Homologs in group_4135
0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product |
|---|
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|
| Source | Morganella psychrotolerans |
|---|---|
| Locus tag | F4V73_RS11455 |
| Feature type | CDS |
| Gene | kdpF |
| Product | K(+)-transporting ATPase subunit F |
| Location | 433871 - 433960 (strand: 1) |
| Length | 90 (nucleotides) / 29 (amino acids) |
| Accession | term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object |
|---|---|
| Length | 573139 nucleotides |
| Topology | linear |
| Plasmid | False |
| Orthogroup | group_4135 | |
|---|---|---|
| Orthogroup size | 1 | |
| N. genomes | 1 |
| PF09604 | F subunit of K+-transporting ATPase (Potass_KdpF) |
|---|
| KO | Description | Pathways | Modules |
|---|---|---|---|
| K01545 | potassium-transporting ATPase KdpF subunit | Two-component system | - |
MSLGFIAGLAGTILLLAYLLYALINAEKF
CCCGTTTCTTAGACTGCATCCTGAATAACTCACTGGTGTAAGGATTAATTATGAGTCTGGGTTTTATCGCGGGTCTTGCCGGCACGATCCTGCTTTTGGCGTATCTGCTCTATGCCTTAATTAATGCGGAGAAATTCTGATGGCAGCGAATGCATTTTTACTCATTGCCGGGTTTCTGATTGTCTTGCTG
