Homologs in group_2767

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07775 FBDBKF_07775 92.0 Morganella morganii S1 - AAA domain-containing protein
EHELCC_13605 EHELCC_13605 92.0 Morganella morganii S2 - AAA domain-containing protein
NLDBIP_14050 NLDBIP_14050 92.0 Morganella morganii S4 - AAA domain-containing protein
LHKJJB_08800 LHKJJB_08800 92.0 Morganella morganii S3 - AAA domain-containing protein
HKOGLL_08350 HKOGLL_08350 92.0 Morganella morganii S5 - AAA domain-containing protein

Distribution of the homologs in the orthogroup group_2767

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2767

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q46802 0.0 776 62 4 625 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
P26047 2.36e-78 264 50 0 234 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
Q06065 6.95e-78 258 50 3 263 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q01265 1.54e-77 251 48 2 257 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
P25852 1.04e-73 246 39 7 379 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q87MX7 1.92e-73 246 52 2 246 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3K999 4.96e-73 242 51 2 226 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
P0C5S5 5.1e-73 245 51 2 246 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 5.1e-73 245 51 2 246 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q8Z333 6.51e-73 244 39 8 379 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P71229 1.3e-72 249 49 2 255 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
O87455 1.31e-72 246 40 8 363 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9APD9 1.48e-72 243 41 6 356 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P14375 6.62e-72 241 50 2 249 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q9KT84 7.39e-72 242 40 6 359 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KN48 1.46e-71 243 40 9 386 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8X613 1.68e-71 240 50 2 249 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q7MM78 3.99e-71 240 51 2 246 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 3.99e-71 240 51 2 246 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
P0AFB8 4.52e-71 240 40 7 361 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 4.52e-71 240 40 7 361 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P03029 8.11e-71 239 40 8 361 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
O31551 4.75e-70 241 38 7 363 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
P0AFU5 6.15e-70 236 50 1 232 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 6.15e-70 236 50 1 232 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q845S7 1e-69 233 50 2 228 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
P41789 1.35e-69 236 40 7 361 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
G3XCV0 3.55e-69 236 39 12 406 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P17899 3.7e-69 234 41 5 357 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B5XVA2 6.02e-69 236 44 2 267 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
P10577 1.78e-68 234 48 2 234 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
E1WAA4 3.54e-68 238 45 3 272 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
A6TCX4 5.17e-68 233 45 2 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P0CL46 5.72e-68 238 45 3 272 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P06519 8.54e-68 234 43 2 270 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
O85057 2.15e-67 233 39 8 345 1 None Limonene hydroxylase Geobacillus stearothermophilus
P19323 2.18e-67 236 45 3 272 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
P27713 2.93e-67 232 50 1 230 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
P12626 6.51e-67 231 45 3 256 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
P45671 8.52e-67 229 46 4 261 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P30667 1.85e-66 232 54 2 213 1 nifA Nif-specific regulatory protein Azospirillum brasilense
P54929 1.87e-66 232 51 2 230 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
A8GG93 1.98e-66 229 45 4 268 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
P54529 7.4e-66 232 40 2 286 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
P12627 7.77e-66 228 44 2 249 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
Q00934 9.94e-66 225 47 1 228 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P05407 2.54e-65 228 43 4 286 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q88RJ6 2.91e-65 224 40 5 342 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q04848 3.09e-65 225 44 3 252 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q43965 4.79e-65 226 37 5 358 1 mopR Phenol regulator MopR Acinetobacter guillouiae
P10576 4.82e-65 224 37 9 363 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P28787 5.67e-65 224 45 1 242 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P09133 6.82e-65 228 48 3 258 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P56266 8e-65 225 46 3 251 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
P03027 1.16e-64 224 47 3 251 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
Q6D8R9 2.4e-64 223 48 1 227 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9I4N3 2.89e-64 222 50 2 223 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P29267 4.24e-64 222 39 9 357 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P54930 8.15e-64 222 48 2 230 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
P77743 1.56e-63 222 35 6 377 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
Q9K4U8 1.85e-63 221 46 1 226 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P09570 3.11e-63 221 48 2 231 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
A8ANR6 4.93e-63 220 38 6 363 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P28614 5.21e-63 223 48 3 237 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5E3W8 5.78e-63 220 47 1 226 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
P13632 6.77e-63 218 46 2 239 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
C0PWN2 2.09e-62 218 47 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
P38022 4.56e-62 216 34 5 373 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
P74839 4.87e-62 218 42 6 281 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5F363 7.5e-62 216 46 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
B5FSZ0 8.32e-62 216 46 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
A9MFX7 1.47e-61 216 48 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4T3B0 1.59e-61 216 46 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
Q88AQ2 1.87e-61 214 46 3 246 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8Z4C6 1.98e-61 215 46 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 1.98e-61 215 46 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 1.98e-61 215 46 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 1.98e-61 215 46 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
B6I695 2.14e-61 215 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
A4STH5 2.25e-61 215 46 1 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
B5RDG4 2.33e-61 215 46 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
B7NSI9 2.34e-61 215 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B1LQ27 2.63e-61 215 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
Q8ZMJ8 2.64e-61 215 46 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 2.64e-61 215 46 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
Q5PF20 2.89e-61 215 46 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A7ZQD8 3.29e-61 215 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YYF5 3.92e-61 214 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
B7N6T9 3.92e-61 214 37 7 362 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7M9E6 4.72e-61 214 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
B7MZ04 4.87e-61 214 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
P23747 5.06e-61 213 47 2 228 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0TEH1 5.23e-61 214 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q9HU19 5.36e-61 213 45 2 246 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q31X73 5.4e-61 214 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
B1IUX0 5.45e-61 214 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q1R7Z1 5.56e-61 214 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 5.56e-61 214 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 5.56e-61 214 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
B7LEC0 5.62e-61 214 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
A8A3I6 5.8e-61 214 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
B7UHC1 6.49e-61 214 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q8FEN6 7.27e-61 214 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B4TF23 7.45e-61 214 46 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
B7LW25 1.07e-60 213 47 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q7MFY9 2.55e-60 213 43 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
Q32CL9 2.91e-60 212 46 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
B5Z370 3.1e-60 212 46 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 3.1e-60 212 46 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
P59402 3.36e-60 212 46 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 3.36e-60 212 46 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
A0KEJ0 3.42e-60 212 47 1 224 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q8D4F9 3.58e-60 212 43 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
P24426 3.71e-60 207 45 2 228 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
P37013 4.58e-60 212 46 1 231 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 4.58e-60 212 46 1 231 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 4.58e-60 212 46 1 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
A4WDR5 1.11e-59 211 44 2 252 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
Q53206 1.6e-59 213 41 3 265 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P54931 3.4e-59 211 47 3 231 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q04849 7.92e-59 207 41 3 270 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P09828 1.93e-58 207 47 3 233 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
D5ARW9 5.42e-58 208 45 2 241 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0CY94 6.31e-58 207 45 2 241 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
P10046 7.02e-58 204 44 1 230 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P37344 2.18e-57 199 40 4 274 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
O25408 2.28e-56 198 42 1 227 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
Q9K4V0 3.16e-56 201 44 1 226 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P37931 8.96e-55 191 47 2 198 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P36219 2.46e-54 191 44 2 225 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
Q9ZIB7 5.27e-53 193 31 7 394 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
P31908 5.81e-52 189 35 6 353 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P37930 1.38e-50 181 44 2 200 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P26316 1.94e-50 180 44 2 198 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
P0A2D7 1.04e-48 181 34 8 347 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 1.04e-48 181 34 8 347 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P03028 1.46e-48 181 36 6 321 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
P07604 6.48e-47 176 39 2 218 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
O54426 5.12e-46 173 32 10 341 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
Q1RJS1 6.59e-43 164 35 4 251 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q9ZCY9 1.42e-42 163 36 5 251 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q68WH4 1.68e-42 163 35 5 251 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q4UL27 2.54e-42 162 35 5 251 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P26408 6.05e-41 159 32 7 333 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
P44694 4.04e-39 149 33 1 236 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q92HC2 2.36e-38 151 35 5 251 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P54156 4.74e-38 147 36 6 249 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P76016 2.09e-37 151 28 10 385 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
P38035 8.86e-37 147 34 7 277 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P45512 2.57e-36 147 24 12 552 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P09432 9.42e-33 135 34 5 231 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P55610 1.22e-20 99 29 4 248 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P06184 4.45e-16 84 27 4 245 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZLR9 7.36e-14 79 36 4 127 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P23914 1.44e-12 74 37 5 136 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
P42425 1.03e-05 52 30 6 140 1 lon2 Lon protease 2 Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS13270
Feature type CDS
Gene -
Product sigma 54-interacting transcriptional regulator
Location 280123 - 282030 (strand: -1)
Length 1908 (nucleotides) / 635 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2767
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00158 Sigma-54 interaction domain
PF02954 Bacterial regulatory protein, Fis family
PF13188 PAS domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3829 Transcription (K)
Signal transduction mechanisms (T)		 KT RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains

Protein Sequence

MITEKSLSVLMQIQPTIVHFSKMLASVLQLDVEIVDDKLTRIAGTGLFNQHLGHRLTNNSQLLRYVLETKKEKIVTHSCFDPLCLNCEDKDNCKEKAFIGTPIIFQDRCIGVISLVAVTSEQQERIRDNIHDFSDYVQHISNIFVAKLLDEQEGRSGAQKVLLSLIEFMDQGVLILDDSNHLKFANPHALKILHIPYEKISGKIVTIRPLTYFKSLNSGHLQHIVSYDGESNIIIGQLHVVNGCQMFLMAFHQSHAAIDMSEARAGENGLFIEHLVGKSEPVRQLKHLISRVAPSPSSILITGESGTGKEVVARAIHKLSNRSEKPFIAINCAAIPEQLLESELFGYVKGAFTGASANGKQGLIQAADKGTLFLDEIGDMPLLVQAKLLRAIESREVQPIGSSRTIPVDIRIVSATNQNLEQFVSEGKFREDLYYRLNVIPIALPPLRERYGDVELLVHHFLNVHTKRLGLVYPGISDEVMAVINAWPWPGNLRELSNLMEYLVNVVPPGEVIDISLLPPNFAKHAGQTINAPALPGQTGGDVYQSDITIPVKSIPVKSIPVKTIPNSAVPLRGIPPLPADDPVLHGETMLEEMEKQMIREALQRYDNKRQAAEELGIGIATLYRKIKKYELSAD

Flanking regions ( +/- flanking 50bp)

ATGTACTTTCTTTCATATATGTCATTTGAAGAGCATAGGAAGTCGTAAGCATGATCACTGAAAAATCACTGTCTGTGCTGATGCAGATACAACCGACGATCGTTCATTTCAGCAAGATGCTCGCCAGCGTGCTGCAACTTGATGTGGAAATCGTTGATGACAAACTGACAAGGATTGCCGGAACCGGGCTGTTTAATCAGCATCTGGGGCATCGTCTGACGAACAATTCGCAGCTTCTGCGCTATGTGCTGGAGACAAAAAAGGAAAAAATTGTCACCCATTCCTGTTTTGATCCCCTGTGCCTGAATTGTGAGGATAAAGATAATTGTAAGGAGAAAGCCTTTATCGGTACGCCGATCATTTTCCAGGATCGCTGTATCGGTGTGATTAGCCTGGTGGCGGTCACGTCAGAACAACAGGAGCGGATCCGCGATAATATTCATGATTTCTCGGATTATGTGCAGCATATTTCGAATATCTTTGTCGCTAAATTGCTGGATGAACAAGAAGGCCGCAGCGGGGCGCAAAAAGTCTTACTGAGCCTGATTGAATTTATGGATCAGGGCGTATTGATCCTTGATGATTCTAATCATCTGAAGTTTGCCAATCCTCATGCACTGAAAATTCTCCATATTCCGTATGAAAAAATCTCAGGAAAAATCGTGACCATCCGTCCGCTGACTTACTTCAAGAGCCTGAACAGCGGGCATTTACAGCACATTGTGTCATACGATGGTGAGAGCAATATTATTATCGGTCAGTTGCATGTGGTGAACGGCTGTCAGATGTTCCTGATGGCATTTCATCAGTCCCATGCGGCGATTGATATGAGTGAGGCACGCGCGGGTGAGAACGGATTGTTTATTGAACATCTGGTCGGAAAATCCGAACCTGTCCGCCAGCTTAAACACCTGATTTCCCGTGTGGCACCCAGCCCGTCGAGCATTCTTATTACCGGCGAAAGCGGCACGGGGAAAGAAGTGGTGGCGCGCGCTATCCACAAGCTGAGCAACCGCAGCGAAAAGCCGTTTATTGCAATTAACTGTGCCGCCATTCCTGAGCAGTTACTGGAAAGTGAGCTGTTTGGTTATGTGAAAGGCGCATTTACCGGGGCATCCGCCAACGGGAAACAAGGGCTGATTCAGGCGGCAGACAAAGGCACCTTATTTCTTGATGAAATAGGGGATATGCCGCTGCTTGTTCAGGCGAAATTGTTACGGGCAATCGAATCCCGCGAAGTGCAGCCAATCGGGTCAAGCCGGACCATTCCGGTGGATATCCGCATTGTGTCCGCAACTAATCAGAATCTGGAGCAGTTTGTCAGTGAAGGTAAATTCCGGGAAGATCTCTATTACCGCCTCAATGTTATCCCGATTGCCCTGCCGCCGCTGCGTGAGCGCTATGGTGATGTGGAACTGCTGGTGCATCATTTCCTCAATGTGCATACCAAGCGCCTCGGATTGGTCTATCCGGGTATTTCGGATGAGGTGATGGCGGTGATTAACGCCTGGCCGTGGCCGGGTAACTTGCGGGAACTGAGTAACCTGATGGAATATCTGGTGAATGTGGTGCCGCCGGGCGAAGTGATTGATATCTCACTGCTACCGCCGAACTTTGCGAAACATGCCGGACAAACAATAAATGCACCGGCGTTGCCGGGTCAGACCGGCGGGGATGTGTATCAAAGCGACATAACTATTCCTGTTAAAAGCATTCCGGTAAAAAGCATTCCTGTTAAAACGATTCCGAACAGCGCGGTGCCACTCAGAGGCATTCCGCCGCTGCCGGCAGATGACCCTGTATTACACGGGGAAACCATGCTGGAAGAGATGGAAAAGCAGATGATCCGCGAAGCACTGCAACGTTATGATAATAAACGTCAGGCGGCGGAAGAGCTGGGAATAGGCATTGCCACACTGTACCGGAAGATTAAAAAATACGAATTATCAGCAGACTAATTATGATTATGTCAGCCTGATACAAAAAAGCCGCCGGGGTAATTTTACTT