogroup group_2779

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2779

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q46812 0.0 705 74 0 441 1 ssnA Putative aminohydrolase SsnA Escherichia coli (strain K12)
Q8PUQ3 3.34e-42 157 29 12 452 3 dadD 5'-deoxyadenosine deaminase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8R9L4 6.11e-42 157 28 13 452 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
C6A048 1.01e-41 156 28 11 425 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus sibiricus (strain DSM 12597 / MM 739)
Q8TRA4 7.87e-40 151 28 10 454 3 dadD 5'-deoxyadenosine deaminase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q24UA2 2.56e-38 147 27 13 442 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain Y51)
B6YUF8 3.47e-38 146 29 13 444 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus onnurineus (strain NA1)
A5D1G6 7.55e-38 145 28 13 452 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B8FRL9 7.83e-38 145 27 13 442 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B0K2W0 3.37e-36 141 27 14 454 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter sp. (strain X514)
B0K8R8 3.37e-36 141 27 14 454 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q5JER0 4.36e-36 140 27 12 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q466Q9 1.05e-35 139 27 11 452 3 dadD 5'-deoxyadenosine deaminase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q58936 2.17e-33 133 25 16 447 1 dadD 5'-deoxyadenosine deaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q2RJW1 4.57e-33 132 27 15 447 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B1I2P4 4.57e-32 129 25 10 445 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforudis audaxviator (strain MP104C)
Q3AC64 5.07e-32 129 26 15 447 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
O29701 5.53e-32 129 28 12 429 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q0AYV2 1.32e-31 128 27 10 396 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q8TYD4 1.81e-31 128 27 7 372 3 dadD 5'-deoxyadenosine deaminase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q8U0P7 2.13e-30 125 26 9 422 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q2FRU6 6.71e-30 124 27 12 410 3 dadD 5'-deoxyadenosine deaminase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q6LX61 4.36e-29 121 26 17 450 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q2NHL6 4.96e-29 121 25 11 424 3 dadD 5'-deoxyadenosine deaminase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
O27549 6.77e-29 120 27 13 420 3 dadD 5'-deoxyadenosine deaminase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A7I6C5 6.92e-29 120 27 13 412 3 dadD 5'-deoxyadenosine deaminase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q9V0Y5 9.21e-29 120 25 10 412 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus abyssi (strain GE5 / Orsay)
A9A9H3 1.94e-28 119 25 15 446 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
O29265 5.07e-28 118 27 11 375 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A6UQD4 6.66e-28 117 25 16 450 3 dadD 5'-deoxyadenosine deaminase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A6VH76 1.03e-27 117 26 16 450 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
O66851 2.4e-27 116 27 16 457 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Aquifex aeolicus (strain VF5)
Q5WGA8 3.74e-27 115 25 15 450 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Shouchella clausii (strain KSM-K16)
A4J675 3.84e-27 115 24 12 448 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
O59184 8.64e-27 114 25 11 415 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A4FW32 8.75e-27 114 25 16 446 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A3DEQ2 1.15e-26 114 26 12 409 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A6UUG9 2.21e-26 113 28 16 406 3 dadD 5'-deoxyadenosine deaminase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
A5UMN6 2.48e-26 113 25 13 424 3 dadD 5'-deoxyadenosine deaminase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q12WS1 7.67e-26 112 26 16 456 3 dadD 5'-deoxyadenosine deaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q2LUH4 1.7e-25 111 25 14 459 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Syntrophus aciditrophicus (strain SB)
Q891Y7 1.05e-24 108 23 13 449 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Clostridium tetani (strain Massachusetts / E88)
A0LMI3 2.22e-24 108 25 13 451 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B5YDN9 4.15e-23 104 25 11 393 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
B7JJI0 5.13e-22 101 26 13 439 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH820)
Q81S14 5.13e-22 101 26 13 439 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis
C3L6N3 5.13e-22 101 26 13 439 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P768 5.13e-22 101 26 13 439 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain A0248)
Q2LTB7 6.02e-22 101 26 17 432 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Syntrophus aciditrophicus (strain SB)
C1EPN0 1.92e-21 99 26 12 439 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain 03BB102)
A0RCM7 2.32e-21 99 26 12 439 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis (strain Al Hakam)
Q9KC82 3.94e-21 98 24 17 455 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B7IS56 5.6e-21 98 25 12 439 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain G9842)
Q6HK87 5.65e-21 98 25 12 439 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63CU1 5.65e-21 98 25 12 439 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ZK / E33L)
B7HMN9 7.63e-21 97 26 12 439 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH187)
O31352 1.38e-20 97 25 13 450 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 10987 / NRS 248)
B8E183 1.49e-20 96 24 15 446 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q67NQ5 1.61e-20 96 23 11 408 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q9X034 1.8e-20 96 25 17 418 1 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B8CX03 2.9e-20 95 24 17 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B7HIQ2 5.03e-20 95 25 13 450 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain B4264)
Q9HN51 5.52e-20 95 25 12 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q81F14 6.42e-20 95 25 13 450 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A7GNR9 6.72e-20 95 24 11 421 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q92342 7.53e-20 95 25 18 433 3 SPAC1F8.04c Uncharacterized protein C1F8.04c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A1VD37 1.04e-19 94 25 12 425 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DP4)
Q5UYR3 1.59e-19 94 24 7 393 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q9I6Z0 2.42e-19 93 24 14 435 1 PA0142 8-oxoguanine deaminase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3ITF7 2.61e-19 93 26 10 423 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q72B14 6.9e-19 92 25 12 425 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
C5BSJ0 7.78e-18 89 25 10 386 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Teredinibacter turnerae (strain ATCC 39867 / T7901)
A0B7V2 3.66e-16 83 23 14 426 3 dadD 5'-deoxyadenosine deaminase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q18EV7 4.06e-16 83 22 7 400 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q1MR44 7.4e-16 82 21 12 451 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Lawsonia intracellularis (strain PHE/MN1-00)
P72156 1.51e-15 82 24 13 426 1 atzA Atrazine chlorohydrolase Pseudomonas sp. (strain ADP)
Q21IS0 5.92e-15 80 25 12 415 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9EYU0 1.86e-14 78 24 14 433 1 triA Melamine deaminase Paracidovorax citrulli
B8DKS6 2.3e-14 78 21 10 420 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B5YLB7 1.91e-13 75 23 10 379 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B8J2Q8 2.33e-13 75 23 12 387 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
A4XJI3 8.7e-13 73 22 14 446 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
P0CI72 7.62e-12 70 23 16 450 1 None Isoxanthopterin deaminase Unknown prokaryotic organism
Q52725 8.62e-10 64 25 8 252 1 trzA S-triazine hydrolase Gordonia rubripertincta
P95442 5.55e-08 58 21 17 444 1 atzB Hydroxydechloroatrazine ethylaminohydrolase Pseudomonas sp. (strain ADP)
Q58110 9.18e-05 48 29 6 158 3 MJ0699 Uncharacterized protein MJ0699 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8RFG1 0.000347 46 48 2 52 3 hutI Imidazolonepropionase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_07685
Feature type CDS
Gene ssnA
Product putative aminohydrolase SsnA
Location 52029 - 53354 (strand: -1)
Length 1326 (nucleotides) / 441 (amino acids)
In genomic island -

Contig

Accession contig_8
Length 164760 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2779
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01979 Amidohydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0402 Nucleotide transport and metabolism (F)
General function prediction only (R)
FR Cytosine/adenosine deaminase or related metal-dependent hydrolase

Protein Sequence

MLILKNATITEFEPAGIRQGVDIAIEGDKIAAVGNGLHSRYPGAEVKEMNGKLVMPGIVCSHNHFYSGLSRGIMANIAPSPDFISTLKNLWWRLDRALDEESLYYSGLICSLEAIKSGCTSVIDHHASPNYIAGSLKTLRDGFLKAGLRGMTCYETTDRNGGLKELEAGVEENIAFAELIDSERKSGKSRYLVEAHIGAHAPFTVADEGLKMLREAIKKTGRGLHIHAAEDSYDVSFSHDKYGKDLLIRLGEFDLIDEKTLIAHGLYLSSADIELLNKKDGFLVHNARSNMNNHVGYNHRLGDYNNVVLGTDGIGSDMLEEMKFAFFKHRDAGGSMWPDSFTRFLWNGNRLLARNFGKQFGRVETGYQADLTICDYTPPTPFVGDNLPGHLAFGLGSNSVNSVMVDGVMVYENRQFPFDIEPLFAEARKAAKKMWARMDAL

Flanking regions ( +/- flanking 50bp)

CATGTCCATAAACACTATCGTTATCTGTTAGGCCGGGTGGAGAAATAATTATGCTGATTCTGAAAAATGCCACCATCACTGAGTTCGAACCGGCGGGGATCCGCCAAGGGGTCGATATCGCCATAGAGGGTGACAAAATTGCGGCTGTGGGTAACGGGCTTCATTCCCGTTACCCGGGCGCGGAAGTCAAAGAAATGAACGGCAAACTGGTGATGCCGGGGATCGTCTGTTCCCATAACCATTTCTATTCCGGCCTGTCACGCGGCATTATGGCGAATATCGCGCCGAGCCCTGATTTCATCTCCACCCTGAAAAACCTGTGGTGGCGGCTTGACCGCGCGCTGGATGAGGAATCCCTTTATTACAGCGGCCTTATCTGCTCTCTCGAAGCGATTAAGAGCGGCTGTACCTCGGTGATTGACCACCATGCCTCACCAAACTATATCGCCGGTTCCCTGAAAACCCTGCGCGACGGCTTCCTGAAAGCCGGTCTGCGCGGCATGACCTGCTACGAAACCACCGACCGCAACGGCGGCCTGAAAGAGCTGGAAGCCGGGGTGGAAGAGAATATCGCCTTTGCGGAGCTTATCGACAGCGAACGCAAAAGCGGTAAATCCCGCTATCTGGTGGAAGCGCACATCGGGGCACACGCACCGTTCACCGTGGCGGATGAAGGTCTGAAAATGCTGCGCGAGGCGATTAAGAAAACCGGACGCGGCCTGCATATCCACGCGGCGGAAGACAGTTATGACGTCTCTTTCAGCCATGACAAATACGGCAAAGATTTGCTGATCCGCCTGGGTGAGTTTGATCTGATTGATGAAAAAACCCTGATCGCTCACGGCCTGTATCTTTCTTCCGCAGATATTGAGCTGCTGAATAAAAAAGATGGCTTCCTGGTTCACAACGCCCGTTCCAATATGAACAACCATGTCGGCTACAACCACCGCCTGGGTGACTACAACAACGTGGTACTCGGCACAGACGGTATCGGCTCCGATATGTTAGAAGAAATGAAGTTTGCCTTCTTTAAACACCGCGATGCAGGCGGTTCGATGTGGCCGGACAGCTTCACCCGCTTCCTGTGGAACGGTAACCGCTTACTGGCACGCAACTTCGGCAAACAGTTCGGCCGCGTGGAAACCGGGTATCAGGCTGACCTGACCATTTGTGATTACACACCACCAACACCGTTTGTCGGGGATAACCTGCCGGGCCATCTGGCCTTCGGTTTAGGATCCAACAGTGTGAACAGCGTGATGGTGGATGGTGTGATGGTGTATGAAAACCGTCAGTTCCCGTTCGATATCGAACCGCTCTTTGCAGAAGCACGCAAAGCCGCGAAAAAGATGTGGGCCCGGATGGACGCACTGTAATAAAAAACCATGGCCTGCGGCACTGCCGCAGGCCGGAAGAGCAATGTAGG