Homologs in group_3865

Help

1 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
PMI_RS00710 PMI_RS00710 85.1 Proteus mirabilis HI4320 pepT peptidase T

Distribution of the homologs in the orthogroup group_3865

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3865

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8R922 2e-122 363 43 5 410 3 pepT Peptidase T Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
C5DAS5 3.85e-119 355 44 5 406 3 pepT Peptidase T Geobacillus sp. (strain WCH70)
Q8ZH96 4.39e-119 355 44 6 409 3 YPO1009 Peptidase T-like protein YPO1009/y3403/YP_3421 Yersinia pestis
B8CWQ0 4.84e-119 355 43 5 410 3 pepT Peptidase T Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q5KZ39 2.78e-118 353 44 5 406 3 pepT Peptidase T Geobacillus kaustophilus (strain HTA426)
A7GAK0 3.21e-118 353 43 4 411 3 pepT Peptidase T Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q89YZ7 4.95e-118 352 43 5 412 3 pepT Peptidase T Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
C1FSB0 1.03e-117 352 42 4 411 3 pepT Peptidase T Clostridium botulinum (strain Kyoto / Type A2)
B1KV00 1.11e-117 352 42 4 411 3 pepT Peptidase T Clostridium botulinum (strain Loch Maree / Type A3)
C3L049 1.22e-117 352 42 4 411 3 pepT Peptidase T Clostridium botulinum (strain 657 / Type Ba4)
A5HYY2 2.06e-117 351 42 4 411 3 pepT Peptidase T Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FPG2 2.06e-117 351 42 4 411 3 pepT Peptidase T Clostridium botulinum (strain ATCC 19397 / Type A)
B1IEF5 2.97e-117 350 42 4 411 3 pepT Peptidase T Clostridium botulinum (strain Okra / Type B1)
A4INW9 4.25e-117 350 44 5 406 3 pepT Peptidase T Geobacillus thermodenitrificans (strain NG80-2)
A0Q3I1 4.59e-117 350 41 5 406 3 pepT Peptidase T Clostridium novyi (strain NT)
Q0SWT9 5.23e-115 345 43 6 408 3 pepT Peptidase T Clostridium perfringens (strain SM101 / Type A)
Q0TV42 5.46e-115 345 43 6 408 3 pepT Peptidase T Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A8ML45 6.28e-115 345 42 6 409 3 pepT Peptidase T Alkaliphilus oremlandii (strain OhILAs)
Q64WS4 1.44e-114 343 41 4 412 3 pepT Peptidase T Bacteroides fragilis (strain YCH46)
Q5LFT7 1.44e-114 343 41 4 412 3 pepT Peptidase T Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q5E0X3 3.38e-114 343 43 6 413 3 pepT Peptidase T Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q65D74 1.12e-113 342 42 5 410 3 pepT Peptidase T Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P58794 1.8e-113 341 43 4 407 3 pepT Peptidase T Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8XPD8 2.52e-113 340 42 6 408 3 pepT Peptidase T Clostridium perfringens (strain 13 / Type A)
A6L8T2 3e-113 340 41 5 411 3 pepT Peptidase T Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B8DDX7 4.43e-113 340 43 5 406 3 pepT Peptidase T Listeria monocytogenes serotype 4a (strain HCC23)
Q71YN8 7.29e-113 339 43 5 406 3 pepT Peptidase T Listeria monocytogenes serotype 4b (strain F2365)
P55179 1.11e-112 339 42 7 416 3 pepT Peptidase T Bacillus subtilis (strain 168)
C1KW79 3.92e-112 337 43 5 406 3 pepT Peptidase T Listeria monocytogenes serotype 4b (strain CLIP80459)
Q5WK52 4.66e-111 335 43 5 411 3 pepT Peptidase T Shouchella clausii (strain KSM-K16)
Q92AM8 7.5e-111 334 42 5 406 3 pepT Peptidase T Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A7GR91 8.09e-111 334 41 5 410 3 pepT Peptidase T Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q8Y6B1 1.22e-110 333 42 5 406 3 pepT Peptidase T Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q97LS8 1.95e-110 333 41 5 410 3 pepT Peptidase T Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A0AJN4 2.73e-110 333 42 5 406 3 pepT Peptidase T Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q92VT5 3.66e-110 332 45 5 408 3 RB0614 Peptidase T-like protein RB0614 Rhizobium meliloti (strain 1021)
B8G1J0 5.4e-110 332 42 6 411 3 pepT Peptidase T Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B6ER23 1.01e-109 331 42 6 408 3 pepT Peptidase T Aliivibrio salmonicida (strain LFI1238)
Q24VU3 3.49e-109 330 41 6 411 3 pepT Peptidase T Desulfitobacterium hafniense (strain Y51)
A7ZAB2 4.57e-109 330 42 5 410 3 pepT Peptidase T Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B1YFS8 5.74e-109 329 41 6 412 3 pepT Peptidase T Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q8CXN0 8.87e-109 329 41 4 409 3 pepT Peptidase T Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q732Y5 7.58e-108 327 41 6 412 3 pepT Peptidase T Bacillus cereus (strain ATCC 10987 / NRS 248)
B7ITJ6 9.94e-108 326 41 6 412 3 pepT Peptidase T Bacillus cereus (strain G9842)
B7JJ20 9.94e-108 326 41 6 412 3 pepT Peptidase T Bacillus cereus (strain AH820)
B7HDL9 1.26e-107 326 41 6 412 3 pepT Peptidase T Bacillus cereus (strain B4264)
Q6HF68 1.77e-107 325 41 6 412 3 pepT Peptidase T Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1ENW4 2.85e-107 325 41 6 412 3 pepT Peptidase T Bacillus cereus (strain 03BB102)
A0RHB6 2.85e-107 325 41 6 412 3 pepT Peptidase T Bacillus thuringiensis (strain Al Hakam)
B7HKU6 3.65e-107 325 41 6 412 3 pepT Peptidase T Bacillus cereus (strain AH187)
B9IV41 5.44e-107 324 41 6 412 3 pepT Peptidase T Bacillus cereus (strain Q1)
A9VR36 5.45e-107 324 40 6 412 3 pepT Peptidase T Bacillus mycoides (strain KBAB4)
Q636T5 6.4e-107 324 41 6 412 3 pepT Peptidase T Bacillus cereus (strain ZK / E33L)
Q81A48 7.21e-107 324 41 6 412 3 pepT Peptidase T Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A8FIY2 7.47e-107 324 39 5 409 3 pepT Peptidase T Bacillus pumilus (strain SAFR-032)
Q81WU4 1.23e-106 323 41 6 412 1 pepT Peptidase T Bacillus anthracis
C3L855 1.23e-106 323 41 6 412 3 pepT Peptidase T Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P5E3 1.23e-106 323 41 6 412 3 pepT Peptidase T Bacillus anthracis (strain A0248)
B7VSC8 2.27e-105 320 41 6 412 3 pepT Peptidase T Vibrio atlanticus (strain LGP32)
A9KT72 7.18e-105 319 39 4 408 3 pepT Peptidase T Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
C4L0I9 1.11e-104 318 40 4 410 3 pepT Peptidase T Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q7MDF5 3.11e-103 315 40 8 417 3 pepT Peptidase T Vibrio vulnificus (strain YJ016)
Q87GX2 4.54e-103 314 40 8 414 3 pepT Peptidase T Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6LR24 5.45e-103 314 40 7 416 3 pepT Peptidase T Photobacterium profundum (strain SS9)
C0ZDI3 1.57e-100 308 40 5 410 3 pepT Peptidase T Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q6D4E3 2.11e-97 300 40 9 417 3 pepT Peptidase T Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9KMY6 3.11e-97 299 40 6 413 3 pepT Peptidase T Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1WTV4 3.34e-97 299 39 7 412 3 pepT Peptidase T Ligilactobacillus salivarius (strain UCC118)
A0KIP7 5.43e-97 298 39 7 410 3 pepT Peptidase T Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
C6DFW1 3.39e-96 296 39 9 417 3 pepT Peptidase T Pectobacterium carotovorum subsp. carotovorum (strain PC1)
C3LUK2 3.82e-96 296 40 6 413 3 pepT Peptidase T Vibrio cholerae serotype O1 (strain M66-2)
A5EYJ8 3.82e-96 296 40 6 413 3 pepT Peptidase T Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B9EAD7 2.31e-95 295 40 9 401 3 pepT Peptidase T Macrococcus caseolyticus (strain JCSC5402)
A8H6S3 2.49e-95 294 38 6 411 3 pepT Peptidase T Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A4SPD7 8.64e-95 293 39 6 409 3 pepT Peptidase T Aeromonas salmonicida (strain A449)
Q38X92 3.22e-94 292 38 6 411 3 pepT Peptidase T Latilactobacillus sakei subsp. sakei (strain 23K)
B1HZ48 3.78e-94 291 39 6 417 3 pepT Peptidase T Lysinibacillus sphaericus (strain C3-41)
B5BAE8 1.44e-93 290 40 9 414 3 pepT Peptidase T Salmonella paratyphi A (strain AKU_12601)
Q5PMK2 1.44e-93 290 40 9 414 3 pepT Peptidase T Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B0TPD4 1.45e-93 290 38 7 411 3 pepT Peptidase T Shewanella halifaxensis (strain HAW-EB4)
B4TTK0 2.04e-93 290 40 9 414 3 pepT Peptidase T Salmonella schwarzengrund (strain CVM19633)
B5F8C6 2.04e-93 290 40 9 414 3 pepT Peptidase T Salmonella agona (strain SL483)
B5FK77 3.85e-93 289 40 9 414 3 pepT Peptidase T Salmonella dublin (strain CT_02021853)
B9DU35 1.2e-92 288 37 7 406 3 pepT Peptidase T Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B5RB75 1.42e-92 287 40 9 414 3 pepT Peptidase T Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q57QC7 1.42e-92 287 40 9 414 3 pepT Peptidase T Salmonella choleraesuis (strain SC-B67)
P26311 1.71e-92 287 40 9 414 1 pepT Peptidase T Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4T3R6 1.71e-92 287 40 9 414 3 pepT Peptidase T Salmonella newport (strain SL254)
B4TFK5 1.71e-92 287 40 9 414 3 pepT Peptidase T Salmonella heidelberg (strain SL476)
B7LQ18 2.34e-92 287 38 9 414 3 pepT Peptidase T Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
C5BFN3 2.43e-92 287 39 9 417 3 pepT Peptidase T Edwardsiella ictaluri (strain 93-146)
P29745 3.65e-92 286 39 9 414 1 pepT Peptidase T Escherichia coli (strain K12)
B1XA37 3.65e-92 286 39 9 414 3 pepT Peptidase T Escherichia coli (strain K12 / DH10B)
C4ZS67 3.65e-92 286 39 9 414 3 pepT Peptidase T Escherichia coli (strain K12 / MC4100 / BW2952)
Q8Z7H6 4.33e-92 286 40 9 414 3 pepT Peptidase T Salmonella typhi
A7ZKR7 4.82e-92 286 39 9 414 3 pepT Peptidase T Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3Z2Z2 5.05e-92 286 39 9 414 3 pepT Peptidase T Shigella sonnei (strain Ss046)
Q32EY5 5.05e-92 286 39 9 414 3 pepT Peptidase T Shigella dysenteriae serotype 1 (strain Sd197)
Q1RD26 5.05e-92 286 39 9 414 3 pepT Peptidase T Escherichia coli (strain UTI89 / UPEC)
B7N3N7 5.05e-92 286 39 9 414 3 pepT Peptidase T Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P65803 5.05e-92 286 39 9 414 3 pepT Peptidase T Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AA21 5.05e-92 286 39 9 414 3 pepT Peptidase T Escherichia coli O1:K1 / APEC
B7MTQ8 5.05e-92 286 39 9 414 3 pepT Peptidase T Escherichia coli O81 (strain ED1a)
P65804 5.05e-92 286 39 9 414 3 pepT Peptidase T Escherichia coli O157:H7
B7MJB5 5.05e-92 286 39 9 414 3 pepT Peptidase T Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UQ36 5.05e-92 286 39 9 414 3 pepT Peptidase T Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5QXA9 5.86e-92 286 40 9 414 3 pepT Peptidase T Salmonella enteritidis PT4 (strain P125109)
Q83RR6 7.86e-92 285 39 9 414 3 pepT Peptidase T Shigella flexneri
Q0T5R1 7.86e-92 285 39 9 414 3 pepT Peptidase T Shigella flexneri serotype 5b (strain 8401)
B1IUE0 7.94e-92 285 39 9 414 3 pepT Peptidase T Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZ82 7.94e-92 285 39 9 414 3 pepT Peptidase T Escherichia coli O9:H4 (strain HS)
Q31ZK3 8.11e-92 285 39 9 414 3 pepT Peptidase T Shigella boydii serotype 4 (strain Sb227)
B2TZ80 8.11e-92 285 39 9 414 3 pepT Peptidase T Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B9DK09 1e-91 285 39 9 403 3 pepT Peptidase T Staphylococcus carnosus (strain TM300)
Q0TIU6 1.78e-91 285 38 9 414 3 pepT Peptidase T Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B6I9K6 1.82e-91 285 38 9 414 3 pepT Peptidase T Escherichia coli (strain SE11)
Q4L4G8 1.88e-91 285 39 7 400 3 pepT Peptidase T Staphylococcus haemolyticus (strain JCSC1435)
C0Q764 3.09e-91 284 39 9 414 3 pepT Peptidase T Salmonella paratyphi C (strain RKS4594)
Q835J5 5.18e-91 283 37 6 410 3 pepT Peptidase T Enterococcus faecalis (strain ATCC 700802 / V583)
B1JI59 6.06e-91 283 39 9 416 3 pepT Peptidase T Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
B5XSP2 8.77e-91 283 39 9 415 3 pepT Peptidase T Klebsiella pneumoniae (strain 342)
B2GC19 1.65e-90 282 37 5 410 3 pepT Peptidase T Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A9MG86 4.74e-90 281 39 8 414 3 pepT Peptidase T Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8GDC2 8.66e-90 280 38 9 416 3 pepT Peptidase T Serratia proteamaculans (strain 568)
Q669P7 1.13e-89 280 38 9 416 3 pepT Peptidase T Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TLP0 1.13e-89 280 38 9 416 3 pepT Peptidase T Yersinia pestis (strain Pestoides F)
Q1CI51 1.13e-89 280 38 9 416 3 pepT Peptidase T Yersinia pestis bv. Antiqua (strain Nepal516)
A9R0M2 1.13e-89 280 38 9 416 3 pepT Peptidase T Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFR0 1.13e-89 280 38 9 416 3 pepT Peptidase T Yersinia pestis
B2K719 1.13e-89 280 38 9 416 3 pepT Peptidase T Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6R3 1.13e-89 280 38 9 416 3 pepT Peptidase T Yersinia pestis bv. Antiqua (strain Antiqua)
A7FH54 1.37e-89 280 38 9 416 3 pepT Peptidase T Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8AHU0 3.1e-89 279 39 9 414 3 pepT Peptidase T Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q9CP05 3.49e-89 279 38 9 413 3 pepT Peptidase T Pasteurella multocida (strain Pm70)
A4VVF5 2.55e-88 276 37 6 404 3 pepT Peptidase T Streptococcus suis (strain 05ZYH33)
A4W1Q9 2.55e-88 276 37 6 404 3 pepT Peptidase T Streptococcus suis (strain 98HAH33)
B1KHS7 2.07e-87 274 39 6 411 3 pepT Peptidase T Shewanella woodyi (strain ATCC 51908 / MS32)
Q6GIP8 4.87e-87 273 38 8 412 3 pepT Peptidase T Staphylococcus aureus (strain MRSA252)
Q8CWX9 4.95e-87 273 35 5 404 3 pepT Peptidase T Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8NXM6 1.79e-86 271 38 7 404 3 pepT Peptidase T Staphylococcus aureus (strain MW2)
A8Z018 1.79e-86 271 38 7 404 3 pepT Peptidase T Staphylococcus aureus (strain USA300 / TCH1516)
Q6GB87 1.79e-86 271 38 7 404 3 pepT Peptidase T Staphylococcus aureus (strain MSSA476)
A6QF52 1.79e-86 271 38 7 404 3 pepT Peptidase T Staphylococcus aureus (strain Newman)
Q5HHS7 1.79e-86 271 38 7 404 3 pepT Peptidase T Staphylococcus aureus (strain COL)
Q2G064 1.79e-86 271 38 7 404 3 pepT Peptidase T Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIP8 1.79e-86 271 38 7 404 3 pepT Peptidase T Staphylococcus aureus (strain USA300)
B5XKT3 1.86e-86 271 36 7 406 3 pepT Peptidase T Streptococcus pyogenes serotype M49 (strain NZ131)
Q9L4G1 2.08e-86 271 36 6 414 1 pepT Peptidase T Lactobacillus helveticus
C0MGM6 2.41e-86 271 36 7 405 3 pepT Peptidase T Streptococcus equi subsp. zooepidemicus (strain H70)
C0M8H1 2.41e-86 271 36 7 405 3 pepT Peptidase T Streptococcus equi subsp. equi (strain 4047)
P65806 2.64e-86 271 38 8 408 3 pepT Peptidase T Staphylococcus aureus (strain N315)
P65805 2.64e-86 271 38 8 408 3 pepT Peptidase T Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQU7 2.64e-86 271 38 8 408 3 pepT Peptidase T Staphylococcus aureus (strain JH9)
A6TZM2 2.64e-86 271 38 8 408 3 pepT Peptidase T Staphylococcus aureus (strain JH1)
A7WZN6 2.64e-86 271 38 8 408 3 pepT Peptidase T Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5XCU7 4.35e-86 271 35 7 406 3 pepT Peptidase T Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
C1CE02 6.69e-86 270 36 6 405 3 pepT Peptidase T Streptococcus pneumoniae (strain JJA)
Q49VU2 7.47e-86 270 38 8 402 3 pepT Peptidase T Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8P1H9 8.76e-86 270 35 7 406 3 pepT Peptidase T Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q1JHK2 8.95e-86 270 35 7 406 3 pepT Peptidase T Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q2YSI6 9.73e-86 270 38 6 407 3 pepT Peptidase T Staphylococcus aureus (strain bovine RF122 / ET3-1)
C1C6Y4 1.2e-85 270 36 6 405 3 pepT Peptidase T Streptococcus pneumoniae (strain 70585)
C1CK88 1.21e-85 270 36 6 405 3 pepT Peptidase T Streptococcus pneumoniae (strain P1031)
Q48U99 1.22e-85 270 35 7 406 3 pepT Peptidase T Streptococcus pyogenes serotype M28 (strain MGAS6180)
B2IPG2 1.35e-85 270 35 6 405 3 pepT Peptidase T Streptococcus pneumoniae (strain CGSP14)
A2RF89 1.57e-85 269 35 7 406 3 pepT Peptidase T Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J7C3 1.57e-85 269 35 7 406 3 pepT Peptidase T Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JMF5 1.58e-85 269 35 7 406 3 pepT Peptidase T Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JCH7 1.58e-85 269 35 7 406 3 pepT Peptidase T Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0DD01 1.6e-85 269 35 7 406 3 pepT Peptidase T Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DD00 1.6e-85 269 35 7 406 3 pepT Peptidase T Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q97R31 2.63e-85 269 35 6 405 3 pepT Peptidase T Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8DQ05 3.13e-85 268 35 6 405 3 pepT Peptidase T Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04KS5 3.13e-85 268 35 6 405 3 pepT Peptidase T Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B1IBG7 3.37e-85 268 35 6 405 3 pepT Peptidase T Streptococcus pneumoniae (strain Hungary19A-6)
C1CRC4 3.79e-85 268 35 6 405 3 pepT Peptidase T Streptococcus pneumoniae (strain Taiwan19F-14)
B8ZPG1 7.55e-85 268 36 6 405 3 pepT Peptidase T Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q84BV2 1.93e-84 266 35 6 413 1 pepT Peptidase T Lactococcus lactis subsp. hordniae
Q9A0F4 3.03e-84 266 35 7 406 3 pepT Peptidase T Streptococcus pyogenes serotype M1
Q8E4E2 3.61e-84 266 35 6 404 3 pepT Peptidase T Streptococcus agalactiae serotype III (strain NEM316)
Q8DYT4 6.32e-84 265 35 6 404 3 pepT Peptidase T Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q02X44 7.66e-84 265 35 6 408 3 pepT Peptidase T Lactococcus lactis subsp. cremoris (strain SK11)
A2RMN0 7.66e-84 265 35 6 408 3 pepT Peptidase T Lactococcus lactis subsp. cremoris (strain MG1363)
Q76HM7 7.66e-84 265 35 6 408 1 pepT Peptidase T Lactococcus lactis subsp. cremoris
P0C2T7 9.5e-84 265 35 6 408 1 pepT Peptidase T Lactococcus lactis subsp. cremoris
A3CNH0 1.34e-83 264 35 6 406 3 pepT Peptidase T Streptococcus sanguinis (strain SK36)
Q76HM5 1.46e-83 264 35 6 413 1 pepT Peptidase T Lactococcus lactis subsp. lactis
Q9CEM7 1.46e-83 264 35 6 413 3 pepT Peptidase T Lactococcus lactis subsp. lactis (strain IL1403)
A8G0I7 3.73e-83 263 38 7 412 3 pepT Peptidase T Shewanella sediminis (strain HAW-EB3)
Q3K0C3 5.67e-83 263 35 6 404 3 pepT Peptidase T Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q03KI4 2.24e-82 261 36 7 406 3 pepT Peptidase T Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M465 2.81e-82 261 37 7 406 3 pepT Peptidase T Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LZL2 2.81e-82 261 37 7 406 3 pepT Peptidase T Streptococcus thermophilus (strain CNRZ 1066)
A8AXT3 2.14e-81 259 34 5 405 3 pepT Peptidase T Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8CPZ6 8.53e-81 257 35 8 410 3 pepT Peptidase T Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQY6 8.53e-81 257 35 8 410 3 pepT Peptidase T Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4QK58 7.08e-80 255 37 8 404 3 pepT Peptidase T Haemophilus influenzae (strain 86-028NP)
A5UEI5 1.09e-79 254 37 8 404 3 pepT Peptidase T Haemophilus influenzae (strain PittGG)
P45172 1.22e-79 254 37 8 404 3 pepT Peptidase T Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UBV7 3e-78 251 37 8 404 3 pepT Peptidase T Haemophilus influenzae (strain PittEE)
P54542 1.03e-18 90 25 7 281 3 yqjE Uncharacterized protein YqjE Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS13165
Feature type CDS
Gene pepT
Product peptidase T
Location 250943 - 252190 (strand: 1)
Length 1248 (nucleotides) / 415 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000003
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3865
Orthogroup size 2
N. genomes 2

Actions

Genomic region

Domains

PF01546 Peptidase family M20/M25/M40
PF07687 Peptidase dimerisation domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2195 Amino acid transport and metabolism (E) E Di- or tripeptidase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01258 tripeptide aminopeptidase [EC:3.4.11.4] - -

Protein Sequence

MNIVDRFIAYTKINTTTDREKGAAGIMPSSEGQRVLAKQLVQELEGLGLTDIKLRDTAIVTATLPSNLDYDVPAVAFFGHLDTSAEQTNDTHAQILPYTGDDICMNKELGIYLRKSEFPELADYLGDDIIVTDGTSLLGADDKAAIASIMDMLQYFKQNPQIKHGTVKVGFVPDEEQGLRGAKVFDVKEFGADFAYTLDCCGIGELVYENWNAGDAEIVFTGKSAHPMSAKGKLKNSLLMAHKFIAMLPGGEAPEYTEGREGYYWVKQLSGNSARTVLKMDVRDFTETGYQSRMAFLKQLAEQCDALWGEGSVAISLADRYSNVFNSLQGENGYPVDIAKAAYRACGIEPKVIPMRGGYDGAALSQNGLPCPNIFTGAHNFHSIYEYLPVKSLYAASDVLKNVVTLTASRFKPGV

Flanking regions ( +/- flanking 50bp)

TTGAATGAATAAGGGTATACATCACATTACGCAGCCGGAGAATAACAATAATGAACATCGTTGACCGCTTTATTGCCTACACAAAAATTAATACAACGACAGACAGGGAAAAAGGCGCAGCGGGTATTATGCCGTCTTCTGAGGGCCAGCGCGTACTGGCAAAGCAATTAGTGCAGGAACTGGAAGGGCTGGGACTCACCGACATCAAACTGCGTGATACTGCTATTGTCACTGCAACACTGCCGTCAAATCTGGATTATGACGTGCCTGCGGTCGCGTTTTTCGGACATCTGGATACCAGTGCAGAACAAACTAATGATACACACGCACAAATTTTGCCGTATACCGGTGATGATATCTGCATGAATAAAGAGCTGGGTATTTATCTGCGTAAAAGTGAATTCCCGGAACTGGCGGATTATCTGGGCGACGATATTATTGTGACCGACGGCACCAGTCTGCTTGGCGCAGATGATAAAGCCGCCATTGCATCCATTATGGACATGCTTCAATACTTTAAACAGAATCCTCAGATAAAACACGGTACAGTAAAAGTCGGCTTTGTTCCAGATGAAGAACAAGGTCTGCGCGGTGCGAAAGTGTTTGATGTTAAAGAGTTCGGTGCCGATTTTGCGTATACCCTCGACTGCTGCGGTATCGGCGAACTGGTATATGAAAACTGGAATGCCGGTGATGCTGAAATCGTTTTCACCGGAAAGTCCGCACACCCGATGTCCGCAAAAGGCAAACTGAAGAATTCACTGCTGATGGCGCATAAATTCATTGCTATGCTGCCGGGCGGCGAAGCACCTGAGTATACAGAAGGTCGTGAGGGTTATTACTGGGTAAAACAACTATCCGGAAACAGCGCGCGTACCGTACTGAAAATGGATGTGCGTGACTTTACCGAAACCGGTTATCAGAGCCGGATGGCCTTTCTGAAACAGTTAGCTGAGCAGTGTGATGCACTCTGGGGTGAAGGCAGTGTGGCGATTTCACTGGCTGATCGCTATTCCAATGTATTCAACAGCCTGCAGGGCGAAAATGGTTATCCTGTGGATATTGCCAAAGCGGCTTACCGCGCCTGCGGTATTGAGCCGAAAGTTATCCCGATGCGCGGTGGTTACGATGGCGCAGCGCTGTCACAAAATGGTCTGCCGTGCCCGAATATTTTTACCGGCGCTCATAACTTCCATTCAATTTATGAATACCTGCCGGTAAAATCACTGTATGCCGCAAGCGATGTACTGAAAAACGTCGTGACACTGACCGCTTCCCGCTTTAAGCCGGGGGTCTGAGTATGCTCCCGATTCTGGCTGTTCTTGTCGTCATTATCCTTGTTGCCCGT