Homologs in group_2605

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03465 FBDBKF_03465 91.8 Morganella morganii S1 livG high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG
EHELCC_07070 EHELCC_07070 91.8 Morganella morganii S2 livG high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG
NLDBIP_07395 NLDBIP_07395 91.8 Morganella morganii S4 livG high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG
LHKJJB_06930 LHKJJB_06930 91.8 Morganella morganii S3 livG high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG
HKOGLL_04000 HKOGLL_04000 91.8 Morganella morganii S5 livG high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG

Distribution of the homologs in the orthogroup group_2605

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2605

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A193 2.77e-139 394 75 0 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A194 2.77e-139 394 75 0 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhi
P0A9S9 5.01e-139 394 75 0 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Shigella flexneri
P0A9S7 5.01e-139 394 75 0 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli (strain K12)
P0A9S8 5.01e-139 394 75 0 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli O157:H7
P21629 4.57e-132 376 69 0 255 3 braF High-affinity branched-chain amino acid transport ATP-binding protein BraF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O28881 9.58e-50 167 36 3 255 3 livG Probable branched-chain amino acid transport ATP-binding protein LivG Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q58663 1.43e-45 156 35 5 260 1 livG Probable branched-chain amino acid transport ATP-binding protein LivG Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P45073 1.72e-38 137 32 4 253 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7M8M4 2.64e-38 138 34 5 241 3 phnC Phosphonates import ATP-binding protein PhnC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P33982 4.16e-38 137 34 3 246 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q6D201 1.04e-37 137 30 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8Z0H0 2.24e-37 137 32 3 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q6MU19 1.7e-36 135 31 4 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q2SSS4 2.01e-36 135 31 4 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q042G7 1.22e-35 133 29 3 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
P0A9V4 1.9e-35 129 33 3 251 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V1 1.9e-35 129 33 3 251 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V2 1.9e-35 129 33 3 251 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V3 1.9e-35 129 33 3 251 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
Q8DIA0 3.05e-35 131 33 4 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q74K65 3.69e-35 132 29 3 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
P24693 4.67e-35 128 33 3 226 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
Q6WB63 7.24e-35 129 33 5 256 3 phnC Phosphonates import ATP-binding protein PhnC Alcaligenes faecalis
Q5X627 7.83e-35 131 30 3 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q14Q07 1.15e-34 130 30 4 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q88CL2 1.25e-34 129 29 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88AS5 1.34e-34 129 30 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P25885 1.82e-34 127 33 3 254 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
Q5ZWE4 2.01e-34 130 30 3 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q6F0V4 2.23e-34 129 29 6 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q5WXF0 4e-34 129 30 3 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q81GC1 4.98e-34 128 32 4 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q7NQN5 5.13e-34 129 31 3 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q03AH0 6.64e-34 128 28 4 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q3IM24 6.95e-34 126 33 3 224 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q03PF2 9.54e-34 128 30 4 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P14788 1.03e-33 127 31 4 241 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q93DX8 1.05e-33 125 30 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q9G4F5 1.27e-33 127 31 4 251 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q8D653 1.31e-33 127 30 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q0SWH9 1.75e-33 125 27 6 251 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain SM101 / Type A)
Q8F6Z1 2.06e-33 127 30 4 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 2.06e-33 127 30 4 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q07PZ0 2.19e-33 125 33 5 253 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisA53)
Q9HY19 2.63e-33 127 34 4 246 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02R79 2.71e-33 127 34 4 246 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q5UW69 2.87e-33 124 32 4 241 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q7NWX3 2.92e-33 127 32 4 252 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q63E84 3.24e-33 125 31 5 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 3.24e-33 125 31 5 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 3.24e-33 125 31 5 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q6HLQ9 3.83e-33 125 31 5 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q82TL6 4.18e-33 126 32 4 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q2JLH7 4.46e-33 124 32 5 255 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
O27739 4.67e-33 125 30 6 249 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8E8K8 6.96e-33 125 29 4 251 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q04G50 7.59e-33 125 27 4 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q0TUN8 8.62e-33 124 27 6 251 1 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q9I6L0 9.22e-33 124 29 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q81TH8 9.53e-33 124 31 5 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
P54537 1.36e-32 122 28 4 249 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q7N6Z2 1.72e-32 124 29 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q5FL41 2.66e-32 124 27 5 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q7WGW1 2.94e-32 124 29 4 251 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q2YAD6 3.07e-32 124 32 3 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q2IYS5 3.8e-32 122 32 5 253 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
Q74IV9 3.95e-32 123 32 6 262 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q7NX01 3.97e-32 124 30 4 253 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A1VZQ5 4.08e-32 120 25 1 248 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q7VZE5 4.14e-32 123 29 4 251 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W9U5 4.19e-32 123 29 4 251 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q92VJ2 4.83e-32 124 28 4 253 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q63TY1 5.42e-32 123 30 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q62K82 5.77e-32 123 30 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q0P9X7 6.51e-32 120 25 1 248 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q81GU1 6.7e-32 123 30 3 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q82WT5 7.62e-32 123 29 3 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q5L222 8.44e-32 122 27 4 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q8XNY7 1.03e-31 121 26 6 251 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)
P27675 1.08e-31 119 29 5 239 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q043Y8 1.11e-31 122 32 5 261 3 metN Methionine import ATP-binding protein MetN Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q73XU8 1.2e-31 122 30 2 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q9MUN1 1.22e-31 122 30 4 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9KLQ5 1.32e-31 122 29 6 250 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8YUV1 1.52e-31 120 31 4 246 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q1GIE5 1.61e-31 122 30 3 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q31V51 2.1e-31 124 33 6 252 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q31V51 8.9e-14 73 27 5 219 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q8FCE2 2.1e-31 124 33 6 252 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCE2 5.26e-14 74 27 5 219 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBN5 2.1e-31 124 33 6 252 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBN5 5.26e-14 74 27 5 219 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8XDM1 2.1e-31 124 33 6 252 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q8XDM1 8.9e-14 73 27 5 219 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q1B8V9 2.24e-31 122 29 3 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 2.24e-31 122 29 3 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q1R528 2.26e-31 124 33 6 252 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q1R528 4.12e-14 74 27 5 219 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q0SY86 2.35e-31 124 33 6 252 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
Q0SY86 1.21e-13 73 27 5 219 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
O34677 2.94e-31 119 26 5 252 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q83J33 3.14e-31 123 34 5 229 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q83J33 8.65e-14 73 27 5 219 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q1GB17 3.33e-31 121 27 4 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q8XK20 3.75e-31 124 31 7 257 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 2.04e-15 79 27 7 233 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q38WL5 4.14e-31 120 31 5 242 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q89C51 4.54e-31 119 31 4 248 3 phnC Phosphonates import ATP-binding protein PhnC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q20ZP0 4.61e-31 119 32 6 240 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisB18)
Q7N8B9 4.83e-31 120 27 4 253 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A2RKA7 4.93e-31 123 32 2 231 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
A2RKA7 1.2e-14 76 28 8 238 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
Q28P50 5.27e-31 123 31 3 253 3 rbsA Ribose import ATP-binding protein RbsA Jannaschia sp. (strain CCS1)
Q28P50 1.78e-15 79 28 8 224 3 rbsA Ribose import ATP-binding protein RbsA Jannaschia sp. (strain CCS1)
Q8RI39 5.55e-31 121 31 6 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8XZP8 5.83e-31 120 31 3 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q2SJY7 6.13e-31 120 30 4 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
P55662 6.38e-31 118 29 5 258 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q04BG2 7.88e-31 120 27 4 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
O31339 8.04e-31 120 29 3 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q2K8C8 8.16e-31 120 32 4 243 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P37388 8.39e-31 122 32 6 252 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
P37388 8.9e-14 73 27 5 219 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
P44785 8.55e-31 120 30 2 230 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QMH4 9.49e-31 119 30 2 230 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q8FV85 1.03e-30 120 31 3 228 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 1.03e-30 120 31 3 228 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 1.03e-30 120 31 3 228 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 1.03e-30 120 31 3 228 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q5HQ70 1.06e-30 120 28 4 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q609Q1 1.16e-30 119 29 3 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q16BC5 1.63e-30 117 31 4 238 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q65E55 1.67e-30 121 30 4 248 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65E55 5.04e-10 62 24 3 209 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q9CL63 1.69e-30 121 31 2 226 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q9CL63 3.32e-12 69 25 5 214 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q0AGF4 1.76e-30 119 31 4 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q6LKD4 1.81e-30 119 26 5 255 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q50801 1.84e-30 117 30 5 234 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q8A883 1.86e-30 120 29 5 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A1TXH7 1.87e-30 119 30 3 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q65VG9 1.92e-30 119 31 4 230 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5LBT4 2.07e-30 120 29 5 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64SQ6 2.2e-30 120 29 5 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
P21630 2.74e-30 115 30 4 249 3 braG High-affinity branched-chain amino acid transport ATP-binding protein BraG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0I348 2.83e-30 120 32 7 256 3 xylG Xylose import ATP-binding protein XylG Histophilus somni (strain 129Pt)
Q0I348 2.8e-11 66 27 8 233 3 xylG Xylose import ATP-binding protein XylG Histophilus somni (strain 129Pt)
Q8UH62 2.85e-30 118 28 4 253 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92XW1 3.15e-30 118 28 4 253 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
O83658 3.23e-30 119 31 6 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
A0PY57 3.46e-30 118 27 3 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
P31134 3.51e-30 119 31 3 244 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q1MQ44 3.56e-30 119 31 3 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q7NIW1 4.3e-30 118 29 4 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
O51587 4.58e-30 118 28 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q7AH43 4.85e-30 118 26 4 254 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q24XJ2 5.06e-30 118 26 3 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q0SML1 5.08e-30 118 28 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q1R0Z6 5.26e-30 116 33 5 240 3 phnC Phosphonates import ATP-binding protein PhnC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q660M8 5.69e-30 117 28 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q8U6M1 5.8e-30 117 31 4 243 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7CN92 5.9e-30 118 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 5.9e-30 118 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q1J6Q6 6.34e-30 118 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 6.34e-30 118 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 6.34e-30 118 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 6.34e-30 118 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q9WXX0 6.47e-30 120 34 2 226 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX0 1.47e-11 67 26 6 217 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8CPN0 6.67e-30 118 28 4 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q88ZJ6 8.96e-30 117 26 4 256 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q578K3 9.06e-30 117 31 4 248 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 9.06e-30 117 31 4 248 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q1B677 9.22e-30 117 28 2 243 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q8D0W8 9.72e-30 117 29 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q5XCA4 9.77e-30 117 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ35 1.07e-29 117 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 1.07e-29 117 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 1.07e-29 117 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q6MCV4 1.38e-29 117 32 4 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
P9WQM1 1.44e-29 117 28 2 238 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 1.44e-29 117 28 2 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 1.44e-29 117 28 2 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q6D734 1.53e-29 116 27 4 254 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7VM95 1.54e-29 116 30 3 230 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q58488 1.59e-29 115 29 6 247 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q1MMZ3 1.83e-29 115 29 4 239 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q65T42 1.91e-29 116 29 3 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8REG7 2.05e-29 114 27 4 251 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q1M8E0 2.63e-29 116 32 4 248 3 metN Methionine import ATP-binding protein MetN Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q02XM9 2.64e-29 118 28 3 250 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. cremoris (strain SK11)
Q02XM9 1.05e-10 64 26 7 215 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. cremoris (strain SK11)
Q89UD2 2.7e-29 115 27 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q92WJ0 2.83e-29 116 31 5 248 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q9JUX4 2.87e-29 116 28 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q87ZE0 2.92e-29 118 30 3 227 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87ZE0 5.73e-15 77 29 6 231 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q73P71 3.07e-29 114 27 6 249 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8FVV5 3.11e-29 115 31 4 248 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q6F9A8 3.21e-29 115 28 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q72FW5 3.21e-29 116 30 2 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q668K6 3.39e-29 116 28 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q9K6J9 4.05e-29 117 30 5 252 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K6J9 1.59e-10 64 25 10 235 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q4KDI2 4.06e-29 117 29 2 227 3 PFL_2594 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KDI2 3.54e-17 84 30 6 231 3 PFL_2594 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P45046 4.26e-29 117 32 6 252 3 xylG Xylose import ATP-binding protein XylG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45046 2.57e-11 66 27 7 214 3 xylG Xylose import ATP-binding protein XylG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9JZW0 4.34e-29 115 28 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P37009 4.42e-29 115 26 5 253 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
P0A191 4.48e-29 112 29 4 255 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A192 4.48e-29 112 29 4 255 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhi
Q110U3 5.05e-29 115 30 2 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q8ELR4 5.05e-29 115 27 5 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q30V33 5.34e-29 115 30 4 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q1GCR8 5.69e-29 112 31 7 253 3 thiQ Thiamine import ATP-binding protein ThiQ Ruegeria sp. (strain TM1040)
Q38VW6 6.31e-29 115 27 5 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q2KDV1 7e-29 113 30 5 239 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P36947 7.38e-29 117 27 4 248 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
P36947 2.25e-12 69 25 6 236 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
Q73F11 7.71e-29 114 28 5 252 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q63H29 8.04e-29 114 29 5 252 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
P74548 8.48e-29 114 28 4 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5YZY9 8.49e-29 114 27 3 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q2K284 8.59e-29 115 31 5 258 3 metN Methionine import ATP-binding protein MetN Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8NR12 9.27e-29 117 29 5 251 3 rbsA Ribose import ATP-binding protein RbsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NR12 1.11e-09 61 26 8 254 3 rbsA Ribose import ATP-binding protein RbsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q1QE80 9.57e-29 115 31 4 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q18AM3 9.65e-29 114 27 4 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
A0AGP9 9.77e-29 115 27 6 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q97JB8 9.79e-29 113 27 4 236 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8Y8T6 1.05e-28 114 27 6 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P32721 1.06e-28 116 30 4 239 3 alsA D-allose import ATP-binding protein AlsA Escherichia coli (strain K12)
P32721 5.08e-15 77 26 6 231 3 alsA D-allose import ATP-binding protein AlsA Escherichia coli (strain K12)
Q0I2Z4 1.07e-28 114 27 5 259 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q97KS6 1.23e-28 114 27 4 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q65M34 1.29e-28 114 28 3 229 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q92DL6 1.32e-28 114 27 5 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q132E8 1.43e-28 112 29 5 251 3 phnC Phosphonates import ATP-binding protein PhnC Rhodopseudomonas palustris (strain BisB5)
Q9I6T2 1.47e-28 114 30 4 241 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9K876 1.5e-28 114 28 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q87RS1 1.57e-28 114 29 3 230 1 metN Methionine import ATP-binding protein MetN Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P45022 1.58e-28 112 26 4 249 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q722B1 1.67e-28 114 26 6 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
P56344 1.75e-28 111 29 4 238 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
O05253 1.86e-28 115 32 3 228 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
O05253 5.68e-13 71 28 5 227 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
Q52666 1.93e-28 112 25 6 254 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q6NBX6 1.94e-28 112 30 5 250 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A3DDF6 2.03e-28 114 29 4 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
O34900 2.31e-28 111 28 7 255 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
Q1AS06 2.39e-28 114 29 4 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q8YCG3 2.61e-28 113 30 4 248 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q4ZZR8 2.82e-28 113 30 6 240 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q1BWI2 2.89e-28 112 32 3 238 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q03ZQ0 3.03e-28 113 25 4 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q39GT7 3.05e-28 112 33 3 233 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A1TAI4 3.13e-28 113 29 3 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q81VM2 3.87e-28 112 28 5 252 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q2JB14 3.92e-28 110 30 4 243 3 phnC Phosphonates import ATP-binding protein PhnC Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q48GY7 4.16e-28 115 30 3 226 3 PSPPH_3184 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48GY7 5.59e-11 65 25 5 231 3 PSPPH_3184 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9CK97 4.29e-28 112 30 4 232 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q8DUF7 4.32e-28 113 26 6 261 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q03CA4 4.41e-28 114 30 2 225 3 rbsA Ribose import ATP-binding protein RbsA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q03CA4 8.66e-16 79 28 6 228 3 rbsA Ribose import ATP-binding protein RbsA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q6D4W8 4.42e-28 115 30 3 240 3 araG Arabinose import ATP-binding protein AraG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4W8 1.54e-12 70 26 6 212 3 araG Arabinose import ATP-binding protein AraG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5E715 4.61e-28 112 29 4 241 3 metN Methionine import ATP-binding protein MetN Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q2RGX2 4.78e-28 114 31 4 233 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2RGX2 2.48e-11 66 22 5 215 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q6NBT1 4.82e-28 112 27 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q92EZ6 4.82e-28 112 30 3 224 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q0AU85 5.04e-28 112 30 5 235 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q1AXG5 5.09e-28 114 32 4 227 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1AXG5 4.04e-13 72 27 7 241 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q92W60 5.1e-28 114 28 5 252 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q92W60 1.3e-08 58 24 6 211 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q5HBR8 5.13e-28 110 26 5 255 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5FHB0 5.13e-28 110 26 5 255 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q1M360 5.18e-28 114 29 5 249 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M360 4.19e-10 63 21 4 214 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q07LY2 5.2e-28 110 29 5 252 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisA53)
Q58664 5.31e-28 110 29 2 249 3 livF Probable branched-chain amino acid transport ATP-binding protein LivF Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q3A9G5 5.32e-28 112 31 5 232 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P77795 6.82e-28 112 28 3 240 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q8YK28 6.82e-28 110 29 7 243 3 phnC3 Phosphonates import ATP-binding protein PhnC 3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7UC29 6.88e-28 112 27 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q8UA73 7.43e-28 112 26 3 252 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
P63354 7.48e-28 112 28 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 7.48e-28 112 28 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q13VD7 7.57e-28 112 27 5 258 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q0I3Y9 7.62e-28 112 28 4 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q20Y31 7.66e-28 110 30 5 249 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisB18)
Q8DZJ0 7.81e-28 112 25 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 7.81e-28 112 25 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 7.81e-28 112 25 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P16676 7.94e-28 112 27 4 252 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q5PCG9 8.18e-28 112 29 3 231 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8FFB3 8.27e-28 112 27 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8ZR89 8.61e-28 112 29 3 230 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q724C0 8.61e-28 112 30 3 224 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q7MPC5 8.66e-28 109 30 5 229 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain YJ016)
Q8DE95 8.66e-28 109 30 5 229 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain CMCP6)
Q8XBJ8 9.17e-28 112 27 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q30W28 9.44e-28 110 28 4 246 3 phnC Phosphonates import ATP-binding protein PhnC Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q5E586 9.45e-28 112 27 3 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8UAK2 9.67e-28 114 28 3 249 3 Atu3371 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UAK2 4.57e-14 74 27 8 235 3 Atu3371 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q65UE1 9.89e-28 112 27 3 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q98HF7 1.02e-27 112 29 4 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q4K681 1.04e-27 112 30 4 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6A6X6 1.06e-27 112 30 5 241 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q3SGJ8 1.08e-27 109 30 7 242 3 phnC Phosphonates import ATP-binding protein PhnC Thiobacillus denitrificans (strain ATCC 25259)
Q5HV18 1.11e-27 111 26 3 257 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni (strain RM1221)
Q0PAB6 1.11e-27 111 26 3 257 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9RR46 1.13e-27 112 27 3 240 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q8DFC3 1.13e-27 111 29 4 241 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
Q7MN25 1.16e-27 111 29 4 241 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
Q9CF44 1.18e-27 113 28 3 250 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. lactis (strain IL1403)
Q9CF44 2.2e-10 63 25 6 215 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. lactis (strain IL1403)
Q5WC31 1.26e-27 113 31 3 237 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q5WC31 7.32e-08 56 23 5 211 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q8A1M1 1.26e-27 108 28 4 230 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q9X051 1.27e-27 114 26 3 253 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X051 1.62e-11 67 23 7 243 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q57S53 1.33e-27 111 28 2 228 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
P22731 1.36e-27 108 29 4 255 1 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Escherichia coli (strain K12)
Q7VNG4 1.38e-27 112 29 6 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q2ISN3 1.42e-27 110 29 4 247 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain HaA2)
Q5LYN4 1.43e-27 112 26 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q5M397 1.47e-27 112 26 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q87UN4 1.51e-27 111 30 6 240 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q03JH1 1.62e-27 112 26 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q81IZ6 1.71e-27 111 29 5 243 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q4ZRC6 1.79e-27 113 30 3 226 3 Psyr_3264 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. syringae (strain B728a)
Q4ZRC6 6.99e-12 68 27 6 231 3 Psyr_3264 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. syringae (strain B728a)
Q12B04 1.83e-27 111 27 4 243 3 metN Methionine import ATP-binding protein MetN Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q83F44 1.85e-27 111 30 2 217 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q1JII9 2.06e-27 111 30 8 258 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q3K3R2 2.08e-27 112 28 3 248 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3K3R2 3.21e-11 66 25 6 220 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P0A2V2 2.33e-27 108 26 6 261 2 occP Octopine permease ATP-binding protein P Rhizobium radiobacter
P0A2V3 2.33e-27 108 26 6 261 3 occP Octopine permease ATP-binding protein P Agrobacterium tumefaciens (strain Ach5)
Q9A502 2.33e-27 110 32 7 246 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q667L9 2.79e-27 110 29 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q21TR5 2.82e-27 112 29 3 236 3 Rfer_3129 Putative ribose/galactose/methyl galactoside import ATP-binding protein Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21TR5 6.48e-07 53 24 6 214 3 Rfer_3129 Putative ribose/galactose/methyl galactoside import ATP-binding protein Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A0LUE6 2.88e-27 111 32 3 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q830W6 2.96e-27 110 26 4 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q1J8E4 3.02e-27 110 29 7 258 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q18C09 3.15e-27 110 26 5 256 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q8Z4V6 3.19e-27 110 27 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q8E7N9 3.23e-27 112 28 3 248 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q8E7N9 5.26e-11 65 25 6 220 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q6D645 3.26e-27 108 30 6 252 3 hmuV Hemin import ATP-binding protein HmuV Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P40860 3.31e-27 110 27 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4FMG5 3.33e-27 108 28 3 208 3 tauB Taurine import ATP-binding protein TauB Pelagibacter ubique (strain HTCC1062)
Q0SFW6 3.34e-27 110 31 4 232 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
P14175 3.48e-27 111 29 4 239 1 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Escherichia coli (strain K12)
Q6D3Q6 3.89e-27 110 29 3 231 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7N3S7 3.89e-27 108 29 7 253 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6LV32 4e-27 107 30 4 226 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
Q9X196 4.07e-27 110 28 4 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q5ZUG5 4.21e-27 110 27 3 244 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5KVK2 4.28e-27 110 29 6 247 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q5XDS8 4.42e-27 110 30 8 258 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q88RL5 4.46e-27 109 30 5 240 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8P2K6 4.6e-27 110 30 8 258 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q48V78 4.65e-27 110 30 8 258 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 4.65e-27 110 30 8 258 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q63S19 4.7e-27 110 27 5 258 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 4.7e-27 110 27 5 258 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 4.7e-27 110 27 5 258 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
Q1GMA8 4.85e-27 108 28 6 253 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Ruegeria sp. (strain TM1040)
Q8TIX0 4.88e-27 109 29 6 258 3 MA_4020 Putative ABC transporter ATP-binding protein MA_4020 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P0CZ31 4.9e-27 110 30 8 258 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ30 4.9e-27 110 30 8 258 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q1JNE0 5.1e-27 110 30 8 258 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 5.1e-27 110 30 8 258 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q8E281 5.14e-27 112 28 3 248 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E281 7.43e-11 65 25 6 220 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8YA75 5.2e-27 109 29 3 224 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q6LUY1 5.2e-27 112 34 5 229 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q6LUY1 4.98e-14 74 28 5 215 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
P17328 5.39e-27 110 29 4 239 2 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O69063 6.04e-27 109 31 5 246 3 htxD Hypophosphite import ATP-binding protein HtxD Stutzerimonas stutzeri
Q63TX3 6.05e-27 108 32 5 256 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q8G5P8 6.1e-27 110 30 4 230 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q3JSQ0 6.17e-27 108 32 5 256 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 6.17e-27 108 32 5 256 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q9TKX3 6.37e-27 109 27 3 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9HNI8 6.38e-27 108 29 4 231 3 phnC Phosphonates import ATP-binding protein PhnC Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q5WVL8 6.5e-27 109 27 3 244 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q0ST95 6.72e-27 111 26 3 240 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain SM101 / Type A)
Q0ST95 2.8e-15 78 26 6 233 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain SM101 / Type A)
Q3BNZ3 6.75e-27 109 31 7 244 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8UIW7 6.88e-27 108 28 4 238 3 phnC Phosphonates import ATP-binding protein PhnC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0I5E9 6.92e-27 109 28 2 235 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q52815 7e-27 107 25 4 254 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q5FA19 7.09e-27 109 32 7 253 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q8EPK1 7.23e-27 109 29 4 233 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q49WM4 7.8e-27 109 26 4 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9KS33 8.1e-27 110 28 5 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P55604 8.18e-27 109 29 5 245 3 NGR_a02170 Uncharacterized ABC transporter ATP-binding protein y4oS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q92UV5 8.42e-27 110 30 3 236 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q5X484 8.85e-27 109 27 4 244 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
Q663Y5 9.04e-27 111 31 6 252 3 xylG Xylose import ATP-binding protein XylG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q663Y5 1.27e-12 70 26 5 214 3 xylG Xylose import ATP-binding protein XylG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CDC0 9.04e-27 111 31 6 252 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDC0 1.27e-12 70 26 5 214 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CFR2 9.04e-27 111 31 6 252 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis
Q7CFR2 1.27e-12 70 26 5 214 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis
Q1C0D5 9.04e-27 111 31 6 252 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C0D5 1.27e-12 70 26 5 214 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Antiqua)
Q16BJ3 9.09e-27 107 29 5 230 3 tauB Taurine import ATP-binding protein TauB Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q6DB03 9.11e-27 111 32 6 241 3 xylG Xylose import ATP-binding protein XylG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6DB03 4.86e-15 77 29 7 217 3 xylG Xylose import ATP-binding protein XylG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5HQQ9 9.22e-27 109 28 4 232 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9K7C3 9.42e-27 111 28 5 236 3 araG L-arabinose transport ATP-binding protein AraG Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K7C3 1.89e-12 70 25 4 212 3 araG L-arabinose transport ATP-binding protein AraG Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q32JQ8 1.03e-26 108 29 5 249 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
D4GP38 1.04e-26 109 27 4 251 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P30750 1.07e-26 108 29 5 249 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q2K204 1.2e-26 110 30 6 254 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K204 2.55e-05 48 28 1 78 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3AKM8 1.21e-26 107 31 5 235 3 phnC Phosphonates import ATP-binding protein PhnC Synechococcus sp. (strain CC9605)
P45769 1.22e-26 107 25 5 257 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q72AQ6 1.26e-26 107 29 4 242 3 phnC Phosphonates import ATP-binding protein PhnC Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8PYH5 1.34e-26 108 29 7 262 3 MM_0887 Putative ABC transporter ATP-binding protein MM_0887 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q83GE8 1.36e-26 107 31 8 238 3 pstB Phosphate import ATP-binding protein PstB Tropheryma whipplei (strain Twist)
Q7N8M2 1.38e-26 108 29 3 228 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8RFN2 1.39e-26 108 30 3 232 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q2NRN5 1.44e-26 108 28 5 258 3 metN Methionine import ATP-binding protein MetN Sodalis glossinidius (strain morsitans)
Q9CGD4 1.45e-26 110 25 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q8XKQ2 1.48e-26 110 26 3 240 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain 13 / Type A)
Q8XKQ2 9.52e-15 76 26 5 231 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain 13 / Type A)
Q02Z10 1.5e-26 109 25 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
Q3Z5F8 1.5e-26 108 29 5 249 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 1.5e-26 108 29 5 249 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 1.5e-26 108 29 5 249 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 1.5e-26 108 29 5 249 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
Q8KFD6 1.51e-26 107 28 2 233 3 CT0391 Putative ABC transporter ATP-binding protein CT0391 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q0TLD2 1.56e-26 108 29 5 249 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1BWL4 1.56e-26 108 30 4 228 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 1.56e-26 108 30 4 228 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q0TQU8 1.62e-26 110 26 3 240 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TQU8 6.35e-15 77 26 5 231 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q48PU6 1.64e-26 108 30 6 240 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6AE21 1.74e-26 108 30 4 233 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q8U949 1.76e-26 110 31 4 248 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U949 1.4e-10 64 25 4 214 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q3JHZ1 1.77e-26 110 33 4 229 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia pseudomallei (strain 1710b)
Q3JHZ1 2.55e-13 72 28 4 213 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia pseudomallei (strain 1710b)
Q8Z8R5 1.81e-26 108 28 2 228 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q325U1 1.82e-26 108 29 5 249 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
Q65S66 1.85e-26 108 26 4 256 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q6LR20 1.92e-26 108 28 4 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
O26236 2.08e-26 107 27 5 234 3 MTH_133 Putative ABC transporter ATP-binding protein MTH_133 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q98DA2 2.13e-26 108 31 5 258 3 metN Methionine import ATP-binding protein MetN Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0SSJ0 2.16e-26 110 28 2 239 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain SM101 / Type A)
Q0SSJ0 4.44e-15 77 25 7 235 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain SM101 / Type A)
Q0SRL2 2.23e-26 108 27 5 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q24QI5 2.46e-26 108 28 6 252 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q4L5B3 2.48e-26 108 26 3 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q1CFH7 2.5e-26 108 29 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 2.5e-26 108 29 4 230 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 2.5e-26 108 29 4 230 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q9HT70 2.55e-26 107 30 7 252 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 2.55e-26 107 30 7 252 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q0TPX5 2.61e-26 110 28 2 239 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TPX5 1.44e-16 82 26 7 235 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q63P06 2.75e-26 110 33 4 229 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia pseudomallei (strain K96243)
Q63P06 2.63e-13 72 28 4 213 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia pseudomallei (strain K96243)
Q8Z990 2.77e-26 107 28 3 247 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhi
Q98K23 2.84e-26 107 27 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1IGZ0 3.14e-26 107 30 4 231 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q9KTJ5 3.22e-26 107 28 3 233 3 metN Methionine import ATP-binding protein MetN Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P45171 3.23e-26 108 27 2 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0S9A4 3.45e-26 109 30 4 250 3 rbsA Ribose import ATP-binding protein RbsA Rhodococcus jostii (strain RHA1)
Q0S9A4 2.56e-13 72 26 6 214 3 rbsA Ribose import ATP-binding protein RbsA Rhodococcus jostii (strain RHA1)
Q8UA86 3.59e-26 109 31 2 235 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UA86 2.89e-15 78 26 7 263 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4QK57 3.61e-26 108 27 2 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q8XJX3 3.72e-26 109 27 2 239 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain 13 / Type A)
Q8XJX3 2.4e-16 81 26 7 235 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain 13 / Type A)
Q6D1C4 3.78e-26 107 28 4 247 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A3CMQ7 4.1e-26 108 26 3 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q2SVP3 4.48e-26 106 32 5 242 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8RD43 4.8e-26 109 28 4 251 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD43 4.13e-19 89 25 6 255 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5PID0 5.09e-26 107 28 4 249 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8CTB2 5.58e-26 107 28 4 232 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q6GIH9 5.64e-26 107 28 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
P37624 5.7e-26 109 32 4 236 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P37624 1.35e-12 70 25 8 259 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
Q28K97 5.91e-26 105 29 5 230 3 tauB Taurine import ATP-binding protein TauB Jannaschia sp. (strain CCS1)
Q5PFQ7 6.01e-26 107 29 5 241 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z8W8 6.08e-26 107 29 5 241 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q3KK97 6.12e-26 107 30 6 240 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain Pf0-1)
Q2YWP2 6.51e-26 107 28 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2JPW6 6.65e-26 105 29 6 255 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q1WVG9 6.74e-26 107 29 7 267 3 metN Methionine import ATP-binding protein MetN Ligilactobacillus salivarius (strain UCC118)
Q5FKL2 6.81e-26 107 30 7 256 3 metN Methionine import ATP-binding protein MetN Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q49W48 6.86e-26 106 26 5 243 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5WKL3 7.17e-26 107 27 2 228 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q6G2E2 7.17e-26 106 29 4 232 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q5KYS1 7.26e-26 108 29 5 238 3 xylG Xylose import ATP-binding protein XylG Geobacillus kaustophilus (strain HTA426)
Q5KYS1 3.46e-12 69 29 7 219 3 xylG Xylose import ATP-binding protein XylG Geobacillus kaustophilus (strain HTA426)
Q7A6M2 7.75e-26 106 28 4 230 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q99VG8 7.75e-26 106 28 4 230 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9KFL0 7.77e-26 104 25 3 230 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0KDG3 7.95e-26 106 26 5 258 3 metN Methionine import ATP-binding protein MetN Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8NXH5 8.16e-26 106 28 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q6GB18 8.16e-26 106 28 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q5HHK4 8.16e-26 106 28 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q2FZZ2 8.16e-26 106 28 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FII2 8.16e-26 106 28 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
Q57293 8.35e-26 106 28 4 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q2SY12 8.45e-26 106 26 5 258 3 metN Methionine import ATP-binding protein MetN Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q21BU8 8.55e-26 106 27 3 230 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q04DA7 8.74e-26 106 26 5 262 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q160M2 8.87e-26 107 28 4 251 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q8XIZ5 9.39e-26 106 27 5 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 9.39e-26 106 27 5 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q1M5X4 9.61e-26 108 30 5 254 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M5X4 4.59e-15 77 26 7 244 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8CUY0 1e-25 104 29 5 238 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8Y4L8 1.02e-25 106 28 4 242 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q1M7W6 1.07e-25 105 31 3 238 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9CIN4 1.09e-25 106 29 9 259 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. lactis (strain IL1403)
Q6N798 1.12e-25 106 29 4 236 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q82CM5 1.15e-25 108 27 5 254 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82CM5 6.5e-08 56 27 8 216 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q83MC5 1.17e-25 106 28 5 249 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 1.17e-25 106 28 5 249 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
Q3MAR5 1.23e-25 106 29 3 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8G847 1.24e-25 108 32 7 234 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q8G847 1.44e-12 70 26 5 237 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q1WVI7 1.24e-25 106 27 4 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q02ME3 1.25e-25 106 30 7 244 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9F9B0 1.26e-25 104 29 5 241 1 frcA Fructose import ATP-binding protein FrcA Rhizobium meliloti
Q92V71 1.26e-25 104 28 4 239 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium meliloti (strain 1021)
Q4L4R9 1.27e-25 106 25 4 241 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q4W575 1.29e-25 106 31 7 253 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 1.29e-25 106 31 7 253 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q03P57 1.33e-25 106 29 6 251 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q7MEV1 1.34e-25 107 29 2 230 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q7MEV1 3.17e-12 69 26 4 214 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q471U2 1.34e-25 104 30 5 228 3 tauB Taurine import ATP-binding protein TauB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P96063 1.35e-25 106 29 5 241 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P73265 1.53e-25 104 28 6 228 3 nrtD Nitrate import ATP-binding protein NrtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P72335 1.65e-25 105 33 5 245 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q8PGE8 1.66e-25 105 31 7 244 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q13LD8 1.74e-25 106 30 5 238 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q47T99 1.77e-25 106 31 3 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q8X5Q4 1.87e-25 107 29 4 249 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Escherichia coli O157:H7
Q8X5Q4 8.02e-16 79 29 5 215 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Escherichia coli O157:H7
Q8YM92 1.89e-25 106 29 3 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O85818 1.96e-25 106 26 2 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q71X09 2.03e-25 105 28 4 242 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
Q8ZRM9 2.16e-25 105 28 4 249 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4KKK8 2.17e-25 105 29 5 240 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q2RWA3 2.17e-25 105 27 5 244 3 metN Methionine import ATP-binding protein MetN Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A3CVD3 2.17e-25 104 28 4 246 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q4UMZ7 2.23e-25 102 26 5 234 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11430
Feature type CDS
Gene livG
Product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG
Location 429457 - 430227 (strand: 1)
Length 771 (nucleotides) / 256 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2605
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00005 ABC transporter
PF12399 Branched-chain amino acid ATP-binding cassette transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0411 Amino acid transport and metabolism (E) E ABC-type branched-chain amino acid transport system, ATPase component LivG

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01995 branched-chain amino acid transport system ATP-binding protein ABC transporters
Quorum sensing		 -

Protein Sequence

MTDTLLQVSDLTMRFGGLLAVNQVSLHLNKGEIVSLIGPNGAGKTTIFNCLTGFYKPAGGEILLRGKPVQGLSGQAIAKRGMIRTFQHVRLFKEMTVIENLLVAQHQHHKSGLLAGLLTLPSFRRDQREAMENAVMWLERTGLTAVANRQAGNLAYGQQRRLEIARCMVTRPDILMLDEPAAGLNPKETDDLDALIIELRAKHSVSVLLIEHDMKLVMGISDRIYVVNQGTPLANGTPAEIRNHPDVIRAYLGEAY

Flanking regions ( +/- flanking 50bp)

CCGCACCTGAAAATTCGCACCGGCTCCGCTGAAAAAACCGGAGGTGCGCAATGACAGACACATTATTGCAGGTATCAGACCTGACGATGCGCTTCGGCGGATTACTGGCGGTAAATCAGGTTTCACTGCATCTGAATAAGGGCGAAATTGTCTCGCTGATTGGCCCGAATGGTGCCGGAAAAACCACTATTTTCAACTGTTTAACCGGGTTTTATAAACCGGCTGGCGGAGAGATCCTGCTGCGCGGTAAACCGGTACAGGGCTTATCCGGGCAGGCTATCGCAAAGCGCGGGATGATCCGCACTTTTCAGCATGTGCGCCTGTTTAAAGAGATGACGGTGATTGAAAACCTGCTGGTGGCGCAGCATCAGCACCACAAAAGCGGGTTGCTGGCAGGATTGCTGACCCTGCCGTCATTTCGCCGTGATCAGCGCGAAGCCATGGAAAATGCGGTTATGTGGCTGGAGCGCACCGGGCTTACTGCGGTGGCAAACCGGCAGGCAGGAAACCTGGCGTATGGTCAGCAGCGGCGGCTGGAAATCGCCCGCTGTATGGTGACCCGCCCGGATATTCTGATGCTGGATGAACCCGCCGCCGGGCTGAACCCGAAAGAAACAGACGATTTGGATGCGCTGATTATTGAACTGCGTGCAAAGCACAGCGTATCTGTATTATTGATTGAGCATGATATGAAACTGGTGATGGGCATTTCTGACCGGATCTATGTGGTAAACCAGGGAACACCACTGGCAAACGGCACACCGGCTGAAATTCGTAATCATCCTGATGTGATCCGCGCGTATTTAGGGGAGGCGTATTAATGCTGGAATTTAATAATGTCAGCGCACAATACGGCAAAATTCAGGCGCTG