Homologs in group_2631

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03465 FBDBKF_03465 100.0 Morganella morganii S1 livG high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG
EHELCC_07070 EHELCC_07070 100.0 Morganella morganii S2 livG high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG
LHKJJB_06930 LHKJJB_06930 100.0 Morganella morganii S3 livG high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG
HKOGLL_04000 HKOGLL_04000 100.0 Morganella morganii S5 livG high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG
F4V73_RS11430 F4V73_RS11430 91.8 Morganella psychrotolerans livG high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG

Distribution of the homologs in the orthogroup group_2631

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2631

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9S9 2.52e-142 402 77 0 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Shigella flexneri
P0A9S7 2.52e-142 402 77 0 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli (strain K12)
P0A9S8 2.52e-142 402 77 0 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli O157:H7
P0A193 8.06e-142 400 76 0 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A194 8.06e-142 400 76 0 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhi
P21629 1.28e-131 375 69 0 255 3 braF High-affinity branched-chain amino acid transport ATP-binding protein BraF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O28881 2.87e-51 171 36 3 255 3 livG Probable branched-chain amino acid transport ATP-binding protein LivG Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q58663 2.61e-45 155 33 5 260 1 livG Probable branched-chain amino acid transport ATP-binding protein LivG Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P33982 7.88e-43 149 35 3 251 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P45073 8.28e-39 138 32 4 253 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P25885 1.16e-38 139 35 3 254 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
Q88AS5 1.46e-37 137 31 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q6D201 3.49e-37 136 30 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6WB63 9.08e-37 134 36 5 246 3 phnC Phosphonates import ATP-binding protein PhnC Alcaligenes faecalis
P24693 9.18e-37 133 34 3 226 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
Q7M8M4 1.22e-36 133 32 4 242 3 phnC Phosphonates import ATP-binding protein PhnC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q5ZWE4 4.08e-36 134 31 3 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q2JLH7 4.21e-36 132 34 6 256 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q3IM24 4.86e-36 132 35 6 239 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q5X627 5.08e-36 134 31 3 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q8Z0H0 5.42e-36 133 31 2 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8D653 6.86e-36 133 32 5 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
P0A9V4 7.14e-36 130 33 3 251 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V1 7.14e-36 130 33 3 251 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V2 7.14e-36 130 33 3 251 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V3 7.14e-36 130 33 3 251 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
Q88CL2 1.03e-35 132 30 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q93DX8 1.21e-35 130 32 5 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q042G7 1.29e-35 133 29 3 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q38WL5 1.45e-35 132 33 5 242 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q5WXF0 1.64e-35 132 31 3 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q6MU19 3.16e-35 132 30 4 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q74K65 4.27e-35 131 29 3 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q2SSS4 4.37e-35 131 30 4 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q6F0V4 8.22e-35 130 29 5 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q9CL63 9.95e-35 133 33 2 233 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q9CL63 1.89e-11 67 24 6 213 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q03PF2 1.69e-34 130 31 4 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P54537 1.88e-34 127 29 4 249 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q62K82 1.96e-34 129 32 5 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q63TY1 2.24e-34 129 32 5 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q8UH62 3.87e-34 129 30 4 253 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
P55662 7.06e-34 125 30 5 258 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2YAD6 8.16e-34 128 32 3 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q16BC5 1.12e-33 125 33 5 240 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q20ZP0 1.37e-33 125 32 6 255 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisB18)
Q03AH0 1.51e-33 127 28 4 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q7NQN5 1.74e-33 127 31 3 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1B677 1.92e-33 126 31 2 235 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q28P50 2.61e-33 129 33 3 253 3 rbsA Ribose import ATP-binding protein RbsA Jannaschia sp. (strain CCS1)
Q28P50 2.72e-16 81 28 8 224 3 rbsA Ribose import ATP-binding protein RbsA Jannaschia sp. (strain CCS1)
Q9HY19 2.63e-33 127 33 3 245 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02R79 2.68e-33 127 33 3 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q89C51 2.74e-33 124 33 6 249 3 phnC Phosphonates import ATP-binding protein PhnC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8F6Z1 2.85e-33 126 30 4 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 2.85e-33 126 30 4 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q9I6L0 3.74e-33 125 30 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q81GC1 3.83e-33 125 30 3 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8FCE2 4.11e-33 129 32 4 251 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCE2 3.81e-15 77 31 8 218 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBN5 4.11e-33 129 32 4 251 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBN5 3.81e-15 77 31 8 218 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R528 4.24e-33 129 32 4 251 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q1R528 1.77e-15 79 30 7 214 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q0SWH9 4.67e-33 124 28 4 250 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain SM101 / Type A)
Q8DIA0 4.97e-33 125 31 3 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q31V51 5.24e-33 128 32 4 251 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q31V51 4.11e-15 77 30 7 214 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q8XDM1 5.24e-33 128 32 4 251 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q8XDM1 4.11e-15 77 30 7 214 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q7N6Z2 5.35e-33 126 30 5 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6NBX6 5.83e-33 124 34 6 249 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1GIE5 6.7e-33 126 31 3 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q9WXX0 6.77e-33 128 36 2 226 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX0 1.9e-13 72 25 6 224 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q92VJ2 6.98e-33 125 29 4 253 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q6F9A8 7.59e-33 125 30 5 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q5FL41 8.39e-33 125 28 5 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q2IYS5 1.05e-32 123 33 6 255 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
P32721 1.12e-32 127 30 4 253 3 alsA D-allose import ATP-binding protein AlsA Escherichia coli (strain K12)
P32721 3.04e-14 75 25 6 232 3 alsA D-allose import ATP-binding protein AlsA Escherichia coli (strain K12)
Q0SY86 1.13e-32 127 32 4 251 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
Q0SY86 6.21e-15 77 29 7 214 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
Q92XW1 1.16e-32 125 29 4 253 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q14Q07 1.17e-32 125 29 4 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q82TL6 1.25e-32 125 31 3 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P14788 1.34e-32 124 31 5 241 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P44785 1.51e-32 124 31 3 232 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QMH4 1.92e-32 124 31 3 232 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q6HLQ9 1.97e-32 124 30 4 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
P37388 1.98e-32 127 32 4 251 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
P37388 4.07e-15 77 30 7 214 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
Q0TUN8 1.99e-32 122 28 4 250 1 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
O27739 2e-32 123 31 5 236 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q63E84 2.12e-32 124 30 4 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 2.12e-32 124 30 4 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 2.12e-32 124 30 4 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q7NX01 2.12e-32 124 31 4 253 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1B8V9 2.28e-32 125 29 3 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 2.28e-32 125 29 3 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
A1VZQ5 2.9e-32 121 25 1 248 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q83J33 3.02e-32 126 32 4 246 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q83J33 4.22e-15 77 28 5 214 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q07PZ0 3.72e-32 122 33 6 255 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisA53)
Q8E8K8 3.73e-32 124 29 4 251 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1TXH7 4.21e-32 124 31 2 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A2RKA7 4.98e-32 125 31 2 232 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
A2RKA7 1.47e-13 73 28 8 238 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
Q0P9X7 5.15e-32 120 25 1 248 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q81TH8 5.66e-32 122 30 4 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q9G4F5 6.63e-32 123 30 5 251 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q6A6X6 6.79e-32 123 33 4 236 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q8YUV1 7.56e-32 120 31 4 243 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q74IV9 7.62e-32 122 31 7 263 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q5L222 8.1e-32 122 28 4 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q82WT5 8.63e-32 123 29 3 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q88ZJ6 9.28e-32 122 29 5 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P27675 1.12e-31 119 28 5 239 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q7NWX3 1.13e-31 122 32 4 252 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0AGF4 1.16e-31 122 31 2 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q2ISN3 1.25e-31 120 32 6 248 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain HaA2)
Q132E8 1.27e-31 120 32 6 248 3 phnC Phosphonates import ATP-binding protein PhnC Rhodopseudomonas palustris (strain BisB5)
Q5HV18 1.27e-31 122 26 3 257 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni (strain RM1221)
Q0PAB6 1.27e-31 122 26 3 257 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q8FV85 1.29e-31 122 32 4 220 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 1.29e-31 122 32 4 220 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 1.29e-31 122 32 4 220 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 1.29e-31 122 32 4 220 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
P63354 1.31e-31 122 29 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 1.31e-31 122 29 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8CUY0 1.38e-31 120 31 5 238 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q6NBT1 1.4e-31 122 30 5 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
O05253 1.4e-31 124 34 3 221 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
O05253 5.64e-15 77 27 5 238 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
Q04G50 1.42e-31 122 26 4 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q72FW5 1.59e-31 122 31 2 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q73P71 1.83e-31 119 27 6 249 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
O31339 1.98e-31 122 29 4 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
P21630 2.01e-31 119 32 4 249 3 braG High-affinity branched-chain amino acid transport ATP-binding protein BraG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KLQ5 2.1e-31 121 29 5 250 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q65VG9 2.16e-31 121 31 4 232 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1MQ44 2.29e-31 122 31 3 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q5YZY9 2.36e-31 121 28 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q5UW69 2.52e-31 119 33 4 238 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q89UD2 2.54e-31 121 29 6 254 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5PCG9 2.8e-31 121 30 3 231 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P0A191 3.05e-31 118 31 5 256 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A192 3.05e-31 118 31 5 256 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhi
Q7WGW1 3.19e-31 121 31 7 254 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9MUN1 3.42e-31 121 30 5 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q64SQ6 3.52e-31 123 28 4 256 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q043Y8 3.52e-31 121 30 5 261 3 metN Methionine import ATP-binding protein MetN Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q1GB17 3.77e-31 121 27 4 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q5LBT4 3.77e-31 122 28 4 256 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q0A9E2 3.78e-31 119 32 7 254 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q7VZE5 4.31e-31 120 31 7 254 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8RI39 4.33e-31 121 30 5 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q7W9U5 4.54e-31 120 31 7 254 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7CN92 4.57e-31 121 28 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 4.57e-31 121 28 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q30V33 4.57e-31 121 29 2 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q07LY2 4.84e-31 119 33 6 243 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisA53)
Q8D0W8 4.87e-31 120 30 5 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q50801 5.78e-31 119 30 5 234 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q0SSJ0 5.95e-31 122 29 2 239 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain SM101 / Type A)
Q0SSJ0 1.14e-15 79 25 7 235 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain SM101 / Type A)
Q8XNY7 6.18e-31 119 27 4 250 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)
Q0TPX5 6.77e-31 122 29 2 239 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TPX5 4.82e-17 83 26 7 235 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q1J6Q6 7.05e-31 120 28 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 7.05e-31 120 28 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 7.05e-31 120 28 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 7.05e-31 120 28 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q81GU1 7.4e-31 120 29 4 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q04BG2 8.22e-31 120 27 4 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q609Q1 8.74e-31 120 30 4 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q73F11 1.04e-30 119 28 5 252 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
O34677 1.06e-30 117 25 4 251 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q9JUX4 1.07e-30 120 29 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8XJX3 1.12e-30 122 29 2 239 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain 13 / Type A)
Q8XJX3 9.02e-17 82 26 7 235 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain 13 / Type A)
Q5XCA4 1.14e-30 120 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1QE80 1.17e-30 120 32 4 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q6D3Q6 1.24e-30 119 29 4 241 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P0CZ35 1.3e-30 120 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 1.3e-30 120 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 1.3e-30 120 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8A1M1 1.35e-30 116 29 5 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
O51587 1.37e-30 119 28 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q8ZR89 1.38e-30 119 30 3 230 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1M8E0 1.39e-30 119 32 4 248 3 metN Methionine import ATP-binding protein MetN Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9K6J9 1.4e-30 121 30 5 252 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K6J9 1.13e-11 67 25 8 232 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7N8B9 1.47e-30 119 27 4 253 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8XZP8 1.48e-30 119 32 4 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0SFW6 1.52e-30 119 32 4 232 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q660M8 1.54e-30 119 28 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q9KS33 1.57e-30 120 30 6 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q0SML1 1.57e-30 119 28 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q9JZW0 1.59e-30 119 29 4 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q7VM95 1.64e-30 119 30 3 230 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7AH43 1.66e-30 119 27 4 254 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q668K6 1.84e-30 119 29 5 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q578K3 1.85e-30 119 32 5 247 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 1.85e-30 119 32 5 247 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q9A502 1.94e-30 119 32 5 246 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A1TAI4 1.95e-30 119 30 3 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q65E55 2.26e-30 121 32 2 216 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65E55 1.51e-11 67 25 6 217 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q5ZUG5 2.33e-30 119 28 3 244 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q18C09 2.37e-30 118 27 5 256 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q2K8C8 2.5e-30 119 32 5 243 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q12B04 2.66e-30 119 30 4 243 3 metN Methionine import ATP-binding protein MetN Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q63H29 2.91e-30 118 29 5 252 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q0I3Y9 2.93e-30 119 28 5 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
A0AGP9 2.98e-30 119 28 6 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q3A9G5 3.18e-30 118 30 4 230 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q1AXG5 3.25e-30 120 33 4 227 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1AXG5 7.97e-14 73 30 9 232 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q6MCV4 3.77e-30 119 30 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q8DUF7 3.87e-30 119 27 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5WVL8 3.87e-30 118 27 3 244 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q6AE21 4.01e-30 118 30 4 250 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q722B1 4.02e-30 118 27 5 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q5E586 4.12e-30 118 27 3 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q2SJY7 4.44e-30 118 28 4 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q1AS06 4.54e-30 118 29 4 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q81VM2 4.74e-30 118 29 5 252 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q57S53 4.86e-30 117 30 3 230 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q65T42 4.87e-30 118 29 3 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8A883 5.27e-30 119 28 4 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q92DL6 5.37e-30 118 28 5 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5X484 5.63e-30 117 28 3 244 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
P45046 6.01e-30 120 31 5 251 3 xylG Xylose import ATP-binding protein XylG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45046 6.33e-14 74 28 8 222 3 xylG Xylose import ATP-binding protein XylG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P36947 6.04e-30 120 29 3 239 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
P36947 3.42e-12 69 26 5 219 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
Q63S19 6.19e-30 117 29 7 260 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 6.19e-30 117 29 7 260 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 6.19e-30 117 29 7 260 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
Q0I5E9 6.23e-30 117 30 4 238 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q8FVV5 6.24e-30 117 32 5 247 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q52815 6.32e-30 115 26 6 257 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q97KS6 7.24e-30 117 29 5 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q39GT7 7.46e-30 116 34 5 245 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8G5P8 8.01e-30 118 32 4 221 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q4KDI2 8.16e-30 119 29 2 227 3 PFL_2594 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KDI2 6.6e-16 80 29 8 221 3 PFL_2594 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A3DDF6 8.2e-30 117 29 4 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q2K284 8.4e-30 117 33 5 246 3 metN Methionine import ATP-binding protein MetN Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3K3R2 8.68e-30 119 29 3 248 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3K3R2 2.47e-12 69 25 6 217 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8REG7 9.18e-30 115 26 4 251 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q18AM3 9.37e-30 117 27 4 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
A0PY57 9.47e-30 117 26 3 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q8NR12 1.03e-29 119 31 3 230 3 rbsA Ribose import ATP-binding protein RbsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NR12 1.92e-10 63 27 8 229 3 rbsA Ribose import ATP-binding protein RbsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q6LKD4 1.14e-29 117 26 4 256 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q1BWI2 1.15e-29 116 32 5 258 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q8Y8T6 1.17e-29 117 28 5 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P37009 1.24e-29 117 27 5 254 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q2K204 1.35e-29 119 31 6 253 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K204 9.04e-06 50 28 1 78 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P74548 1.43e-29 117 28 3 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9KFL0 1.44e-29 114 27 5 245 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P31134 1.46e-29 117 31 4 241 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q6LUY1 1.53e-29 119 32 5 251 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q6LUY1 2.86e-13 72 27 6 215 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q28VN1 1.53e-29 114 32 7 250 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
P45022 1.57e-29 114 25 4 249 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8U6M1 1.57e-29 116 32 5 243 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q81IZ6 1.66e-29 116 29 5 243 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q87ZE0 1.71e-29 119 30 3 227 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87ZE0 9.8e-14 73 28 9 232 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q52666 1.79e-29 114 27 7 251 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q8E7N9 1.82e-29 118 29 3 248 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q8E7N9 6.05e-12 68 25 6 217 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q73XU8 1.87e-29 116 28 2 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q110U3 2.02e-29 117 29 2 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q8UA86 2.17e-29 118 30 3 249 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UA86 3.65e-16 80 26 7 245 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
P22731 2.18e-29 113 30 5 256 1 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Escherichia coli (strain K12)
Q7UC29 2.27e-29 116 28 5 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q8E281 2.32e-29 118 29 3 248 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E281 6.46e-12 68 24 6 217 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8YK28 2.33e-29 114 31 7 243 3 phnC3 Phosphonates import ATP-binding protein PhnC 3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q0I348 2.34e-29 118 31 5 251 3 xylG Xylose import ATP-binding protein XylG Histophilus somni (strain 129Pt)
Q0I348 4.42e-12 68 27 7 225 3 xylG Xylose import ATP-binding protein XylG Histophilus somni (strain 129Pt)
Q8XBJ8 2.44e-29 116 28 5 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
P40860 2.47e-29 116 28 6 254 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P16676 2.49e-29 116 28 5 252 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q7NIW1 2.59e-29 115 28 3 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q8Z4V6 2.61e-29 116 28 6 254 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q8FFB3 2.65e-29 116 28 5 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0AU85 2.66e-29 115 30 5 240 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q8Z8R5 2.7e-29 115 30 3 230 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q5WC31 3.06e-29 118 31 3 232 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q5WC31 7.79e-09 59 23 8 238 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q8UAK2 3.12e-29 118 28 3 249 3 Atu3371 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UAK2 4e-14 75 28 9 235 3 Atu3371 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8RD43 3.27e-29 118 29 4 251 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD43 6.36e-20 91 26 6 231 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q03CA4 4e-29 117 30 2 225 3 rbsA Ribose import ATP-binding protein RbsA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q03CA4 4.91e-16 80 29 8 233 3 rbsA Ribose import ATP-binding protein RbsA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q6D734 4.13e-29 115 25 3 254 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5KYS1 4.25e-29 117 30 4 237 3 xylG Xylose import ATP-binding protein XylG Geobacillus kaustophilus (strain HTA426)
Q5KYS1 1.05e-13 73 29 7 219 3 xylG Xylose import ATP-binding protein XylG Geobacillus kaustophilus (strain HTA426)
Q6DB03 4.33e-29 117 31 5 251 3 xylG Xylose import ATP-binding protein XylG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6DB03 2.88e-14 75 29 6 216 3 xylG Xylose import ATP-binding protein XylG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9X051 4.33e-29 117 27 3 253 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X051 1.08e-12 70 23 8 246 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q21TR5 5.19e-29 117 30 3 237 3 Rfer_3129 Putative ribose/galactose/methyl galactoside import ATP-binding protein Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21TR5 8.68e-08 56 25 7 232 3 Rfer_3129 Putative ribose/galactose/methyl galactoside import ATP-binding protein Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q02ME3 5.51e-29 115 31 7 255 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9K876 5.85e-29 115 28 4 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q92EZ6 5.95e-29 115 31 4 222 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q0BGD7 6e-29 117 33 3 232 3 Bamb_1228 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BGD7 1.42e-10 64 28 6 212 3 Bamb_1228 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q4ZZR8 6.46e-29 114 31 6 240 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q1GCR8 6.6e-29 112 32 7 253 3 thiQ Thiamine import ATP-binding protein ThiQ Ruegeria sp. (strain TM1040)
Q8YCG3 6.61e-29 115 31 5 247 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q30W28 6.64e-29 113 29 4 246 3 phnC Phosphonates import ATP-binding protein PhnC Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q92W60 6.66e-29 117 29 6 252 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q92W60 6.55e-09 59 24 6 212 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q9CGD4 6.75e-29 116 26 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q1R0Z6 7.3e-29 113 34 6 244 3 phnC Phosphonates import ATP-binding protein PhnC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q64Z80 7.72e-29 111 29 6 230 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain YCH46)
Q7MKU3 7.72e-29 115 28 5 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 7.72e-29 115 28 5 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q02Z10 7.84e-29 116 26 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
Q2SY12 8.71e-29 114 29 7 260 3 metN Methionine import ATP-binding protein MetN Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q0KDG3 8.8e-29 114 28 7 260 3 metN Methionine import ATP-binding protein MetN Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q724C0 9.01e-29 114 31 4 222 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q3ISC1 9.11e-29 112 33 8 255 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
O34900 9.23e-29 112 27 6 254 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
Q92WJ0 9.3e-29 114 31 6 247 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q8U949 9.58e-29 116 32 4 253 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U949 7.26e-11 65 25 4 214 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q3BNZ3 9.69e-29 114 31 5 244 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q82CM5 1.01e-28 117 28 5 254 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82CM5 2.52e-11 66 29 9 236 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q1BWL4 1.03e-28 114 31 3 228 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 1.03e-28 114 31 3 228 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q8DZJ0 1.05e-28 115 26 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 1.05e-28 115 26 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 1.05e-28 115 26 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q5LI72 1.12e-28 111 29 6 230 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q9RDI1 1.12e-28 116 31 3 228 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9RDI1 6.26e-11 65 29 9 237 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q1M5X4 1.2e-28 116 32 3 232 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M5X4 7.45e-17 82 26 7 245 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q02XM9 1.31e-28 116 29 2 225 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. cremoris (strain SK11)
Q02XM9 1.39e-12 70 26 8 218 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. cremoris (strain SK11)
Q6D4W8 1.34e-28 116 30 3 248 3 araG Arabinose import ATP-binding protein AraG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4W8 2.8e-13 72 27 6 214 3 araG Arabinose import ATP-binding protein AraG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1M360 1.56e-28 116 29 5 249 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M360 2.87e-12 69 22 4 214 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q7VNG4 1.62e-28 114 28 5 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q20Y31 1.67e-28 112 32 6 246 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisB18)
Q5KVK2 1.78e-28 114 29 4 234 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q160Y9 1.84e-28 111 31 7 251 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q87PH3 1.85e-28 114 28 4 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q4L5B3 2.01e-28 114 27 4 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q1M7W6 2.17e-28 112 31 4 245 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
O83658 2.27e-28 114 30 5 250 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
P0A9U2 2.29e-28 116 33 6 240 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U2 1.09e-17 85 30 8 244 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U1 2.29e-28 116 33 6 240 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
P0A9U1 1.09e-17 85 30 8 244 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
Q03P57 2.44e-28 113 31 5 230 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q39GW5 2.52e-28 112 31 4 230 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q21PQ7 2.56e-28 111 27 4 255 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q87UN4 2.57e-28 113 31 6 240 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3SGJ8 2.76e-28 111 30 7 242 3 phnC Phosphonates import ATP-binding protein PhnC Thiobacillus denitrificans (strain ATCC 25259)
Q98K23 2.81e-28 113 28 3 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q7MU65 2.87e-28 110 30 5 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q5LYN4 3.27e-28 114 27 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q5M397 3.31e-28 114 27 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q03JH1 3.48e-28 113 27 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q48PU6 3.62e-28 112 30 5 240 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q72AQ6 3.64e-28 111 30 5 244 3 phnC Phosphonates import ATP-binding protein PhnC Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q46Y69 3.67e-28 112 28 7 260 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q4FMG5 3.71e-28 111 28 4 208 3 tauB Taurine import ATP-binding protein TauB Pelagibacter ubique (strain HTCC1062)
Q5WKL3 3.83e-28 112 28 3 230 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q04DA7 3.85e-28 113 26 5 262 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q9K7C3 3.88e-28 115 28 4 237 3 araG L-arabinose transport ATP-binding protein AraG Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K7C3 8.24e-13 70 26 7 217 3 araG L-arabinose transport ATP-binding protein AraG Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8Z990 3.88e-28 112 28 4 249 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhi
P9WQM1 3.9e-28 113 28 2 238 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 3.9e-28 113 28 2 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 3.9e-28 113 28 2 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8G847 3.93e-28 115 32 5 233 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q8G847 4e-10 63 24 6 211 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q9HNI8 3.95e-28 111 30 4 231 3 phnC Phosphonates import ATP-binding protein PhnC Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q0ST95 4.18e-28 115 28 4 234 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain SM101 / Type A)
Q0ST95 1.07e-13 73 25 7 233 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain SM101 / Type A)
Q1LKJ2 4.26e-28 112 30 5 250 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P30750 4.26e-28 112 29 5 249 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q24XJ2 4.34e-28 112 25 3 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q97JB8 4.48e-28 111 26 3 235 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8EPK1 4.53e-28 112 28 4 233 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8RBQ1 4.54e-28 114 27 5 255 3 TTE0763 Putative ribose/galactose/methyl galactoside import ATP-binding protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RBQ1 2.51e-10 63 26 8 229 3 TTE0763 Putative ribose/galactose/methyl galactoside import ATP-binding protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P48243 4.57e-28 110 27 5 254 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q667L9 4.68e-28 112 30 4 232 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q5PID0 4.68e-28 112 28 4 249 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q1BGC0 4.72e-28 115 30 2 231 3 Bcen_6474 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia orbicola (strain AU 1054)
Q1BGC0 4.59e-11 65 29 7 233 3 Bcen_6474 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia orbicola (strain AU 1054)
A0KE25 4.72e-28 115 30 2 231 3 Bcen2424_6709 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia cenocepacia (strain HI2424)
A0KE25 4.59e-11 65 29 7 233 3 Bcen2424_6709 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia cenocepacia (strain HI2424)
Q92UV5 4.86e-28 113 31 5 241 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q8YA75 4.88e-28 112 30 4 222 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q32JQ8 5.46e-28 112 29 5 249 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q1GMA8 5.51e-28 110 29 6 253 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Ruegeria sp. (strain TM1040)
P72335 5.63e-28 111 33 5 245 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q47T99 5.69e-28 113 32 3 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q88RL5 5.82e-28 112 30 5 240 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P0A2V2 5.89e-28 110 28 7 253 2 occP Octopine permease ATP-binding protein P Rhizobium radiobacter
P0A2V3 5.89e-28 110 28 7 253 3 occP Octopine permease ATP-binding protein P Agrobacterium tumefaciens (strain Ach5)
Q98DA2 5.89e-28 112 31 4 249 3 metN Methionine import ATP-binding protein MetN Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q2JB14 6.23e-28 110 33 5 233 3 phnC Phosphonates import ATP-binding protein PhnC Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q6GJL2 6.5e-28 112 28 4 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
P45769 6.56e-28 110 25 8 261 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q9I1C8 6.72e-28 112 30 7 255 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0I2Z4 6.81e-28 112 25 4 257 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q5HIL5 6.99e-28 112 28 4 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 6.99e-28 112 28 4 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 6.99e-28 112 28 4 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q0TLD2 7e-28 112 29 5 249 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3Z5F8 7.14e-28 112 29 5 249 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 7.14e-28 112 29 5 249 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 7.14e-28 112 29 5 249 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 7.14e-28 112 29 5 249 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
Q0SRL2 7.24e-28 112 26 5 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
D4GSY7 7.27e-28 110 32 5 250 3 HVO_1886 Probable anion import ATP-binding protein HVO_1886 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q325U1 7.45e-28 112 29 5 249 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
Q7A7E3 7.51e-28 112 28 4 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 7.51e-28 112 28 4 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9I6T2 7.55e-28 112 29 4 241 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5F8K2 7.66e-28 109 30 7 240 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q38VW6 7.71e-28 112 26 5 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q7W148 7.96e-28 110 31 7 244 3 phnC Phosphonates import ATP-binding protein PhnC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q28K97 8.34e-28 110 31 6 236 3 tauB Taurine import ATP-binding protein TauB Jannaschia sp. (strain CCS1)
Q1LQF6 8.66e-28 112 28 7 260 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q032A0 8.83e-28 112 29 9 259 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain SK11)
D8KFN1 9.01e-28 112 29 9 259 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain NZ9000)
P0CI33 9.01e-28 112 29 9 259 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain MG1363)
Q7WNT8 9.12e-28 110 31 7 244 3 phnC Phosphonates import ATP-binding protein PhnC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q6D664 9.15e-28 109 30 8 227 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q16BJ3 9.16e-28 110 30 5 230 3 tauB Taurine import ATP-binding protein TauB Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
O69063 9.63e-28 111 31 4 244 3 htxD Hypophosphite import ATP-binding protein HtxD Stutzerimonas stutzeri
Q6G2E2 9.7e-28 112 31 4 232 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q5HQ70 9.71e-28 112 28 5 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1IGZ0 9.87e-28 111 31 4 231 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q87RS1 1.01e-27 111 28 4 232 1 metN Methionine import ATP-binding protein MetN Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9CK97 1.02e-27 111 29 3 232 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q8NY21 1.05e-27 111 28 4 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 1.05e-27 111 28 4 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q8TIX0 1.05e-27 111 29 5 258 3 MA_4020 Putative ABC transporter ATP-binding protein MA_4020 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q65WJ1 1.08e-27 114 28 3 248 3 araG Arabinose import ATP-binding protein AraG Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65WJ1 3.43e-05 48 22 5 208 3 araG Arabinose import ATP-binding protein AraG Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A3CMQ7 1.09e-27 112 26 4 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q58664 1.11e-27 109 28 2 250 3 livF Probable branched-chain amino acid transport ATP-binding protein LivF Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8XKQ2 1.11e-27 114 28 4 234 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain 13 / Type A)
Q8XKQ2 5.79e-14 74 26 7 233 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain 13 / Type A)
Q8UA73 1.25e-27 111 26 3 252 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9CF44 1.26e-27 113 29 2 225 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. lactis (strain IL1403)
Q9CF44 3.36e-12 69 26 8 218 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. lactis (strain IL1403)
Q8ELR4 1.29e-27 112 27 5 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q03ZQ0 1.32e-27 112 26 4 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q0TQU8 1.36e-27 113 28 4 234 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TQU8 4.75e-14 74 26 7 233 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8PYH5 1.36e-27 111 29 6 262 3 MM_0887 Putative ABC transporter ATP-binding protein MM_0887 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P42246 1.38e-27 110 29 4 239 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
Q4UMZ7 1.39e-27 108 27 5 234 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q6D1C4 1.41e-27 111 28 5 249 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q65M34 1.46e-27 111 28 4 231 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q830W6 1.46e-27 111 26 4 257 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q65UE1 1.46e-27 112 28 5 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4KKK8 1.48e-27 111 30 5 240 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q48GY7 1.59e-27 113 30 3 226 3 PSPPH_3184 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48GY7 1.27e-11 67 26 7 231 3 PSPPH_3184 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q7MPC5 1.78e-27 108 30 5 229 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain YJ016)
Q8DE95 1.78e-27 108 30 5 229 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain CMCP6)
Q13VD7 1.82e-27 111 27 6 260 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q9HT70 1.84e-27 110 31 7 252 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 1.84e-27 110 31 7 252 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
A0LUE6 1.95e-27 111 32 3 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q8PGE8 1.97e-27 110 30 5 244 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q8ZRM9 2.03e-27 110 28 4 249 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q98HF7 2.03e-27 111 29 4 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q7VMV4 2.07e-27 108 29 4 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q57T09 2.16e-27 110 28 4 249 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella choleraesuis (strain SC-B67)
Q2RGX2 2.16e-27 113 30 5 239 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2RGX2 2.52e-12 69 23 5 215 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q9CIN4 2.18e-27 111 29 9 259 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. lactis (strain IL1403)
Q7N8M2 2.22e-27 110 30 4 230 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q3MAR5 2.26e-27 111 30 3 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q6LR20 2.45e-27 111 28 4 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q8FRX8 2.54e-27 110 29 4 231 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q3KK97 2.56e-27 110 30 5 240 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain Pf0-1)
Q5YRD1 2.73e-27 110 31 4 214 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q63P06 2.83e-27 112 34 7 236 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia pseudomallei (strain K96243)
Q63P06 2.48e-13 72 27 4 213 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia pseudomallei (strain K96243)
Q3JHZ1 2.83e-27 112 34 7 236 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia pseudomallei (strain 1710b)
Q3JHZ1 2.41e-13 72 27 4 213 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia pseudomallei (strain 1710b)
Q83F44 2.91e-27 110 28 3 234 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q2YVT7 3e-27 110 27 4 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q65TB7 3.03e-27 107 28 4 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1MMZ3 3.23e-27 108 29 5 241 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q160M2 3.28e-27 110 29 4 251 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q2K0S7 3.35e-27 112 31 3 232 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K0S7 6.26e-16 80 26 5 219 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2SMT0 3.37e-27 112 27 3 251 3 HCH_01167 Putative ribose/galactose/methyl galactoside import ATP-binding protein Hahella chejuensis (strain KCTC 2396)
Q2SMT0 6.53e-15 77 30 10 235 3 HCH_01167 Putative ribose/galactose/methyl galactoside import ATP-binding protein Hahella chejuensis (strain KCTC 2396)
Q24QI5 3.48e-27 110 28 4 238 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q87JM4 3.5e-27 113 31 7 243 3 macB Macrolide export ATP-binding/permease protein MacB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P56344 3.65e-27 107 28 5 238 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q6F9P2 3.72e-27 110 29 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P39456 4.2e-27 108 25 5 248 1 tcyC L-cystine import ATP-binding protein TcyC Bacillus subtilis (strain 168)
Q92LX3 4.23e-27 110 31 4 229 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q8XIZ5 4.35e-27 110 26 5 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 4.35e-27 110 26 5 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q1JII9 4.51e-27 110 28 7 258 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8ENB3 4.51e-27 112 28 3 239 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ENB3 7.07e-15 77 26 6 214 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q1BY14 4.56e-27 110 29 8 261 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 4.56e-27 110 29 8 261 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
Q57293 4.56e-27 110 28 3 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
O26236 4.57e-27 108 28 5 234 3 MTH_133 Putative ABC transporter ATP-binding protein MTH_133 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q1CFH7 4.58e-27 110 29 4 232 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 4.58e-27 110 29 4 232 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 4.58e-27 110 29 4 232 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q73EL7 4.62e-27 110 31 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8PC11 4.67e-27 110 28 5 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8RFN2 4.95e-27 109 29 3 234 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P08720 5.13e-27 109 31 4 245 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
Q8YM92 5.23e-27 110 29 3 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8RQL7 5.26e-27 107 26 6 255 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q88WA5 5.29e-27 110 29 5 253 3 metN1 Methionine import ATP-binding protein MetN 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8CPN0 5.79e-27 110 27 5 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7N545 5.79e-27 107 29 6 249 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q81ZF5 5.85e-27 109 31 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q576K0 5.88e-27 108 33 8 250 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 5.88e-27 108 33 8 250 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
O32169 6.11e-27 109 27 3 234 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q83MC5 6.24e-27 109 28 5 249 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 6.24e-27 109 28 5 249 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
Q8PNN4 6.24e-27 109 29 4 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q6D645 6.31e-27 108 30 5 251 3 hmuV Hemin import ATP-binding protein HmuV Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6HP89 6.42e-27 109 31 4 230 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q1J8E4 6.46e-27 109 28 7 258 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q2SJ99 6.47e-27 111 31 4 232 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
Q2SJ99 9.06e-08 55 23 6 220 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
Q9PDN2 6.74e-27 109 27 3 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q8KFD6 7.07e-27 108 29 5 237 3 CT0391 Putative ABC transporter ATP-binding protein CT0391 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q81IN8 7.12e-27 109 31 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P72297 7.15e-27 107 27 5 258 3 occP Octopine permease ATP-binding protein P Rhizobium meliloti
Q5E715 7.17e-27 109 27 5 243 3 metN Methionine import ATP-binding protein MetN Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q4ZRC6 7.26e-27 111 30 3 226 3 Psyr_3264 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. syringae (strain B728a)
Q4ZRC6 4.19e-13 72 28 9 232 3 Psyr_3264 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. syringae (strain B728a)
Q1BX03 7.44e-27 111 29 6 255 3 Bcen_0943 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia orbicola (strain AU 1054)
Q1BX03 3.97e-14 75 27 5 211 3 Bcen_0943 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia orbicola (strain AU 1054)
A0K6Q0 7.44e-27 111 29 6 255 3 Bcen2424_1425 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia cenocepacia (strain HI2424)
A0K6Q0 3.97e-14 75 27 5 211 3 Bcen2424_1425 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia cenocepacia (strain HI2424)
Q0BFQ0 7.65e-27 108 31 3 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q4K681 7.72e-27 109 27 3 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q63GR8 7.89e-27 109 31 4 230 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q0B6I6 8.26e-27 110 29 4 221 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
P0AAG3 8.27e-27 107 27 4 249 3 gltL Glutamate/aspartate import ATP-binding protein GltL Escherichia coli (strain K12)
P0AAG4 8.27e-27 107 27 4 249 3 gltL Glutamate/aspartate import ATP-binding protein GltL Escherichia coli O157:H7
Q5YTW4 8.63e-27 107 29 6 253 3 phnC Phosphonates import ATP-binding protein PhnC Nocardia farcinica (strain IFM 10152)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_07395
Feature type CDS
Gene livG
Product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG
Location 147768 - 148538 (strand: 1)
Length 771 (nucleotides) / 256 (amino acids)
In genomic island -

Contig

Accession ZDB_522
Length 269640 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2631
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00005 ABC transporter
PF12399 Branched-chain amino acid ATP-binding cassette transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0411 Amino acid transport and metabolism (E) E ABC-type branched-chain amino acid transport system, ATPase component LivG

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01995 branched-chain amino acid transport system ATP-binding protein ABC transporters
Quorum sensing
-

Protein Sequence

MTDTLLQVSGLTMRFGGLLAVNNVSLELNRGEIVSLIGPNGAGKTTIFNCLTGFYKPADGQILLRGKPVQGLSGQAIARLGMIRTFQHVRLFREMTVIENLLVAQHQHHKSGLLAGLLTLPSFRRDQREATERAVMWLDRIGLTSLANRQAGNLAYGQQRRLEIARCMVTRPDILMLDEPAAGLNPKETDDLDALIAELRVEHGVSVLLIEHDMKLVMGISDRIYVVNQGTPLASGTPAAIRNHPDVIRAYLGEAY

Flanking regions ( +/- flanking 50bp)

CCGCACCTGAAAGTCAGCACAACGGATGCGGAAAAAACCGGAGGTGCGCAATGACCGATACCTTATTGCAGGTCTCCGGCCTGACCATGCGTTTCGGCGGGTTGCTGGCGGTGAACAATGTGTCGCTGGAACTGAACCGTGGTGAGATAGTCTCTCTGATCGGCCCCAACGGCGCGGGAAAAACCACGATCTTCAACTGTCTGACCGGCTTCTACAAACCGGCGGACGGGCAGATCCTGCTGCGCGGAAAACCGGTACAGGGATTGTCCGGACAGGCAATCGCCCGGCTCGGCATGATCCGCACCTTCCAGCATGTGCGTTTATTCCGGGAAATGACGGTGATTGAAAACCTGCTGGTGGCGCAGCATCAGCATCATAAAAGCGGATTACTCGCCGGGCTGCTGACGCTGCCCTCGTTCCGCCGTGATCAGCGTGAAGCCACGGAACGCGCGGTGATGTGGCTGGACAGAATCGGGCTGACGTCACTGGCAAACCGGCAGGCAGGTAACCTGGCGTATGGTCAGCAGCGGCGGCTGGAAATCGCCCGCTGTATGGTGACCCGGCCGGATATTCTGATGCTGGATGAACCGGCGGCCGGGCTGAACCCGAAAGAAACGGACGATCTGGATGCACTGATCGCGGAACTGCGGGTGGAGCACGGCGTGTCTGTCCTGCTGATCGAACATGATATGAAACTGGTGATGGGGATTTCAGACCGGATCTATGTGGTGAACCAGGGAACGCCGCTGGCAAGCGGCACCCCGGCGGCGATCCGCAACCACCCGGACGTGATCCGCGCGTATTTGGGGGAGGCATACTGATGCTGGAATTTAATAATGTCTCCGCGCAGTACGGCAAAATTCAGGCGCTG