Homologs in group_823

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03350 FBDBKF_03350 100.0 Morganella morganii S1 mreB rod shape-determining protein MreB
EHELCC_07185 EHELCC_07185 100.0 Morganella morganii S2 mreB rod shape-determining protein MreB
NLDBIP_07510 NLDBIP_07510 100.0 Morganella morganii S4 mreB rod shape-determining protein MreB
LHKJJB_07045 LHKJJB_07045 100.0 Morganella morganii S3 mreB rod shape-determining protein MreB
HKOGLL_03885 HKOGLL_03885 100.0 Morganella morganii S5 mreB rod shape-determining protein MreB
PMI_RS18065 PMI_RS18065 94.8 Proteus mirabilis HI4320 mreB rod shape-determining protein MreB

Distribution of the homologs in the orthogroup group_823

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_823

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9X8 0.0 660 94 0 347 3 mreB Cell shape-determining protein MreB Shigella flexneri
P0A9X6 0.0 660 94 0 347 3 mreB Cell shape-determining protein MreB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A9X7 0.0 660 94 0 347 3 mreB Cell shape-determining protein MreB Salmonella typhi
P0A9X4 0.0 660 94 0 347 1 mreB Cell shape-determining protein MreB Escherichia coli (strain K12)
P0A9X5 0.0 660 94 0 347 3 mreB Cell shape-determining protein MreB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P44474 0.0 563 79 1 349 3 mreB Cell shape-determining protein MreB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9L6A3 0.0 563 79 1 349 3 mreB Cell shape-determining protein MreB Pasteurella multocida (strain Pm70)
A0A0H3C7V4 7.98e-141 405 63 5 337 1 mreB Cell shape-determining protein MreB Caulobacter vibrioides (strain NA1000 / CB15N)
Q01465 1.18e-130 379 57 3 335 1 mreB Cell shape-determining protein MreB Bacillus subtilis (strain 168)
P39751 1.97e-122 358 53 2 330 1 mbl Cell shape-determining protein Mbl Bacillus subtilis (strain 168)
P32444 4.67e-121 355 54 3 330 3 mbl Cell shape-determining protein Mbl Bacillus cereus (strain ATCC 10987 / NRS 248)
P39763 1.91e-115 340 52 4 334 1 mreBH Cell shape-determining protein MreBH Bacillus subtilis (strain 168)
Q67S54 3.97e-13 73 26 8 219 3 dnaK Chaperone protein DnaK Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q9HHB9 4.95e-13 73 29 8 223 3 dnaK Chaperone protein DnaK Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
O87777 5.22e-13 73 29 9 220 2 dnaK Chaperone protein DnaK Latilactobacillus sakei
Q38W93 5.41e-13 73 29 9 220 3 dnaK Chaperone protein DnaK Latilactobacillus sakei subsp. sakei (strain 23K)
B9LUC7 6.49e-13 73 27 8 224 3 dnaK Chaperone protein DnaK Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
Q89A16 9.27e-13 72 25 9 238 3 hscA Chaperone protein HscA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O51883 1.56e-12 72 26 9 238 3 hscA Chaperone protein HscA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q465Y6 3.11e-12 71 28 8 227 3 dnaK Chaperone protein DnaK Methanosarcina barkeri (strain Fusaro / DSM 804)
Q4AAR4 3.19e-12 71 28 9 214 3 dnaK Chaperone protein DnaK Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q49539 3.19e-12 71 28 9 214 3 dnaK Chaperone protein DnaK Mesomycoplasma hyopneumoniae (strain 232)
Q4A8U5 3.25e-12 70 28 9 214 3 dnaK Chaperone protein DnaK Mesomycoplasma hyopneumoniae (strain 7448)
Q3IUI0 3.51e-12 70 26 6 223 3 dnaK Chaperone protein DnaK Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q05866 5.3e-12 70 25 10 239 1 BIP Endoplasmic reticulum chaperone BIP Plasmodium falciparum (isolate NF54)
B9MJZ1 5.63e-12 70 25 8 327 3 dnaK Chaperone protein DnaK Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q6MT06 6.77e-12 70 26 7 213 3 dnaK Chaperone protein DnaK Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q2SSB0 6.83e-12 70 26 7 213 3 dnaK Chaperone protein DnaK Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
B0TAD7 6.99e-12 70 26 4 212 3 dnaK Chaperone protein DnaK Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
P36604 1.05e-11 69 30 2 124 3 bip1 Endoplasmic reticulum chaperone BiP Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q3AF08 1.12e-11 69 27 4 214 3 dnaK Chaperone protein DnaK Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A0A509AJG0 1.23e-11 69 26 8 199 1 BIP Endoplasmic reticulum chaperone BIP Plasmodium berghei (strain Anka)
C5D4U1 1.51e-11 68 27 6 218 3 dnaK Chaperone protein DnaK Geobacillus sp. (strain WCH70)
A4XKA4 1.56e-11 68 25 12 377 3 dnaK Chaperone protein DnaK Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
C0ZB48 2.25e-11 68 26 7 211 3 dnaK Chaperone protein DnaK Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q8Z4N2 2.86e-11 68 26 8 256 3 hscA Chaperone protein HscA Salmonella typhi
B5BAX0 3.08e-11 68 26 8 256 3 hscA Chaperone protein HscA Salmonella paratyphi A (strain AKU_12601)
Q5PNH1 3.08e-11 68 26 8 256 3 hscA Chaperone protein HscA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T0R8 3.08e-11 68 26 8 256 3 hscA Chaperone protein HscA Salmonella newport (strain SL254)
B9DNK0 3.4e-11 67 28 8 217 3 dnaK Chaperone protein DnaK Staphylococcus carnosus (strain TM300)
Q45551 3.53e-11 67 27 6 210 3 dnaK Chaperone protein DnaK Geobacillus stearothermophilus
Q9ZEJ0 3.72e-11 67 25 9 247 3 dnaK Chaperone protein DnaK Metamycoplasma hominis
Q5KWZ7 3.72e-11 67 27 5 219 1 dnaK Chaperone protein DnaK Geobacillus kaustophilus (strain HTA426)
A4IR31 3.89e-11 67 27 6 219 3 dnaK Chaperone protein DnaK Geobacillus thermodenitrificans (strain NG80-2)
C0PYL1 3.89e-11 67 26 8 247 3 hscA Chaperone protein HscA Salmonella paratyphi C (strain RKS4594)
B5RD08 3.89e-11 67 26 8 247 3 hscA Chaperone protein HscA Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R598 3.89e-11 67 26 8 247 3 hscA Chaperone protein HscA Salmonella enteritidis PT4 (strain P125109)
B5FR81 3.89e-11 67 26 8 247 3 hscA Chaperone protein HscA Salmonella dublin (strain CT_02021853)
B4TRB1 4.04e-11 67 26 8 247 3 hscA Chaperone protein HscA Salmonella schwarzengrund (strain CVM19633)
B4TDB2 4.04e-11 67 26 8 247 3 hscA Chaperone protein HscA Salmonella heidelberg (strain SL476)
Q1WUE8 4.26e-11 67 27 9 218 3 dnaK Chaperone protein DnaK Ligilactobacillus salivarius (strain UCC118)
C4L425 4.89e-11 67 27 9 212 3 dnaK Chaperone protein DnaK Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q4A658 5.01e-11 67 26 7 215 3 dnaK Chaperone protein DnaK Mycoplasmopsis synoviae (strain 53)
Q5N0G0 5.22e-11 67 25 9 240 3 dnaK3 Chaperone protein DnaK 3 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
B9E6X1 5.85e-11 67 27 7 215 3 dnaK Chaperone protein DnaK Macrococcus caseolyticus (strain JCSC5402)
Q8CP17 6.13e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNW6 6.64e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P64408 6.71e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain MW2)
A8Z4B9 6.71e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8Y7 6.71e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain MSSA476)
Q6GGC0 6.71e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain MRSA252)
P99110 6.71e-11 67 27 8 213 1 dnaK Chaperone protein DnaK Staphylococcus aureus (strain N315)
P64407 6.71e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHC3 6.71e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain Newman)
Q5HFI0 6.71e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain COL)
A5ITA8 6.71e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain JH9)
Q2FXZ2 6.71e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGE3 6.71e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain USA300)
A6U252 6.71e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain JH1)
A7X2Y1 6.71e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YT47 6.83e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain bovine RF122 / ET3-1)
P45554 6.89e-11 67 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus aureus
Q9KWS7 7.26e-11 67 26 5 214 3 dnaK Chaperone protein DnaK Parageobacillus thermoglucosidasius
Q8ZN42 7.72e-11 67 26 9 247 3 hscA Chaperone protein HscA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q049W6 7.92e-11 66 28 8 214 3 dnaK Chaperone protein DnaK Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9R2 7.92e-11 66 28 8 214 3 dnaK Chaperone protein DnaK Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q9LCQ5 8.11e-11 66 27 8 211 3 dnaK Chaperone protein DnaK Brevibacillus choshinensis
A7Z6W1 8.12e-11 66 28 9 215 3 dnaK Chaperone protein DnaK Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q2RKX4 9.13e-11 66 25 7 227 3 dnaK Chaperone protein DnaK Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B1HUD1 9.29e-11 66 28 7 212 3 dnaK Chaperone protein DnaK Lysinibacillus sphaericus (strain C3-41)
P05646 1.19e-10 66 29 8 212 3 dnaK Chaperone protein DnaK Priestia megaterium
B5F1B6 1.2e-10 66 26 8 247 3 hscA Chaperone protein HscA Salmonella agona (strain SL483)
A9N1X9 1.26e-10 66 27 9 249 3 hscA Chaperone protein HscA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A9MHJ8 1.28e-10 66 25 7 247 3 hscA Chaperone protein HscA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q6NEY9 1.39e-10 65 25 7 220 3 dnaK Chaperone protein DnaK Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
B7GKC8 1.46e-10 65 27 7 219 3 dnaK Chaperone protein DnaK Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A8YVQ3 1.6e-10 65 26 8 220 3 dnaK Chaperone protein DnaK Lactobacillus helveticus (strain DPC 4571)
P17820 1.93e-10 65 28 9 215 1 dnaK Chaperone protein DnaK Bacillus subtilis (strain 168)
Q49Y22 2.04e-10 65 28 8 213 3 dnaK Chaperone protein DnaK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5PAB8 2.05e-10 65 25 10 276 3 dnaK Chaperone protein DnaK Anaplasma marginale (strain St. Maries)
O69268 2.11e-10 65 28 7 212 3 dnaK Chaperone protein DnaK Lysinibacillus sphaericus
Q9PQF2 2.13e-10 65 26 7 215 3 dnaK Chaperone protein DnaK Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIX8 2.13e-10 65 26 7 215 3 dnaK Chaperone protein DnaK Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
B8CXL1 2.24e-10 65 25 7 252 3 dnaK Chaperone protein DnaK Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B8DYH6 2.63e-10 65 26 8 227 3 dnaK Chaperone protein DnaK Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q65H54 3.08e-10 65 29 9 213 3 dnaK Chaperone protein DnaK Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8EPW4 3.25e-10 65 26 9 219 3 dnaK Chaperone protein DnaK Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q4L6T0 3.33e-10 64 27 8 213 3 dnaK Chaperone protein DnaK Staphylococcus haemolyticus (strain JCSC1435)
B8I305 3.7e-10 64 25 5 212 3 dnaK Chaperone protein DnaK Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q18GZ4 3.8e-10 64 26 7 220 3 dnaK Chaperone protein DnaK Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
B5YAR3 3.9e-10 64 27 8 213 3 dnaK Chaperone protein DnaK Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
B5ZBE9 3.92e-10 64 24 15 345 3 dnaK Chaperone protein DnaK Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
B0K3Y0 3.99e-10 64 24 8 254 3 dnaK Chaperone protein DnaK Thermoanaerobacter sp. (strain X514)
A8FFD2 4.18e-10 64 28 8 212 3 dnaK Chaperone protein DnaK Bacillus pumilus (strain SAFR-032)
Q6F149 4.41e-10 64 23 13 359 3 dnaK Chaperone protein DnaK Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q88VM0 4.57e-10 64 27 9 220 3 dnaK Chaperone protein DnaK Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A7GT08 5.18e-10 64 26 7 213 3 dnaK Chaperone protein DnaK Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B0KA81 5.52e-10 64 24 8 254 3 dnaK Chaperone protein DnaK Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A4QHJ0 5.55e-10 64 25 7 220 3 dnaK Chaperone protein DnaK Corynebacterium glutamicum (strain R)
Q8RB68 5.69e-10 64 25 8 254 3 dnaK Chaperone protein DnaK Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8NLY6 6.01e-10 63 25 7 220 3 dnaK Chaperone protein DnaK Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P50020 6.47e-10 63 25 9 240 3 dnaK1 Chaperone protein dnaK1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8EUH7 6.48e-10 63 25 8 213 3 dnaK Chaperone protein DnaK Malacoplasma penetrans (strain HF-2)
Q8KML6 7.11e-10 63 27 9 218 3 dnaK Chaperone protein DnaK Fructilactobacillus sanfranciscensis
A6LRN4 8.21e-10 63 25 9 217 3 dnaK Chaperone protein DnaK Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q74IT6 8.65e-10 63 26 8 218 3 dnaK Chaperone protein DnaK Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q9UXR0 8.87e-10 63 27 9 215 3 dnaK Chaperone protein DnaK Methanosarcina thermophila
Q85FW4 9e-10 63 24 7 239 3 dnaK Chaperone protein dnaK Cyanidioschyzon merolae (strain NIES-3377 / 10D)
O27351 9.24e-10 63 23 14 366 3 dnaK Chaperone protein DnaK Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B1MZG6 1.05e-09 63 27 8 218 3 dnaK Chaperone protein DnaK Leuconostoc citreum (strain KM20)
B1I699 1.05e-09 63 33 1 99 3 dnaK Chaperone protein DnaK Desulforudis audaxviator (strain MP104C)
Q8FM78 1.09e-09 63 25 7 220 3 dnaK Chaperone protein DnaK Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q71ZJ7 1.3e-09 63 25 7 206 3 dnaK Chaperone protein DnaK Listeria monocytogenes serotype 4b (strain F2365)
C1KVC0 1.3e-09 63 25 7 206 3 dnaK Chaperone protein DnaK Listeria monocytogenes serotype 4b (strain CLIP80459)
A9KKU0 1.31e-09 63 24 14 367 3 dnaK Chaperone protein DnaK Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q92BN8 1.32e-09 63 25 7 206 3 dnaK Chaperone protein DnaK Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q044A9 1.34e-09 63 26 8 218 3 dnaK Chaperone protein DnaK Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
P0DJM2 1.38e-09 63 25 7 206 3 dnaK Chaperone protein DnaK Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
G2K046 1.38e-09 63 25 7 206 3 dnaK Chaperone protein DnaK Listeria monocytogenes serotype 1/2a (strain 10403S)
Q0SRE3 1.41e-09 62 24 8 252 3 dnaK Chaperone protein DnaK Clostridium perfringens (strain SM101 / Type A)
B8DE38 1.44e-09 62 25 7 206 3 dnaK Chaperone protein DnaK Listeria monocytogenes serotype 4a (strain HCC23)
Q84BU4 1.47e-09 62 26 9 221 3 dnaK Chaperone protein DnaK Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B1YKS9 1.52e-09 62 27 6 210 3 dnaK Chaperone protein DnaK Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A8AD56 1.53e-09 62 24 7 247 3 hscA Chaperone protein HscA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q03WI2 1.57e-09 62 26 7 221 3 dnaK Chaperone protein DnaK Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
P26823 1.59e-09 62 24 8 252 3 dnaK Chaperone protein DnaK Clostridium perfringens (strain 13 / Type A)
Q0TNS7 1.59e-09 62 24 8 252 3 dnaK Chaperone protein DnaK Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q24895 1.62e-09 62 24 8 219 2 GRP78 Endoplasmic reticulum chaperone BiP Echinococcus multilocularis
A3DF25 1.63e-09 62 25 6 212 3 dnaK Chaperone protein DnaK Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A0AIS4 1.7e-09 62 25 7 206 3 dnaK Chaperone protein DnaK Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q03QU1 1.7e-09 62 28 11 223 3 dnaK Chaperone protein DnaK Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P47547 1.72e-09 62 25 7 218 1 dnaK Chaperone protein DnaK Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q24798 1.75e-09 62 24 8 219 2 GRP78 Endoplasmic reticulum chaperone BiP Echinococcus granulosus
Q01100 1.79e-09 62 26 7 223 3 dnaK Chaperone protein DnaK Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
A6TSM0 1.79e-09 62 24 7 217 3 dnaK Chaperone protein DnaK Alkaliphilus metalliredigens (strain QYMF)
A4X148 1.85e-09 62 26 8 219 3 dnaK Chaperone protein DnaK Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q6AC76 1.92e-09 62 23 12 350 3 dnaK Chaperone protein DnaK Leifsonia xyli subsp. xyli (strain CTCB07)
P0CW12 2.06e-09 62 27 8 218 3 dnaK Chaperone protein DnaK Methanosarcina mazei
P0CW13 2.06e-09 62 27 8 218 3 dnaK Chaperone protein DnaK Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A0M353 2.17e-09 62 25 5 206 3 dnaK Chaperone protein DnaK Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q03FR7 2.35e-09 62 28 9 220 3 dnaK Chaperone protein DnaK Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q98QY7 2.67e-09 62 27 8 215 3 dnaK Chaperone protein DnaK Mycoplasmopsis pulmonis (strain UAB CTIP)
B2TLZ7 2.71e-09 62 24 10 254 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Eklund 17B / Type B)
P17066 2.72e-09 62 24 13 353 1 HSPA6 Heat shock 70 kDa protein 6 Homo sapiens
Q9HRY2 2.81e-09 62 25 10 218 3 dnaK Chaperone protein DnaK Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R3H4 2.81e-09 62 25 10 218 3 dnaK Chaperone protein DnaK Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B2V2I5 2.86e-09 62 24 10 254 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Alaska E43 / Type E3)
Q038N3 3.12e-09 62 27 9 214 3 dnaK Chaperone protein DnaK Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEQ7 3.12e-09 62 27 9 214 3 dnaK Chaperone protein DnaK Lacticaseibacillus casei (strain BL23)
A5IXT5 3.49e-09 61 23 9 250 3 dnaK Chaperone protein DnaK Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
P50023 3.5e-09 61 27 10 222 3 dnaK Chaperone protein DnaK Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q5YNI0 3.51e-09 61 25 7 220 3 dnaK Chaperone protein DnaK Nocardia farcinica (strain IFM 10152)
Q6L590 3.58e-09 61 26 8 225 2 BIP3 Heat shock 70 kDa protein BIP3 Oryza sativa subsp. japonica
P49118 3.88e-09 61 23 13 356 2 None Luminal-binding protein Solanum lycopersicum
Q7NZ33 3.95e-09 61 26 15 364 3 hscA Chaperone protein HscA homolog Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q5FFM4 3.96e-09 61 25 11 275 3 dnaK Chaperone protein DnaK Ehrlichia ruminantium (strain Gardel)
B0S1F8 4.06e-09 61 23 6 217 3 dnaK Chaperone protein DnaK Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
P75344 4.24e-09 61 25 7 218 3 dnaK Chaperone protein DnaK Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
C4LGV8 4.35e-09 61 24 7 221 3 dnaK Chaperone protein DnaK Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
Q7VC04 4.35e-09 61 24 8 240 3 dnaK1 Chaperone protein dnaK1 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A6QBG0 4.39e-09 61 32 3 137 3 dnaK Chaperone protein DnaK Sulfurovum sp. (strain NBC37-1)
Q5ZM98 4.5e-09 61 23 8 235 1 HSPA9 Stress-70 protein, mitochondrial Gallus gallus
Q5HAY1 4.57e-09 61 25 11 275 3 dnaK Chaperone protein DnaK Ehrlichia ruminantium (strain Welgevonden)
P30721 4.97e-09 61 23 14 361 2 dnaK Chaperone protein DnaK Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q00488 5.05e-09 61 23 12 340 3 dnaK Chaperone protein DnaK Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q9KD72 5.1e-09 61 24 6 212 3 dnaK Chaperone protein DnaK Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8RH05 5.17e-09 61 26 8 225 3 dnaK Chaperone protein DnaK Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q93R27 5.4e-09 61 27 9 215 3 dnaK Chaperone protein DnaK Tetragenococcus halophilus
Q9CNV2 5.41e-09 61 25 8 255 3 hscA Chaperone protein HscA homolog Pasteurella multocida (strain Pm70)
Q7VIE3 5.43e-09 61 31 2 137 3 dnaK Chaperone protein DnaK Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A1SPX5 5.61e-09 61 25 8 214 3 dnaK Chaperone protein DnaK Nocardioides sp. (strain ATCC BAA-499 / JS614)
B8D8B9 5.77e-09 61 24 8 226 3 hscA Chaperone protein HscA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57660 5.77e-09 61 24 8 226 3 hscA Chaperone protein HscA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8G2 5.77e-09 61 24 8 226 3 hscA Chaperone protein HscA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A0KJ36 5.79e-09 61 28 12 244 3 hscA Chaperone protein HscA homolog Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P55994 5.92e-09 60 29 2 137 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain ATCC 700392 / 26695)
B4EZU4 6.34e-09 60 26 7 232 3 hscA Chaperone protein HscA Proteus mirabilis (strain HI4320)
B6JPL0 6.59e-09 60 29 2 137 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain P12)
Q1CV46 6.65e-09 60 29 2 137 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain HPAG1)
B2URT8 6.83e-09 60 29 2 137 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain Shi470)
B5Z9P0 6.89e-09 60 29 2 137 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain G27)
C4Z1J4 6.93e-09 60 25 6 216 3 dnaK Chaperone protein DnaK Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
A0QLZ6 7.16e-09 60 23 12 340 3 dnaK Chaperone protein DnaK Mycobacterium avium (strain 104)
P30722 8e-09 60 25 11 289 3 dnaK Chaperone protein dnaK Diacronema lutheri
Q8TQR2 8.6e-09 60 27 8 218 3 dnaK Chaperone protein DnaK Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A5CWM2 8.81e-09 60 21 14 369 3 hscA Chaperone protein HscA homolog Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q8KEP3 8.94e-09 60 25 9 240 3 dnaK Chaperone protein DnaK Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q4FNP9 8.95e-09 60 26 14 273 3 dnaK Chaperone protein DnaK Pelagibacter ubique (strain HTCC1062)
Q16D45 9.28e-09 60 24 8 234 3 dnaK Chaperone protein DnaK Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q97BG8 9.37e-09 60 25 18 362 3 dnaK Chaperone protein DnaK Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q826F6 1.03e-08 60 25 7 236 3 dnaK2 Chaperone protein dnaK2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q54215 1.12e-08 60 24 8 218 3 dnaK Chaperone protein DnaK Streptomyces griseus
B1VMF3 1.13e-08 60 25 8 216 3 dnaK Chaperone protein DnaK Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q7UM31 1.15e-08 60 25 8 244 3 dnaK Chaperone protein DnaK Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A6GXZ1 1.19e-08 60 25 8 234 3 dnaK Chaperone protein DnaK Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
P25840 1.28e-08 60 22 6 228 2 HSP70 Heat shock 70 kDa protein Chlamydomonas reinhardtii
B2G6W3 1.36e-08 60 22 14 364 3 dnaK Chaperone protein DnaK Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VJE7 1.36e-08 60 22 14 364 3 dnaK Chaperone protein DnaK Limosilactobacillus reuteri (strain DSM 20016)
Q6Z058 1.42e-08 60 23 10 298 1 BIP5 Heat shock 70 kDa protein BIP5 Oryza sativa subsp. japonica
Q6LU58 1.46e-08 59 23 9 256 3 hscA Chaperone protein HscA homolog Photobacterium profundum (strain SS9)
Q3YRR6 1.47e-08 59 23 8 242 3 dnaK Chaperone protein DnaK Ehrlichia canis (strain Jake)
Q5GSE1 1.57e-08 59 23 7 271 3 dnaK Chaperone protein DnaK Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q75E44 1.57e-08 59 21 12 362 3 SSB1 Ribosome-associated molecular chaperone SSB1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q91883 1.61e-08 59 21 8 296 2 hspa5 Endoplasmic reticulum chaperone BiP Xenopus laevis
Q835R7 1.63e-08 59 25 8 214 3 dnaK Chaperone protein DnaK Enterococcus faecalis (strain ATCC 700802 / V583)
P78695 1.63e-08 59 23 6 221 3 grp78 Endoplasmic reticulum chaperone BiP Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
B7LKB3 1.65e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B0T138 1.67e-08 59 28 3 127 3 dnaK Chaperone protein DnaK Caulobacter sp. (strain K31)
Q53RJ5 1.68e-08 59 26 7 221 2 BIP2 Heat shock 70 kDa protein BIP2 Oryza sativa subsp. japonica
B1LNI1 1.74e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli (strain SMS-3-5 / SECEC)
Q8DKR6 1.77e-08 59 23 9 235 3 dnaK1 Chaperone protein dnaK1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q03MR6 1.81e-08 59 25 7 216 3 dnaK Chaperone protein DnaK Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M1T8 1.81e-08 59 25 7 216 3 dnaK Chaperone protein DnaK Streptococcus thermophilus (strain CNRZ 1066)
Q17VY4 1.82e-08 59 29 2 137 3 dnaK Chaperone protein DnaK Helicobacter acinonychis (strain Sheeba)
Q8DH10 1.85e-08 59 23 5 238 3 dnaK3 Chaperone protein dnaK3 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q3YZ26 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Shigella sonnei (strain Ss046)
Q32D38 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Shigella dysenteriae serotype 1 (strain Sd197)
B6I598 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli (strain SE11)
P0A6Z1 1.87e-08 59 24 7 247 1 hscA Chaperone protein HscA Escherichia coli (strain K12)
B1IWD5 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TEV9 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A332 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli O9:H4 (strain HS)
B1XB01 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli (strain K12 / DH10B)
C4ZXA1 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli (strain K12 / MC4100 / BW2952)
B7M7M9 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli O8 (strain IAI1)
B7MY19 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli O81 (strain ED1a)
B5Z0Z9 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A6Z2 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli O157:H7
B7LDB8 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli (strain 55989 / EAEC)
B7MIL6 1.87e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli O45:K1 (strain S88 / ExPEC)
B8FUN4 1.88e-08 59 25 5 212 3 dnaK Chaperone protein DnaK Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A0B747 1.9e-08 59 24 8 225 3 dnaK Chaperone protein DnaK Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
B7UGX2 1.9e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q04EE1 1.9e-08 59 23 12 355 3 dnaK Chaperone protein DnaK Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q8FF44 1.94e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7NRH5 1.95e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q9ZMW4 2.03e-08 59 29 2 137 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain J99 / ATCC 700824)
A7ZPW9 2.04e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli O139:H28 (strain E24377A / ETEC)
B7N6B3 2.14e-08 59 24 7 247 3 hscA Chaperone protein HscA Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q7V1H4 2.21e-08 59 26 1 101 3 dnaK1 Chaperone protein dnaK1 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A0RZ01 2.26e-08 59 27 10 224 3 dnaK Chaperone protein DnaK Cenarchaeum symbiosum (strain A)
A1K724 2.26e-08 59 26 8 232 3 hscA Chaperone protein HscA homolog Azoarcus sp. (strain BH72)
Q8GLE4 2.33e-08 59 25 6 232 3 hscA Chaperone protein HscA Xenorhabdus nematophila (strain ATCC 19061 / DSM 3370 / CCUG 14189 / LMG 1036 / NCIMB 9965 / AN6)
P19208 2.35e-08 59 21 6 235 3 hsp-3 Heat shock 70 kDa protein C Caenorhabditis briggsae
A0QQC8 2.39e-08 59 25 7 213 1 dnaK Chaperone protein DnaK Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q12WE6 2.41e-08 59 25 8 219 3 dnaK Chaperone protein DnaK Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q82EX9 2.41e-08 59 24 8 214 3 dnaK1 Chaperone protein dnaK1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P40150 2.41e-08 59 22 14 362 1 SSB2 Ribosome-associated molecular chaperone SSB2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A7GXU4 2.46e-08 58 29 2 137 3 dnaK Chaperone protein DnaK Campylobacter curvus (strain 525.92)
P95334 2.54e-08 58 26 4 158 3 dnaK Chaperone protein DnaK Myxococcus xanthus (strain DK1622)
Q1BEV1 2.61e-08 58 25 7 211 3 dnaK Chaperone protein DnaK Mycobacterium sp. (strain MCS)
A1UA31 2.61e-08 58 25 7 211 3 dnaK Chaperone protein DnaK Mycobacterium sp. (strain KMS)
A3PTN4 2.61e-08 58 25 7 211 3 dnaK Chaperone protein DnaK Mycobacterium sp. (strain JLS)
C0ZT86 2.67e-08 58 25 7 220 3 dnaK Chaperone protein DnaK Rhodococcus erythropolis (strain PR4 / NBRC 100887)
B1MIX5 2.68e-08 58 25 7 220 3 dnaK Chaperone protein DnaK Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
P27420 2.71e-08 58 21 6 235 1 hsp-3 Heat shock 70 kDa protein C Caenorhabditis elegans
A7GHH6 2.81e-08 58 22 7 253 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
C1FVU0 2.81e-08 58 22 7 253 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Kyoto / Type A2)
A5I640 2.81e-08 58 22 7 253 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXL5 2.81e-08 58 22 7 253 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain ATCC 19397 / Type A)
Q89YW6 2.84e-08 58 24 9 244 3 dnaK Chaperone protein DnaK Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q05558 2.92e-08 58 25 9 216 3 dnaK Chaperone protein DnaK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P20029 3e-08 58 21 8 297 1 Hspa5 Endoplasmic reticulum chaperone BiP Mus musculus
B1KZN7 3.01e-08 58 22 7 253 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Loch Maree / Type A3)
B9DVF3 3.12e-08 58 24 8 217 3 dnaK Chaperone protein DnaK Streptococcus uberis (strain ATCC BAA-854 / 0140J)
P06761 3.19e-08 58 21 8 297 1 Hspa5 Endoplasmic reticulum chaperone BiP Rattus norvegicus
B1ILM3 3.24e-08 58 22 7 253 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Okra / Type B1)
Q7NDH1 3.24e-08 58 24 7 237 3 dnaK Chaperone protein DnaK Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9XCB1 3.25e-08 58 25 3 158 3 dnaK Chaperone protein DnaK Rhodothermus marinus
C3PJM6 3.27e-08 58 24 7 220 3 dnaK Chaperone protein DnaK Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
P07823 3.37e-08 58 21 8 297 1 HSPA5 Endoplasmic reticulum chaperone BiP Mesocricetus auratus
G3I8R9 3.37e-08 58 21 8 297 1 HSPA5 Endoplasmic reticulum chaperone BiP Cricetulus griseus
P87222 3.42e-08 58 20 11 365 3 SSB1 Ribosome-associated molecular chaperone SSB1 Candida albicans (strain WO-1)
Q5R4P0 3.55e-08 58 21 8 297 2 HSPA5 Endoplasmic reticulum chaperone BiP Pongo abelii
P11021 3.55e-08 58 21 8 297 1 HSPA5 Endoplasmic reticulum chaperone BiP Homo sapiens
C3L3G7 3.6e-08 58 23 8 254 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain 657 / Type Ba4)
A6L2X7 3.64e-08 58 21 7 242 3 dnaK Chaperone protein DnaK Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q03684 3.74e-08 58 23 13 356 2 BIP4 Luminal-binding protein 4 Nicotiana tabacum
Q55154 3.87e-08 58 29 4 117 3 dnaK1 Chaperone protein dnaK1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q3S4T7 3.88e-08 58 21 8 297 2 HSPA5 Endoplasmic reticulum chaperone BiP Ictidomys tridecemlineatus
A7ZEB5 3.9e-08 58 28 2 137 3 dnaK Chaperone protein DnaK Campylobacter concisus (strain 13826)
A9A135 3.94e-08 58 26 11 256 3 dnaK Chaperone protein DnaK Nitrosopumilus maritimus (strain SCM1)
Q2GF34 3.97e-08 58 24 9 232 3 dnaK Chaperone protein DnaK Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q0VCX2 3.99e-08 58 21 8 297 2 HSPA5 Endoplasmic reticulum chaperone BiP Bos taurus
P17879 4.03e-08 58 22 11 296 1 Hspa1b Heat shock 70 kDa protein 1B Mus musculus
Q61696 4.1e-08 58 22 11 296 1 Hspa1a Heat shock 70 kDa protein 1A Mus musculus
A0Q1R4 4.25e-08 58 23 9 255 3 dnaK Chaperone protein DnaK Clostridium novyi (strain NT)
B2UKV6 4.29e-08 58 26 10 262 3 dnaK Chaperone protein DnaK Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q4G366 4.3e-08 58 28 1 103 3 dnaK Chaperone protein dnaK Emiliania huxleyi
P29215 4.36e-08 58 24 8 240 3 dnaK Chaperone protein dnaK Guillardia theta
A1ANV0 4.38e-08 58 24 10 281 3 dnaK Chaperone protein DnaK Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
P11484 4.55e-08 58 21 13 362 1 SSB1 Ribosome-associated molecular chaperone SSB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6FW50 4.76e-08 58 24 3 173 3 KAR2 Endoplasmic reticulum chaperone BiP Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
B1VHX4 4.77e-08 58 24 8 221 3 dnaK Chaperone protein DnaK Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
B9KCH0 4.83e-08 58 28 2 137 3 dnaK Chaperone protein DnaK Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
O85282 4.88e-08 58 24 8 232 3 dnaK Chaperone protein DnaK Neorickettsia sennetsu
A7MGW6 4.94e-08 58 25 10 251 3 hscA Chaperone protein HscA Cronobacter sakazakii (strain ATCC BAA-894)
A5FGL1 5.16e-08 58 24 8 234 3 dnaK Chaperone protein DnaK Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q9N1U2 5.45e-08 58 24 13 353 2 HSPA6 Heat shock 70 kDa protein 6 Saguinus oedipus
Q5M6D1 5.56e-08 58 24 7 216 3 dnaK Chaperone protein DnaK Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
C0ME86 5.57e-08 58 24 5 177 3 dnaK Chaperone protein DnaK Streptococcus equi subsp. zooepidemicus (strain H70)
C0M7T9 5.61e-08 58 24 5 177 3 dnaK Chaperone protein DnaK Streptococcus equi subsp. equi (strain 4047)
A1T2S3 5.72e-08 58 26 7 211 3 dnaK Chaperone protein DnaK Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q5UPU0 5.72e-08 58 30 5 135 3 MIMI_L254 Heat shock protein 70 homolog Acanthamoeba polyphaga mimivirus
O24581 5.78e-08 58 25 8 219 2 BIPE3 Luminal-binding protein 3 Zea mays
P99502 5.93e-08 57 23 9 269 1 HSPA9 Stress-70 protein, mitochondrial Canis lupus familiaris
Q47TI0 6.05e-08 57 25 7 219 3 dnaK Chaperone protein DnaK Thermobifida fusca (strain YX)
P38646 6.1e-08 57 23 9 269 1 HSPA9 Stress-70 protein, mitochondrial Homo sapiens
A1B4E9 6.1e-08 57 23 8 238 3 dnaK Chaperone protein DnaK Paracoccus denitrificans (strain Pd 1222)
A8LWM4 6.15e-08 57 26 8 217 3 dnaK Chaperone protein DnaK Salinispora arenicola (strain CNS-205)
A8Z5V5 6.23e-08 57 25 3 159 3 dnaK Chaperone protein DnaK Karelsulcia muelleri (strain GWSS)
Q15WH0 6.31e-08 57 30 1 102 3 hscA Chaperone protein HscA homolog Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q6KIH7 6.38e-08 57 27 9 214 3 dnaK Chaperone protein DnaK Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
A1AWL7 6.44e-08 57 23 6 227 3 hscA Chaperone protein HscA homolog Ruthia magnifica subsp. Calyptogena magnifica
P77319 6.53e-08 57 27 5 177 1 hscC Chaperone protein HscC Escherichia coli (strain K12)
Q5B0C0 6.61e-08 57 24 9 252 1 AN6010 Iron-sulfur cluster biogenesis chaperone, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q10265 6.82e-08 57 29 3 119 1 ssa1 Probable heat shock protein ssa1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0RPW7 6.86e-08 57 29 2 136 3 dnaK Chaperone protein DnaK Campylobacter fetus subsp. fetus (strain 82-40)
B2KAX0 6.88e-08 57 23 15 360 3 dnaK Chaperone protein DnaK Elusimicrobium minutum (strain Pei191)
P24067 6.96e-08 57 25 8 219 1 BIPE2 Luminal-binding protein 2 Zea mays
B4SDA0 7.05e-08 57 24 9 233 3 dnaK Chaperone protein DnaK Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q90593 7.1e-08 57 22 6 219 1 HSPA5 Endoplasmic reticulum chaperone BiP Gallus gallus
Q5R511 7.16e-08 57 23 9 269 2 HSPA9 Stress-70 protein, mitochondrial Pongo abelii
A4J7F3 7.24e-08 57 25 7 216 3 dnaK Chaperone protein DnaK Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q74H59 7.35e-08 57 23 9 276 3 dnaK Chaperone protein DnaK Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
P22774 7.46e-08 57 25 12 283 1 ssc1 Iron-sulfur cluster biogenesis chaperone, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A7MIK5 7.62e-08 57 23 10 279 3 dnaK Chaperone protein DnaK Cronobacter sakazakii (strain ATCC BAA-894)
Q7MA35 7.72e-08 57 29 2 137 3 dnaK Chaperone protein DnaK Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A0L4Z2 7.84e-08 57 27 5 159 3 dnaK Chaperone protein DnaK Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q3APD2 8.04e-08 57 26 2 123 3 dnaK Chaperone protein DnaK Chlorobium chlorochromatii (strain CaD3)
A8GHX9 8.21e-08 57 24 7 245 3 hscA Chaperone protein HscA Serratia proteamaculans (strain 568)
A9VHU1 8.32e-08 57 25 7 213 3 dnaK Chaperone protein DnaK Bacillus mycoides (strain KBAB4)
Q182E8 8.57e-08 57 24 9 218 3 dnaK Chaperone protein DnaK Clostridioides difficile (strain 630)
Q28VY3 8.64e-08 57 24 8 234 3 dnaK Chaperone protein DnaK Jannaschia sp. (strain CCS1)
Q0RBC4 8.76e-08 57 26 9 215 3 dnaK Chaperone protein DnaK Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
P38647 8.78e-08 57 23 9 269 1 Hspa9 Stress-70 protein, mitochondrial Mus musculus
P86233 8.82e-08 57 23 9 269 1 HSPA9 Stress-70 protein, mitochondrial Mesocricetus auratus
A6LM32 8.83e-08 57 28 5 140 3 dnaK Chaperone protein DnaK Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q03685 9.04e-08 57 25 8 219 2 BIP5 Luminal-binding protein 5 Nicotiana tabacum
Q3ZCH0 9.35e-08 57 23 9 269 2 HSPA9 Stress-70 protein, mitochondrial Bos taurus
Q83MH5 9.52e-08 57 25 13 286 3 dnaK Chaperone protein DnaK Shigella flexneri
Q0T8H6 9.52e-08 57 25 13 286 3 dnaK Chaperone protein DnaK Shigella flexneri serotype 5b (strain 8401)
O06942 9.86e-08 57 24 7 218 2 dnaK Chaperone protein DnaK Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B2GBQ5 9.91e-08 57 22 14 362 3 dnaK Chaperone protein DnaK Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
P11143 9.91e-08 57 25 11 261 3 HSP70 Heat shock 70 kDa protein Zea mays
P12076 9.93e-08 57 25 3 163 3 HSP70.1 Heat shock 70-related protein 1, mitochondrial Leishmania major
Q5HV33 1.02e-07 57 27 2 137 3 dnaK Chaperone protein DnaK Campylobacter jejuni (strain RM1221)
A8FLH2 1.02e-07 57 27 2 137 3 dnaK Chaperone protein DnaK Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
O69298 1.06e-07 57 27 2 137 3 dnaK Chaperone protein DnaK Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
C5CXC5 1.06e-07 57 27 8 229 3 hscA Chaperone protein HscA homolog Variovorax paradoxus (strain S110)
A0LWS7 1.06e-07 57 24 8 250 3 dnaK Chaperone protein DnaK Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A7H484 1.07e-07 57 27 2 137 3 dnaK Chaperone protein DnaK Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
B7KSZ4 1.09e-07 57 25 10 276 3 dnaK Chaperone protein DnaK Methylorubrum extorquens (strain CM4 / NCIMB 13688)
P20442 1.09e-07 57 23 10 240 2 dnaK Chaperone protein DnaK Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B9KBT4 1.09e-07 57 26 12 256 3 dnaK Chaperone protein DnaK Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
A1BET8 1.1e-07 57 26 2 123 3 dnaK Chaperone protein DnaK Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q2LUH6 1.12e-07 57 22 7 276 3 dnaK Chaperone protein DnaK Syntrophus aciditrophicus (strain SB)
A9W6R7 1.12e-07 57 25 10 276 3 dnaK Chaperone protein DnaK Methylorubrum extorquens (strain PA1)
P48721 1.14e-07 57 23 9 269 1 Hspa9 Stress-70 protein, mitochondrial Rattus norvegicus
A8EWT6 1.15e-07 57 27 2 137 3 dnaK Chaperone protein DnaK Aliarcobacter butzleri (strain RM4018)
P50021 1.17e-07 57 26 12 269 3 dnaK2 Chaperone protein dnaK2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A6Q421 1.18e-07 57 28 2 137 3 dnaK Chaperone protein DnaK Nitratiruptor sp. (strain SB155-2)
Q52701 1.21e-07 57 24 11 292 3 dnaK Chaperone protein DnaK Rhodobacter capsulatus
Q6CQ83 1.21e-07 57 22 12 362 3 SSB1 Ribosome-associated molecular chaperone SSB1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q11QH3 1.22e-07 57 29 3 138 3 dnaK Chaperone protein DnaK Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A8G9K8 1.22e-07 57 23 10 276 3 dnaK Chaperone protein DnaK Serratia proteamaculans (strain 568)
P48741 1.25e-07 56 26 12 289 5 HSPA7 Putative heat shock 70 kDa protein 7 Homo sapiens
Q5WHG1 1.26e-07 57 23 6 212 3 dnaK Chaperone protein DnaK Shouchella clausii (strain KSM-K16)
Q31XW4 1.27e-07 57 23 7 247 3 hscA Chaperone protein HscA Shigella boydii serotype 4 (strain Sb227)
B2TXV1 1.27e-07 57 23 7 247 3 hscA Chaperone protein HscA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P0CY99 1.28e-07 57 22 11 304 3 dnaK Chaperone protein DnaK Cutibacterium acnes (strain DSM 16379 / KPA171202)
P0CY98 1.28e-07 57 22 11 304 3 dnaK Chaperone protein DnaK Cutibacterium acnes
Q27975 1.29e-07 57 22 11 296 1 HSPA1A Heat shock 70 kDa protein 1A Bos taurus
Q12P79 1.29e-07 57 25 9 241 3 hscA Chaperone protein HscA homolog Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q6S4N2 1.33e-07 57 22 11 296 2 HSPA1B Heat shock 70 kDa protein 1B Sus scrofa
Q75HQ0 1.33e-07 57 22 10 298 2 BIP4 Heat shock 70 kDa protein BIP4 Oryza sativa subsp. japonica
B1LZ51 1.34e-07 57 25 10 276 3 dnaK Chaperone protein DnaK Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q27965 1.36e-07 57 22 11 296 2 HSPA1B Heat shock 70 kDa protein 1B Bos taurus
B0BPK8 1.39e-07 56 23 10 292 3 hscA Chaperone protein HscA homolog Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N0T5 1.39e-07 56 23 10 292 3 hscA Chaperone protein HscA homolog Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q99170 1.41e-07 56 26 2 123 3 KAR2 Endoplasmic reticulum chaperone BiP Yarrowia lipolytica (strain CLIB 122 / E 150)
Q7NAU6 1.41e-07 56 24 8 228 3 dnaK Chaperone protein DnaK Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
O35501 1.42e-07 56 23 9 269 2 HSPA9 Stress-70 protein, mitochondrial Cricetulus griseus
Q6BZH1 1.42e-07 56 30 2 100 3 KAR2 Endoplasmic reticulum chaperone BiP Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q4U0F3 1.44e-07 56 22 11 296 2 HSPA1B Heat shock 70 kDa protein 1B Bos mutus grunniens
Q83QK4 1.44e-07 56 23 7 247 3 hscA Chaperone protein HscA homolog Shigella flexneri
Q0T1Z3 1.44e-07 56 23 7 247 3 hscA Chaperone protein HscA Shigella flexneri serotype 5b (strain 8401)
B7ID00 1.44e-07 56 25 17 358 3 dnaK Chaperone protein DnaK Thermosipho africanus (strain TCF52B)
C5B7L7 1.5e-07 56 23 9 277 3 dnaK Chaperone protein DnaK Edwardsiella ictaluri (strain 93-146)
B3CNB5 1.55e-07 56 28 4 138 3 dnaK Chaperone protein DnaK Wolbachia pipientis subsp. Culex pipiens (strain wPip)
A5CM86 1.58e-07 56 23 12 299 3 dnaK Chaperone protein DnaK Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
P16474 1.61e-07 56 25 4 172 1 KAR2 Endoplasmic reticulum chaperone BiP Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0A3J4 1.66e-07 56 22 5 181 3 dnaK Chaperone protein DnaK Streptococcus agalactiae
P0A3J3 1.66e-07 56 22 5 181 3 dnaK Chaperone protein DnaK Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A3J2 1.66e-07 56 22 5 181 3 dnaK Chaperone protein DnaK Streptococcus agalactiae serotype III (strain NEM316)
Q3K3T2 1.66e-07 56 22 5 181 3 dnaK Chaperone protein DnaK Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q6Z7B0 1.67e-07 56 24 8 219 1 BIP1 Heat shock 70 kDa protein BIP1 Oryza sativa subsp. japonica
Q8K9Y8 1.71e-07 56 26 3 142 3 dnaK Chaperone protein DnaK Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B9M357 1.73e-07 56 22 8 277 3 dnaK Chaperone protein DnaK Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A4SP09 1.75e-07 56 25 13 299 3 hscA Chaperone protein HscA homolog Aeromonas salmonicida (strain A449)
A7I2D4 1.75e-07 56 28 2 136 3 dnaK Chaperone protein DnaK Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
B0RBI1 1.76e-07 56 23 12 299 3 dnaK Chaperone protein DnaK Clavibacter sepedonicus
Q5R7D3 1.78e-07 56 22 11 296 2 HSPA1 Heat shock 70 kDa protein 1 Pongo abelii
P0DMV9 1.78e-07 56 22 11 296 1 HSPA1B Heat shock 70 kDa protein 1B Homo sapiens
P0DMV8 1.78e-07 56 22 11 296 1 HSPA1A Heat shock 70 kDa protein 1A Homo sapiens
Q5NPS6 1.8e-07 56 22 9 271 3 dnaK Chaperone protein DnaK Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
C1CCQ8 1.82e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain JJA)
P95829 1.82e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZLY9 1.82e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B7IYG7 1.82e-07 56 25 7 213 3 dnaK Chaperone protein DnaK Bacillus cereus (strain G9842)
Q1H365 1.84e-07 56 22 12 378 3 hscA Chaperone protein HscA homolog Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
C1CQ18 1.85e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain Taiwan19F-14)
C1CJ06 1.85e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain P1031)
Q8CWT3 1.85e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B1IA52 1.85e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain Hungary19A-6)
C1C5N7 1.85e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain 70585)
Q04LY0 1.85e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B5XHZ0 1.85e-07 56 22 5 181 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M49 (strain NZ131)
Q95YL7 1.86e-07 56 23 9 237 3 HSP70 Mitochondrial-type heat shock protein 70 Encephalitozoon hellem
B3ERN8 1.86e-07 56 25 8 236 3 dnaK Chaperone protein DnaK Amoebophilus asiaticus (strain 5a2)
Q7VQL4 1.89e-07 56 23 10 279 3 dnaK Chaperone protein DnaK Blochmanniella floridana
Q6HDK7 1.9e-07 56 25 7 213 3 dnaK Chaperone protein DnaK Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634M7 1.9e-07 56 25 7 213 3 dnaK Chaperone protein DnaK Bacillus cereus (strain ZK / E33L)
Q818E9 1.9e-07 56 25 7 213 3 dnaK Chaperone protein DnaK Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HCU0 1.9e-07 56 25 7 213 3 dnaK Chaperone protein DnaK Bacillus cereus (strain B4264)
C1ESK8 1.9e-07 56 25 7 213 3 dnaK Chaperone protein DnaK Bacillus cereus (strain 03BB102)
B7JN39 1.9e-07 56 25 7 213 3 dnaK Chaperone protein DnaK Bacillus cereus (strain AH820)
Q81LS2 1.9e-07 56 25 7 213 3 dnaK Chaperone protein DnaK Bacillus anthracis
A0RIT3 1.9e-07 56 25 7 213 3 dnaK Chaperone protein DnaK Bacillus thuringiensis (strain Al Hakam)
C3L5R7 1.9e-07 56 25 7 213 3 dnaK Chaperone protein DnaK Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P8M0 1.9e-07 56 25 7 213 3 dnaK Chaperone protein DnaK Bacillus anthracis (strain A0248)
P20583 1.91e-07 56 24 5 231 3 MTP70 Heat shock 70 kDa protein, mitochondrial Trypanosoma cruzi
B2IMB5 1.91e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain CGSP14)
A4WDA7 1.96e-07 56 25 7 249 3 hscA Chaperone protein HscA Enterobacter sp. (strain 638)
B1L9B4 2.02e-07 56 25 11 254 3 dnaK Chaperone protein DnaK Thermotoga sp. (strain RQ2)
A5IK42 2.02e-07 56 25 11 254 3 dnaK Chaperone protein DnaK Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9WYK6 2.02e-07 56 25 11 254 3 dnaK Chaperone protein DnaK Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A4T112 2.02e-07 56 25 7 213 3 dnaK Chaperone protein DnaK Mycolicibacterium gilvum (strain PYR-GCK)
A6TCE7 2.16e-07 56 23 7 247 3 hscA Chaperone protein HscA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q2NVZ1 2.19e-07 56 24 10 279 3 dnaK Chaperone protein DnaK Sodalis glossinidius (strain morsitans)
Q876N3 2.2e-07 56 22 14 362 3 SSB1 Ribosome-associated molecular chaperone SSB Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P20163 2.2e-07 56 22 7 230 1 hsp-4 Endoplasmic reticulum chaperone BiP homolog Caenorhabditis elegans
Q1JKD6 2.21e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JA83 2.21e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0DB71 2.23e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB70 2.23e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q5B2V1 2.26e-07 56 24 8 240 1 hsp70 Heat shock 70 kDa protein Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5N1J4 2.27e-07 56 26 12 269 3 dnaK2 Chaperone protein DnaK 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
O59855 2.29e-07 56 29 3 119 1 ssa2 Probable heat shock protein ssa2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P59565 2.3e-07 56 25 3 142 3 dnaK Chaperone protein DnaK Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P0DMW1 2.32e-07 56 22 11 296 2 Hspa1b Heat shock 70 kDa protein 1B Rattus norvegicus
P0DMW0 2.32e-07 56 22 11 296 1 Hspa1a Heat shock 70 kDa protein 1A Rattus norvegicus
Q1JFC8 2.35e-07 56 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M2 (strain MGAS10270)
C1CZH9 2.38e-07 56 26 8 231 3 dnaK Chaperone protein DnaK Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q730M1 2.4e-07 55 26 9 216 3 dnaK Chaperone protein DnaK Bacillus cereus (strain ATCC 10987 / NRS 248)
B5E232 2.41e-07 55 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae serotype 19F (strain G54)
Q6FCE6 2.41e-07 55 23 7 232 3 hscA Chaperone protein HscA homolog Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B9IY81 2.44e-07 55 26 9 216 3 dnaK Chaperone protein DnaK Bacillus cereus (strain Q1)
B7HPL3 2.44e-07 55 26 9 216 3 dnaK Chaperone protein DnaK Bacillus cereus (strain AH187)
B1ZGR1 2.45e-07 55 24 10 276 3 dnaK Chaperone protein DnaK Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q30Q10 2.45e-07 55 25 2 137 3 dnaK Chaperone protein DnaK Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
P0C0C5 2.46e-07 55 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pyogenes
Q48RR3 2.46e-07 55 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RCW6 2.46e-07 55 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J578 2.46e-07 55 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M4 (strain MGAS10750)
P68837 2.46e-07 55 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XAD6 2.46e-07 55 23 5 177 1 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0C0C6 2.46e-07 55 23 5 177 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M1
A3QFD1 2.5e-07 55 26 8 234 3 hscA Chaperone protein HscA homolog Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q7N8Y4 2.51e-07 55 23 9 277 3 dnaK Chaperone protein DnaK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q37106 2.54e-07 55 23 9 238 3 dnaK-A Chaperone protein dnaK Cyanophora paradoxa
Q707W3 2.56e-07 55 21 12 362 3 SSB1 Ribosome-associated molecular chaperone SSB1 Nakaseomyces delphensis
B5XNK1 2.56e-07 55 24 8 254 3 hscA Chaperone protein HscA Klebsiella pneumoniae (strain 342)
Q04967 2.66e-07 55 23 12 355 1 HSPA6 Heat shock 70 kDa protein 6 Sus scrofa
Q9LHA8 2.67e-07 55 23 8 227 1 HSP70-4 Heat shock 70 kDa protein 4 Arabidopsis thaliana
A9IQZ6 2.71e-07 55 28 10 252 3 hscA Chaperone protein HscA homolog Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q8D2Q5 2.76e-07 55 21 11 284 3 dnaK Chaperone protein DnaK Wigglesworthia glossinidia brevipalpis
P53623 2.78e-07 55 24 8 219 3 HSA2 Heat shock protein 70 2 Pichia angusta
A5N6M2 2.78e-07 55 21 7 253 3 dnaK Chaperone protein DnaK Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E041 2.78e-07 55 21 7 253 3 dnaK Chaperone protein DnaK Clostridium kluyveri (strain NBRC 12016)
Q48M01 2.78e-07 55 30 1 97 3 hscA Chaperone protein HscA homolog Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9ZIV1 2.83e-07 55 25 9 218 3 dnaK Chaperone protein DnaK (Fragment) Megasphaera elsdenii
Q486Y6 2.88e-07 55 23 6 231 3 hscA Chaperone protein HscA homolog Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B2HPS1 2.94e-07 55 22 12 340 3 dnaK Chaperone protein DnaK Mycobacterium marinum (strain ATCC BAA-535 / M)
Q2G6N0 2.97e-07 55 23 12 277 3 dnaK Chaperone protein DnaK Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A8H2N0 3.01e-07 55 25 8 238 3 hscA Chaperone protein HscA homolog Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B3QMB2 3.02e-07 55 26 2 123 3 dnaK Chaperone protein DnaK Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B8CMW9 3.07e-07 55 24 7 233 3 hscA Chaperone protein HscA homolog Shewanella piezotolerans (strain WP3 / JCM 13877)
A2BZ91 3.07e-07 55 29 1 105 3 dnaK Chaperone protein DnaK Prochlorococcus marinus (strain MIT 9515)
Q7YQC6 3.11e-07 55 22 11 296 2 HSPA1 Heat shock 70 kDa protein 1 Canis lupus familiaris

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11585
Feature type CDS
Gene mreB
Product rod shape-determining protein MreB
Location 467371 - 468414 (strand: 1)
Length 1044 (nucleotides) / 347 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_823
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF06723 MreB/Mbl protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1077 Cell cycle control, cell division, chromosome partitioning (D)
Cytoskeleton (Z)
DZ Cell shape-determining ATPase MreB, actin-like superfamily

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03569 rod shape-determining protein MreB and related proteins - -

Protein Sequence

MFKKIRGMFSNDLSIDLGTANTLIYVKGQGIVLDEPSVVAIRQDRPGSTKSVAAVGHEAKRMLGRTPGNIAAIRPMKDGVIADFFVTEKMLQHFIKQVHSNSFMRPSPRVLVCVPVGATQVERRAIRESALSAGAREVYLIEEPVSAAIGAGLPVSEATGSMVVDIGGGTTEVAVISLNGVVYSSSVRIGGDRFDEAIINYVRRNYGSLIGEATAERIKHEIGSAYPTDEVLEIEVRGRNLAEGVPRGFTLNSNEILEALQEPLTGIVSAVMLALEQCPPELASDISERGMVLTGGGALLRNLDRLLMEETGIPVIVAEDPLTCVARGGGKALEMIDMHGSDLLSEE

Flanking regions ( +/- flanking 50bp)

AAAGTAGACGGTTTTATTTCCGTCCCCGGCTTGCAGGATTATCCTTTTGTATGTTTAAAAAAATTCGTGGCATGTTTTCCAACGACTTGTCTATTGACCTGGGTACTGCCAATACCCTGATTTATGTCAAAGGACAAGGTATTGTGCTTGATGAACCGTCTGTTGTGGCTATCCGTCAGGATCGCCCCGGCTCCACCAAGAGTGTTGCGGCAGTCGGGCATGAAGCCAAGCGGATGCTGGGGCGTACCCCCGGTAATATCGCAGCAATCCGTCCGATGAAAGACGGTGTAATCGCTGACTTTTTTGTGACTGAGAAAATGCTTCAGCATTTTATCAAACAGGTTCACAGCAACAGCTTTATGCGTCCGAGCCCGCGTGTTCTGGTGTGTGTACCGGTTGGTGCAACTCAGGTTGAGCGCCGTGCTATCCGCGAATCTGCACTCAGTGCCGGTGCCCGCGAAGTCTATCTGATCGAAGAGCCGGTTTCTGCGGCAATCGGTGCCGGTTTGCCGGTATCAGAAGCGACAGGTTCAATGGTGGTGGATATCGGCGGTGGTACAACAGAAGTTGCCGTTATCTCTCTGAACGGCGTGGTGTATTCCTCCTCTGTCCGTATCGGTGGTGATCGCTTTGATGAAGCCATCATTAATTATGTGCGCCGTAACTACGGTTCACTGATTGGCGAAGCAACGGCTGAGCGCATCAAACACGAAATCGGTTCTGCATATCCGACTGACGAAGTGCTTGAAATCGAAGTTCGCGGCCGTAACCTGGCTGAAGGTGTTCCGCGTGGTTTCACGTTGAATTCCAACGAAATTCTGGAAGCATTGCAGGAACCGCTGACCGGTATTGTCAGTGCGGTGATGCTGGCGCTGGAACAGTGCCCGCCGGAGCTGGCGTCTGATATTTCCGAACGTGGTATGGTGCTGACCGGTGGTGGTGCATTGCTGCGTAATTTAGACCGCCTGCTGATGGAAGAAACCGGGATTCCGGTGATTGTTGCAGAAGATCCGCTGACGTGTGTTGCACGCGGTGGTGGTAAAGCACTTGAGATGATCGATATGCACGGCAGCGATCTTCTTAGTGAAGAATAAGCGGACTCCCGTTCGTTCAATACTGCAAGCCGGGGGAGTCCGCTCCCTCT