Homologs in group_2404

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19270 FBDBKF_19270 92.7 Morganella morganii S1 hybA hydrogenase 2 operon protein HybA
EHELCC_07555 EHELCC_07555 92.7 Morganella morganii S2 hybA hydrogenase 2 operon protein HybA
NLDBIP_07880 NLDBIP_07880 92.7 Morganella morganii S4 hybA hydrogenase 2 operon protein HybA
LHKJJB_07415 LHKJJB_07415 92.7 Morganella morganii S3 hybA hydrogenase 2 operon protein HybA
HKOGLL_03515 HKOGLL_03515 92.7 Morganella morganii S5 hybA hydrogenase 2 operon protein HybA
PMI_RS00155 PMI_RS00155 72.6 Proteus mirabilis HI4320 hybA hydrogenase 2 operon protein HybA

Distribution of the homologs in the orthogroup group_2404

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2404

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AAK0 0.0 584 84 1 328 3 hybA Hydrogenase-2 operon protein HybA Shigella flexneri
P0AAJ8 0.0 584 84 1 328 3 hybA Hydrogenase-2 operon protein HybA Escherichia coli (strain K12)
P0AAJ9 0.0 584 84 1 328 3 hybA Hydrogenase-2 operon protein HybA Escherichia coli O157:H7
P33389 9.36e-45 159 33 10 325 4 DVU_0535 Protein DVU_0535 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
P0AAJ7 4.12e-29 116 30 11 294 3 fdoH Formate dehydrogenase-O iron-sulfur subunit Shigella flexneri
P0AAJ5 4.12e-29 116 30 11 294 1 fdoH Formate dehydrogenase-O iron-sulfur subunit Escherichia coli (strain K12)
P0AAJ6 4.12e-29 116 30 11 294 3 fdoH Formate dehydrogenase-O iron-sulfur subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P45015 7.1e-29 114 31 7 217 3 nrfC Protein NrfC homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AAK9 1.41e-28 113 32 11 254 3 nrfC Protein NrfC Shigella flexneri
P0AAK7 1.41e-28 113 32 11 254 3 nrfC Protein NrfC Escherichia coli (strain K12)
P0AAK8 1.41e-28 113 32 11 254 3 nrfC Protein NrfC Escherichia coli O157:H7
P44450 4.15e-27 111 26 7 306 3 fdxH Formate dehydrogenase iron-sulfur subunit Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AAJ4 2.91e-26 108 25 8 312 3 fdnH Formate dehydrogenase, nitrate-inducible, iron-sulfur subunit Shigella flexneri
P0AAJ3 2.91e-26 108 25 8 312 1 fdnH Formate dehydrogenase, nitrate-inducible, iron-sulfur subunit Escherichia coli (strain K12)
D3RNN7 9.69e-25 103 34 5 181 1 soeB Sulfite dehydrogenase subunit B Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
P0A1I1 1.26e-21 93 33 9 198 1 phsB Thiosulfate reductase electron transfer subunit PhsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1I2 1.26e-21 93 33 9 198 3 phsB Thiosulfate reductase electron transfer subunit PhsB Salmonella typhi
P45003 1.32e-21 94 31 6 182 3 dmsB Anaerobic dimethyl sulfoxide reductase chain B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AAJ1 2.61e-21 93 35 7 172 3 ynfG Probable anaerobic dimethyl sulfoxide reductase chain YnfG Escherichia coli (strain K12)
P0AAJ2 2.61e-21 93 35 7 172 3 ynfG Probable anaerobic dimethyl sulfoxide reductase chain YnfG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q72E85 3.37e-21 94 31 5 200 1 qrcC Menaquinone reductase, iron-sulfur cluster-binding subunit Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
P77375 1.21e-20 92 31 11 233 2 ydhX Uncharacterized ferredoxin-like protein YdhX Escherichia coli (strain K12)
Q8X616 3.55e-20 90 31 11 229 3 ydhX Uncharacterized ferredoxin-like protein YdhX Escherichia coli O157:H7
P31076 7.08e-20 89 32 7 198 4 psrB Polysulfide reductase chain B Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q9HR73 1.58e-19 89 30 5 199 2 dmsB Putative dimethyl sulfoxide reductase iron-sulfur subunit B Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P18776 4.39e-19 87 34 7 172 1 dmsB Anaerobic dimethyl sulfoxide reductase chain B Escherichia coli (strain K12)
Q83RZ7 4.81e-19 87 34 7 172 3 dmsB Anaerobic dimethyl sulfoxide reductase chain B Shigella flexneri
Q7CQM9 8.91e-17 81 31 9 223 1 ttrB Tetrathionate reductase subunit B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O30080 2.48e-14 73 40 4 105 3 ttrB Tetrathionate reductase subunit B Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q727P4 4.32e-14 73 27 8 205 1 DVU_2811 Formate dehydrogenase 2 subunit beta (cytochrome c-553) Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
O29751 4.68e-14 74 34 4 141 1 hmeA Hdr-like menaquinol oxidoreductase iron-sulfur subunit 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q7WTT9 5.55e-13 70 26 6 230 1 arrB Arsenate respiratory reductase iron-sulfur subunit ArrB Shewanella sp. (strain ANA-3)
P27273 1.41e-11 66 25 6 192 1 fdhB1 Formate dehydrogenase iron-sulfur subunit Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8L3A9 1.63e-11 68 27 5 174 1 padI NADH-dependent phenylglyoxylate dehydrogenase subunit beta Aromatoleum evansii
P60069 4.66e-11 66 33 3 123 1 clrB Chlorate reductase subunit beta Ideonella dechloratans
Q83RN5 8.26e-11 66 31 3 125 3 narH Respiratory nitrate reductase 1 beta chain Shigella flexneri
P11349 8.26e-11 66 31 3 125 1 narH Respiratory nitrate reductase 1 beta chain Escherichia coli (strain K12)
Q9S1G9 1.65e-10 64 33 2 105 1 serB Selenate reductase subunit beta Thauera selenatis
P19318 2.03e-10 65 34 2 91 1 narY Respiratory nitrate reductase 2 beta chain Escherichia coli (strain K12)
Q8GC87 2.15e-10 63 25 8 193 1 fdhB Formate dehydrogenase subunit beta Megalodesulfovibrio gigas (strain ATCC 19364 / DSM 1382 / NCIMB 9332 / VKM B-1759)
I3R9M8 3.16e-10 63 34 3 120 1 narH Respiratory nitrate reductase subunit beta Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
Q8GPG3 7.79e-10 62 23 7 221 1 ddhB Dimethylsulfide dehydrogenase subunit beta Rhodovulum sulfidophilum
Q47CW7 1.25e-09 62 31 4 130 1 pcrB Perchlorate reductase subunit beta Dechloromonas aromatica (strain RCB)
P42176 1.48e-09 62 34 2 91 3 narH Nitrate reductase beta chain Bacillus subtilis (strain 168)
Q46820 1.11e-08 60 28 6 160 2 uacF Putative oxidoreductase UacF Escherichia coli (strain K12)
P0AAK3 3.94e-08 56 23 8 219 3 hycB Formate hydrogenlyase subunit 2 Shigella flexneri
P0AAK1 3.94e-08 56 23 8 219 1 hycB Formate hydrogenlyase subunit 2 Escherichia coli (strain K12)
P0AAK2 3.94e-08 56 23 8 219 3 hycB Formate hydrogenlyase subunit 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P20925 6.71e-08 54 27 6 133 4 None Frd operon probable iron-sulfur subunit A (Fragment) Proteus vulgaris
P0AAK4 7.5e-08 55 32 6 125 3 hydN Electron transport protein HydN Escherichia coli (strain K12)
P0AAK5 7.5e-08 55 32 6 125 3 hydN Electron transport protein HydN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAK6 7.5e-08 55 32 6 125 3 hydN Electron transport protein HydN Escherichia coli O157:H7
Q57619 9.29e-08 54 30 7 142 3 MJ0155 Uncharacterized ferredoxin MJ0155 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P56256 1.17e-07 53 26 6 165 4 ysaA Putative electron transport protein YsaA Escherichia coli (strain K12)
Q57713 1.77e-07 53 30 5 141 3 MJ0265 Uncharacterized ferredoxin MJ0265 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P0AAL8 2.34e-07 53 27 2 104 4 ydhY Uncharacterized ferredoxin-like protein YdhY Shigella flexneri
P0AAL6 2.34e-07 53 27 2 104 2 ydhY Uncharacterized ferredoxin-like protein YdhY Escherichia coli (strain K12)
P0AAL7 2.34e-07 53 27 2 104 4 ydhY Uncharacterized ferredoxin-like protein YdhY Escherichia coli O157:H7
P37127 4.17e-07 55 24 8 194 2 aegA Putative oxidoreductase AegA Escherichia coli (strain K12)
Q46819 5.31e-07 52 31 4 109 4 ygfS Putative electron transport protein YgfS Escherichia coli (strain K12)
Q57712 1.52e-06 50 35 3 92 3 MJ0264 Uncharacterized protein MJ0264 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P31894 2.56e-05 47 26 7 179 1 cooF Iron-sulfur protein Rhodospirillum rubrum
P85098 3.44e-05 48 25 5 159 1 narH Respiratory nitrate reductase beta chain (Fragments) Bradyrhizobium sp.
P23481 0.000542 43 23 4 147 2 hyfA Hydrogenase-4 component A Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS12030
Feature type CDS
Gene hybA
Product hydrogenase 2 operon protein HybA
Location 560368 - 561351 (strand: 1)
Length 984 (nucleotides) / 327 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2404
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF13247 4Fe-4S dicluster domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0437 Energy production and conversion (C) C Fe-S-cluster-containing dehydrogenase component (DMSO reductase)

Kegg Ortholog Annotation(s)

Protein Sequence

MNRRDFIKVASGGALLLGSSSAGHAAAENRPPIPGSLGMLYDSTLCIGCQACVTKCQDINFPGRNPQGKQIWSNNDKLSPYTNNIIQVWQSGTGEHKDQEKDGYAYIKKQCMHCVDPNCVSVCPVGALKKHPVTGIVHYDKDVCTGCRYCMVGCPFDVPKYDYDNPFGMIHKCELCNQKGVELLDKGRLPGCVDVCPTGAIIFGSREDLMSEAKKRLGLNAGEEYRYPRQTLKTGDEYKHTVPSYYPHLYGEKEGGGTQVMVLTGVPYKNLQLPELAELSTGARSENIQHTLYKGMILPLAVLAGLTVLVRRNTKNDHHDGGDDHES

Flanking regions ( +/- flanking 50bp)

GGGCGTCAGCAAAAGAAAAATGATGCTGACTCGCCGCGGGGAGAGTAACTGTGAACAGGCGTGACTTTATTAAAGTAGCCTCCGGCGGGGCTTTGCTTCTGGGGAGTTCCTCCGCAGGTCATGCGGCGGCAGAAAACCGCCCGCCGATCCCGGGCTCGCTCGGCATGCTCTATGACTCAACATTGTGTATCGGCTGCCAGGCCTGTGTGACAAAGTGCCAGGATATCAACTTTCCGGGGCGTAACCCGCAGGGTAAACAGATCTGGTCCAACAATGACAAACTGTCACCGTACACTAACAATATTATTCAGGTGTGGCAGAGCGGTACGGGTGAGCACAAAGATCAGGAAAAAGACGGTTATGCCTACATCAAAAAACAATGTATGCATTGCGTTGATCCTAACTGTGTCTCTGTCTGTCCGGTCGGCGCACTGAAAAAACATCCGGTCACCGGCATCGTGCATTATGACAAAGATGTCTGTACCGGGTGTCGTTACTGCATGGTCGGCTGTCCGTTTGATGTGCCGAAATATGATTACGACAATCCGTTCGGGATGATCCACAAGTGTGAGCTGTGCAATCAGAAAGGCGTGGAACTGCTGGATAAAGGCAGATTGCCCGGCTGTGTGGACGTGTGTCCGACCGGTGCGATTATTTTCGGCTCCCGCGAAGACCTGATGAGTGAAGCCAAAAAACGTCTCGGACTGAACGCAGGCGAGGAGTACCGCTATCCGCGCCAGACCCTGAAAACCGGCGATGAGTATAAACACACCGTACCTTCTTACTACCCGCATCTTTACGGGGAAAAAGAGGGCGGCGGTACTCAGGTGATGGTGCTGACCGGCGTGCCGTATAAAAATCTGCAATTACCTGAACTGGCTGAACTTTCAACCGGCGCCCGCTCGGAAAATATCCAGCACACCCTTTATAAAGGCATGATCCTGCCGCTTGCTGTTCTGGCGGGTCTGACAGTGCTGGTACGCCGCAATACCAAAAACGACCATCATGACGGAGGGGATGACCATGAGTCATGATCCTAAACCACTGGGCGGAAAATTATTCAGTAAGCCGATCATCATTTTCG