Homologs in group_1467

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09415 FBDBKF_09415 91.6 Morganella morganii S1 potA spermidine/putrescine ABC transporter ATP-binding protein PotA
EHELCC_09995 EHELCC_09995 91.6 Morganella morganii S2 potA spermidine/putrescine ABC transporter ATP-binding protein PotA
NLDBIP_10340 NLDBIP_10340 91.6 Morganella morganii S4 potA spermidine/putrescine ABC transporter ATP-binding protein PotA
LHKJJB_11015 LHKJJB_11015 91.6 Morganella morganii S3 potA spermidine/putrescine ABC transporter ATP-binding protein PotA
HKOGLL_14075 HKOGLL_14075 91.6 Morganella morganii S5 potA spermidine/putrescine ABC transporter ATP-binding protein PotA
PMI_RS13490 PMI_RS13490 83.3 Proteus mirabilis HI4320 potA spermidine/putrescine ABC transporter ATP-binding protein PotA

Distribution of the homologs in the orthogroup group_1467

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1467

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q5PMK1 0.0 603 78 0 364 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P40790 0.0 603 78 0 364 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 0.0 603 78 0 364 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q3Z2Z3 0.0 602 78 0 365 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q32EY4 0.0 602 78 0 365 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q31ZK0 0.0 602 78 0 365 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
P69877 0.0 601 78 0 365 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 0.0 601 78 0 365 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 0.0 601 78 0 365 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 0.0 601 78 0 365 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 0.0 601 78 0 365 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q1RD28 0.0 600 78 0 365 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 0.0 600 78 0 365 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q8Z7H7 0.0 599 78 0 364 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q0T5R2 0.0 592 76 0 365 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q6D4E2 0.0 587 76 0 371 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6LR20 0.0 563 72 0 370 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q5E586 0.0 560 71 1 370 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q65UE1 0.0 555 71 1 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CP06 0.0 550 70 1 370 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q7MKU3 0.0 539 72 1 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 0.0 539 72 1 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q9KS33 0.0 536 71 1 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87PH3 0.0 535 71 1 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0I3Y9 0.0 528 68 1 369 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
P45171 0.0 519 67 1 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QK57 0.0 517 66 1 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
O85818 0.0 515 65 1 371 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q7VNG4 6.69e-177 499 65 2 361 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1TXH7 2.44e-152 437 60 2 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q2SJY7 3.79e-152 436 60 0 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q72FW5 3.83e-146 421 57 1 359 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q30V33 8.07e-140 405 55 1 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q1QE80 2.28e-138 402 54 3 380 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1MQ44 1.96e-134 391 54 1 360 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q5WXF0 2.67e-134 390 52 2 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q5ZWE4 5.49e-134 390 52 2 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q60AI1 9.19e-133 387 52 1 368 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5X627 1.8e-132 386 52 2 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q18AM3 1.43e-104 314 49 5 322 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q4L5B3 1.73e-104 315 52 2 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q74K65 3.51e-104 314 55 3 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q042G7 4.87e-103 311 54 3 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q1GB17 2.07e-101 306 52 4 297 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q47T99 2.17e-101 307 45 5 364 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
A0PY57 1.29e-100 304 51 2 285 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q97KS6 1.48e-100 304 49 3 319 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q49WM4 2.4e-100 304 50 2 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8A883 2.4e-100 307 52 3 309 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q04BG2 4.14e-100 303 51 4 297 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q0SRL2 4.54e-100 303 48 4 319 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q64SQ6 5.74e-100 306 49 4 328 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q14Q07 2.27e-99 301 45 5 360 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q8XIZ5 2.97e-99 301 48 3 319 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 2.97e-99 301 48 3 319 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q03PF2 6.2e-99 301 52 2 289 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q5LBT4 6.98e-99 303 48 4 328 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q24XJ2 9.2e-99 300 52 2 285 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q8ELR4 9.46e-99 300 46 6 361 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A0LUE6 1.16e-98 300 45 4 355 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q6F0V4 1.65e-98 299 44 5 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q6HLQ9 2.38e-98 298 58 0 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63E84 2.49e-98 298 58 0 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 2.49e-98 298 58 0 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 2.49e-98 298 58 0 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q81TH8 4.77e-98 297 58 0 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
A3DDF6 4.94e-98 298 52 4 291 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q81GC1 1.53e-97 296 58 0 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5L222 1.56e-97 296 51 2 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q3MAR5 1.69e-97 297 57 1 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YM92 1.69e-97 297 57 1 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q03AH0 2.03e-97 296 52 2 285 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q88ZJ6 2.93e-97 296 52 1 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q5FL41 3.03e-97 296 52 3 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q1B8V9 5.35e-97 296 47 1 310 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 5.35e-97 296 47 1 310 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
A1TAI4 5.95e-97 296 43 2 357 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q02R79 1.37e-96 295 47 3 326 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HY19 1.46e-96 294 47 3 326 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5HQ70 3.06e-96 293 50 2 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1AS06 3.25e-96 294 51 1 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q110U3 9.24e-96 293 42 4 375 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q8CPN0 2.59e-95 291 49 2 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q38VW6 2.98e-95 291 50 2 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q8RI39 3.27e-95 291 43 4 356 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A0AGP9 7e-95 290 51 3 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q7CN92 7.7e-95 291 52 4 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 7.7e-95 291 52 4 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q8Y8T6 1.15e-94 290 51 3 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92DL6 1.61e-94 289 51 3 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q03ZQ0 1.77e-94 289 48 3 309 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q1GIE5 1.99e-94 289 48 5 341 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q722B1 2.12e-94 289 51 3 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q1J6Q6 2.38e-94 290 52 4 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 2.38e-94 290 52 4 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 2.38e-94 290 52 4 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 2.38e-94 290 52 4 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q5XCA4 3.25e-94 289 52 4 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ35 3.58e-94 289 52 4 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 3.58e-94 289 52 4 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 3.58e-94 289 52 4 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q160M2 5.95e-94 288 49 3 311 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q830W6 1.07e-93 287 50 2 285 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q9X196 1.57e-93 287 48 0 284 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q6MCV4 2.83e-93 286 47 2 310 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q7A169 4.05e-93 286 50 2 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 4.05e-93 286 50 2 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 4.05e-93 286 50 2 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 4.05e-93 286 50 2 288 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 4.05e-93 286 50 2 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 4.05e-93 286 50 2 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 4.05e-93 286 50 2 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 4.05e-93 286 50 2 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 4.05e-93 286 50 2 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q0SML1 4.17e-93 285 49 3 287 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q8DUF7 4.19e-93 286 52 3 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
O51587 4.8e-93 285 49 3 287 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q5LT05 5.07e-93 285 44 6 370 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q8DZJ0 8.47e-93 285 50 3 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 8.47e-93 285 50 3 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 8.47e-93 285 50 3 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q03JH1 2.58e-92 284 50 4 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M397 3.58e-92 284 50 4 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYN4 3.73e-92 284 50 4 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q660M8 7.96e-92 282 49 3 287 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q98HF7 1.8e-91 281 48 3 312 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8DPC2 1.83e-91 282 52 4 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 1.83e-91 282 52 4 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 1.83e-91 282 52 4 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q04G50 2.15e-91 281 49 3 294 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q3KBH4 3.38e-91 281 47 4 330 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
A3CMQ7 5.7e-91 281 51 3 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q0AGF4 2.27e-90 278 42 5 374 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q578K3 2.3e-90 278 44 5 340 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 2.3e-90 278 44 5 340 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q9I6T2 9.17e-90 277 46 4 343 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O83658 9.41e-90 278 46 4 335 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q2SSS4 2.15e-89 276 50 1 260 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q6MU19 2.79e-89 275 49 1 260 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q1WVI7 4.71e-89 275 48 3 285 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q4K681 7.22e-89 275 47 4 324 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9KLQ5 9.27e-89 274 50 4 284 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8FVV5 1.91e-88 273 44 7 347 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q8YCG3 2.22e-88 273 44 5 340 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q0RAT5 6.96e-88 275 41 5 376 3 potA Spermidine/putrescine import ATP-binding protein PotA Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
P31134 7.16e-88 273 46 2 293 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q2YAD6 2.34e-87 271 40 5 369 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q7NQN5 4.13e-87 270 43 2 343 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2K8C8 4.97e-87 270 42 4 340 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6LKD4 5.93e-87 270 51 1 251 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q82TL6 6.71e-87 270 44 5 348 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q92WJ0 2.44e-86 268 40 6 359 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q8U6M1 1.73e-85 266 42 3 330 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9CGD4 3.55e-85 267 47 4 289 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q02Z10 4.34e-85 267 47 4 289 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
P37009 2.5e-84 263 51 0 240 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q7AH43 6.2e-84 261 51 0 241 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q7N8B9 7.57e-84 261 52 0 240 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P44531 8.85e-84 260 42 3 327 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P77795 2.42e-83 259 39 6 368 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q9CM80 2.78e-83 260 46 3 294 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q6D734 1.53e-82 258 51 0 240 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8YCB1 1.74e-81 255 51 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q92UV5 1.76e-81 257 56 0 226 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q609Q1 2.06e-81 255 41 5 340 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
P55604 2.3e-81 256 45 2 288 3 NGR_a02170 Uncharacterized ABC transporter ATP-binding protein y4oS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q65S66 4.32e-81 254 45 2 288 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7W9U5 5.5e-81 254 45 2 290 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WGW1 7.6e-81 254 45 2 290 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q0I2Z4 8.29e-81 253 51 0 238 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q7VZE5 8.56e-81 254 45 2 290 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8FW07 8.62e-81 254 51 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella suis biovar 1 (strain 1330)
Q578E9 8.62e-81 254 51 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus biovar 1 (strain 9-941)
Q2YKR8 1e-80 253 51 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus (strain 2308)
Q8RGC8 1.59e-80 254 40 2 308 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8FVT0 5.78e-80 251 50 0 232 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q2YKZ7 6.58e-80 251 50 0 232 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 6.58e-80 251 50 0 232 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q9Z3R9 1.21e-79 251 45 5 293 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
P54933 1.95e-79 249 52 0 232 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
Q9KL04 2.75e-79 250 43 4 305 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9G4F5 2.8e-79 249 46 4 283 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q8DIA0 3.58e-79 249 41 3 323 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9L0Q1 6.63e-79 249 49 0 221 1 msiK Diacetylchitobiose uptake system ATP-binding protein MsiK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9YGA6 9.44e-79 249 45 4 292 1 malK Trehalose/maltose import ATP-binding protein MalK Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q7CS28 3.15e-78 247 47 0 232 1 smoE Sulfoquinovosyl glycerol transport ATP-binding protein SmoE Agrobacterium fabrum (strain C58 / ATCC 33970)
P74548 3.46e-78 247 42 3 318 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8UB29 3.71e-78 247 42 5 301 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q81GU1 7.01e-78 246 51 2 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q82WT5 8.77e-78 246 50 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7NWX3 1.16e-77 246 45 5 294 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8FHR3 1.24e-77 246 41 3 300 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q6LK87 1.64e-77 246 41 4 309 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
Q8X8K4 1.72e-77 245 41 3 300 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O157:H7
A1B9Q7 1.85e-77 245 44 3 293 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
Q8XZX8 2.08e-77 245 48 0 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
O31339 2.53e-77 245 50 2 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6F9A8 2.56e-77 245 42 6 331 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q65T42 3.06e-77 244 41 4 320 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0TI47 3.08e-77 245 41 3 300 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q92WD6 3.57e-77 244 50 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhizobium meliloti (strain 1021)
P55453 3.58e-77 244 43 2 301 3 NGR_a03670 Uncharacterized ABC transporter ATP-binding protein y4fO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P77481 5.4e-77 244 40 3 300 5 ycjV Putative uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain K12)
Q1RC47 5.88e-77 244 41 3 300 4 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain UTI89 / UPEC)
Q88AS5 6.59e-77 243 50 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1SWH9 8.52e-77 244 42 4 289 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q7MFC4 8.85e-77 244 50 0 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 8.85e-77 244 50 0 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q9JZW0 1.1e-76 243 48 1 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JUX4 1.32e-76 243 48 1 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q87GB5 1.72e-76 243 46 1 252 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8Z0H0 1.79e-76 242 43 3 286 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A3PRY1 1.88e-76 242 50 0 232 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q79EE4 2.47e-76 243 43 2 284 1 ggtA Osmoprotective compounds uptake ATP-binding protein GgtA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P94360 2.98e-76 242 48 2 235 1 msmX Oligosaccharides import ATP-binding protein MsmX Bacillus subtilis (strain 168)
Q57SD6 4.58e-76 242 49 1 243 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
P96063 4.84e-76 242 49 1 243 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A1URR2 5.13e-76 241 44 3 280 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q7NX01 5.17e-76 241 41 7 351 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2K6L3 5.27e-76 241 47 0 233 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8Z8W8 5.56e-76 242 49 1 243 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q5PFQ7 5.62e-76 242 49 1 243 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q88CL2 6.19e-76 240 47 3 268 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q7NIW1 8.08e-76 241 41 4 324 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q5DZC6 9.64e-76 241 48 0 233 3 malK Maltose/maltodextrin import ATP-binding protein MalK Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q0K998 1.1e-75 241 47 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9I6L0 1.26e-75 239 48 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3IX40 2.27e-75 239 49 0 232 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q8UA73 2.58e-75 239 41 3 296 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5LX21 2.6e-75 239 48 0 232 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q9K876 3e-75 239 44 2 275 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8F6Z1 3.01e-75 239 48 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 3.01e-75 239 48 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q164Y5 4.51e-75 239 47 2 240 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q46ZM0 4.55e-75 239 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q93DX8 5.45e-75 236 47 1 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q6G5J0 5.51e-75 239 49 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q1GID1 5.83e-75 239 46 1 243 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria sp. (strain TM1040)
Q66FU4 7.11e-75 239 48 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q2K4V4 8.22e-75 239 46 0 232 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8PC11 1.16e-74 238 43 4 287 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q2L0H5 1.18e-74 238 47 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella avium (strain 197N)
Q28QL7 1.22e-74 238 49 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Jannaschia sp. (strain CCS1)
Q1MCN6 1.52e-74 238 46 0 232 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8E8K8 1.58e-74 238 48 1 247 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q01937 2.09e-74 238 42 2 285 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q8PNN4 2.56e-74 237 44 4 294 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
O32151 2.62e-74 238 45 0 232 3 yurJ Uncharacterized ABC transporter ATP-binding protein YurJ Bacillus subtilis (strain 168)
Q9KRT4 3.19e-74 238 44 2 245 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P9WQI3 4.3e-74 238 47 2 242 1 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI2 4.3e-74 238 47 2 242 3 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q1CNC6 4.49e-74 236 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q74R28 4.49e-74 236 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis
Q1CBH2 4.49e-74 236 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Antiqua)
P14788 4.76e-74 236 48 0 237 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q7N6Z2 4.87e-74 236 43 4 291 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9PDN2 5.97e-74 236 41 3 291 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q8D653 6.35e-74 236 49 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q6D201 8.28e-74 235 47 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8UBB7 8.47e-74 236 39 4 305 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q57293 8.7e-74 236 50 2 238 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q63TY1 8.72e-74 236 47 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q8UII7 9.67e-74 236 46 1 232 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9KUI0 9.85e-74 236 49 1 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1M8R6 1.06e-73 235 46 0 233 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q62K82 1.11e-73 235 47 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q8EBC3 1.14e-73 236 49 1 244 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q98G42 1.57e-73 235 46 0 232 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6NBT1 3.07e-73 234 47 2 255 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A1JIE0 3.72e-73 234 45 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q87DT9 4.24e-73 234 41 3 291 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q664X5 4.36e-73 234 42 3 293 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 4.36e-73 234 42 3 293 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 4.36e-73 234 42 3 293 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 4.36e-73 234 42 3 293 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
Q7MLB8 4.86e-73 234 45 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain YJ016)
Q8D954 5.35e-73 234 45 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain CMCP6)
Q6G194 6.32e-73 233 48 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella quintana (strain Toulouse)
Q89WG0 6.82e-73 234 48 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8UH62 6.93e-73 233 50 1 237 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
P10907 8.79e-73 233 48 1 233 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain K12)
Q3YW77 8.89e-73 233 48 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella sonnei (strain Ss046)
Q31VH5 1.01e-72 233 48 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella boydii serotype 4 (strain Sb227)
Q8X6U5 1.27e-72 233 48 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O157:H7
Q0BIZ6 1.33e-72 233 48 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0TC10 1.44e-72 233 46 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R5H8 1.59e-72 233 46 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain UTI89 / UPEC)
A1AGY1 1.59e-72 233 46 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O1:K1 / APEC
Q8FCQ2 1.61e-72 233 46 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q89UD2 1.63e-72 232 46 2 255 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6CZ34 2.26e-72 232 46 3 254 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1LLP5 2.46e-72 232 46 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1BRZ8 2.54e-72 232 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia orbicola (strain AU 1054)
A0K3S5 2.54e-72 232 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia cenocepacia (strain HI2424)
Q39KB9 4.58e-72 231 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9TKX3 5.07e-72 231 44 1 247 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q2J2E9 5.22e-72 231 46 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain HaA2)
D4GP39 8.66e-72 231 50 2 225 1 xacK Xylose/arabinose import ATP-binding protein XacK Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q5YZY9 9.69e-72 229 46 0 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q2K1C8 1.3e-71 230 43 1 253 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8XZP8 1.9e-71 230 45 2 255 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q57IS3 1.99e-71 229 48 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella choleraesuis (strain SC-B67)
Q5PJL1 3e-71 229 47 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZLF4 3.27e-71 229 47 1 233 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q21CA3 4.04e-71 229 46 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisB18)
Q0S0Z3 4.82e-71 228 40 10 343 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q7VYN2 6.1e-71 229 43 2 254 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WID6 6.23e-71 229 43 2 254 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q668K6 6.48e-71 229 46 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q07UI9 7.51e-71 228 45 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisA53)
Q0SBZ1 7.57e-71 228 41 11 343 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q7N986 8.29e-71 228 41 3 300 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q13ER6 1.26e-70 228 39 6 316 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisB5)
Q7W6G5 1.41e-70 228 43 2 254 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q2SU77 1.69e-70 228 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P9WQM1 3.15e-70 226 45 1 235 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 3.15e-70 226 45 1 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 3.15e-70 226 45 1 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8Z245 3.68e-70 226 47 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhi
Q8D0W8 4.03e-70 226 46 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q13TV1 7.71e-70 226 41 3 275 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paraburkholderia xenovorans (strain LB400)
Q7NRX5 1.09e-69 226 45 2 243 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P56344 1.12e-69 221 46 0 232 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q6NDQ0 1.17e-69 225 45 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1QTX6 1.21e-69 226 46 1 232 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q62GB4 1.6e-69 225 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia mallei (strain ATCC 23344)
Q63Q62 1.82e-69 225 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain K96243)
Q3JMW7 1.98e-69 224 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain 1710b)
Q0RYP7 2.84e-69 224 40 10 343 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
D4GP38 3.65e-69 225 47 1 234 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q65QT6 4.04e-69 224 46 0 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q92VJ2 8.94e-69 223 44 3 278 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
P16676 1.42e-68 223 46 1 239 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q8FFB3 1.42e-68 223 46 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1M589 1.42e-68 222 43 1 244 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8XBJ8 1.51e-68 223 46 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
P40860 2.97e-68 222 47 1 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z4V6 3.08e-68 222 47 1 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
P44513 3.65e-68 221 36 5 338 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q73XU8 4.1e-68 221 43 0 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q7UC29 4.61e-68 221 46 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q7UBD0 5.06e-68 221 39 3 302 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri
Q4QP85 5.37e-68 221 36 5 338 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
P63354 5.37e-68 221 48 1 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 5.37e-68 221 48 1 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FB37 5.51e-68 221 43 1 250 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3YUV0 6.07e-68 221 45 0 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella sonnei (strain Ss046)
Q1R3Q1 6.07e-68 221 45 0 232 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain UTI89 / UPEC)
P68187 6.07e-68 221 45 0 232 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain K12)
P68188 6.07e-68 221 45 0 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O157:H7
Q8Z1U0 7.35e-68 221 45 0 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhi
P19566 8.45e-68 221 45 0 232 1 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57GZ7 8.45e-68 221 45 0 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella choleraesuis (strain SC-B67)
Q0SXQ1 8.74e-68 221 39 3 302 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri serotype 5b (strain 8401)
Q9A7X1 9.48e-68 219 46 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q5PKZ8 1.44e-67 220 45 0 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q00752 1.82e-67 220 44 2 234 3 msmK Multiple sugar-binding transport ATP-binding protein MsmK Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q82JY6 2.29e-67 219 39 2 307 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q92XW1 3.01e-67 219 48 1 241 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q9MUN1 3.3e-67 219 42 0 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q0TA26 3.64e-67 219 44 0 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
O86751 3.92e-67 218 37 3 327 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8U4K3 1.5e-64 211 36 5 346 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q5FA19 2.86e-64 211 41 5 290 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P18813 1.49e-63 207 44 1 233 3 malK Maltose/maltodextrin import ATP-binding protein MalK (Fragment) Klebsiella aerogenes
Q4W575 2.05e-63 209 44 1 238 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 2.05e-63 209 44 1 238 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q98K23 4.71e-63 208 46 1 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P10091 8.08e-63 208 42 0 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q3KCC5 1.73e-62 206 37 9 330 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q6D2F6 7.53e-61 202 34 6 330 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O57896 1.98e-60 201 44 1 219 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q98G43 7.3e-60 200 36 9 344 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5JEB0 1.94e-59 198 39 2 267 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q4KC87 2.83e-59 198 39 9 318 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q50966 8.5e-59 197 39 5 290 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q85A69 5.06e-58 196 41 0 229 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q97UY8 1.49e-57 194 35 6 335 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
O34992 3.08e-57 194 42 4 238 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
Q45460 4.58e-57 193 41 4 238 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q9V2C0 9.2e-57 191 37 2 270 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q9KIF7 2.07e-56 192 44 2 224 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
P46920 2.96e-56 192 42 1 227 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
P21410 2.63e-55 187 39 4 275 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
Q9KHT9 4.18e-54 186 42 3 225 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 4.18e-54 186 42 3 225 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q8U648 7.4e-52 176 42 3 219 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0K9I2 1.33e-51 177 40 3 250 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
E0SCY1 1.41e-51 179 40 1 227 1 ousV Glycine betaine/choline transport system ATP-binding protein OusV Dickeya dadantii (strain 3937)
A0A0H2ZLL3 1.05e-50 172 39 2 237 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q56927 1.35e-50 176 39 3 241 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia enterocolitica
P14175 3.24e-50 176 39 4 259 1 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Escherichia coli (strain K12)
P17328 3.75e-50 176 40 2 238 2 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q668Q3 2.21e-49 172 38 3 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CJS9 2.25e-49 172 38 3 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 2.25e-49 172 38 3 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 2.25e-49 172 38 3 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q9RR46 4.53e-49 173 38 1 226 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q5LT65 6.76e-49 171 41 4 241 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q2NK31 1.01e-48 172 41 8 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Aster yellows witches'-broom phytoplasma (strain AYWB)
Q2NK31 1.06e-29 121 51 0 104 3 potA Spermidine/putrescine import ATP-binding protein PotA Aster yellows witches'-broom phytoplasma (strain AYWB)
Q6YPR6 1.02e-48 172 44 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Onion yellows phytoplasma (strain OY-M)
Q6YPR6 1.03e-29 121 51 0 104 3 potA Spermidine/putrescine import ATP-binding protein PotA Onion yellows phytoplasma (strain OY-M)
Q3BNZ3 1.33e-48 170 39 2 245 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PGE8 1.6e-48 170 39 2 245 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q46ZU5 3.36e-48 168 44 2 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q2P7S3 6.73e-48 168 39 2 245 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q57855 8.66e-48 166 42 4 206 3 MJ0412 Uncharacterized ABC transporter ATP-binding protein MJ0412 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q89ER4 8.71e-48 166 41 3 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5H503 8.96e-48 167 39 2 245 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q1CDR0 9.07e-48 166 42 4 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 9.07e-48 166 42 4 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 9.07e-48 166 42 4 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q665B6 2.41e-47 165 41 4 218 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q4FL37 3.22e-47 166 40 1 225 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q58762 5.08e-47 164 39 2 206 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P33360 5.31e-47 165 37 2 236 1 yehX Glycine betaine uptake system ATP-binding protein YehX Escherichia coli (strain K12)
Q88R93 5.33e-47 164 42 3 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P54537 5.79e-47 162 37 3 240 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
P55662 1.05e-46 162 34 3 250 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q6CYU2 1.14e-46 163 41 3 220 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8ZPK4 1.61e-46 166 37 3 243 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q0I5E9 2.14e-46 164 36 3 241 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q4A5Q4 2.36e-46 167 36 6 273 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmopsis synoviae (strain 53)
Q4A5Q4 9.23e-25 108 41 0 116 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmopsis synoviae (strain 53)
Q4FMG5 2.95e-46 162 42 4 220 3 tauB Taurine import ATP-binding protein TauB Pelagibacter ubique (strain HTCC1062)
A1VZQ5 4.17e-46 160 36 2 239 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q0P9X7 4.84e-46 160 36 2 239 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P10346 5.25e-46 160 37 3 241 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q8P4S7 7.42e-46 162 38 2 245 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQD2 7.42e-46 162 38 2 245 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain 8004)
Q21XJ9 9.22e-46 160 42 4 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q81ZF5 9.89e-46 162 35 3 241 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q7NB11 9.97e-46 166 42 6 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q7NB11 4.79e-26 112 47 1 107 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q6HP89 1.4e-45 162 35 3 241 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8EUR3 1.55e-45 167 42 5 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Malacoplasma penetrans (strain HF-2)
Q8EUR3 5.49e-23 103 45 1 105 3 potA Spermidine/putrescine import ATP-binding protein PotA Malacoplasma penetrans (strain HF-2)
Q81IN8 2.18e-45 162 35 3 241 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q63GR8 2.27e-45 161 35 3 241 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q0SFW6 2.43e-45 161 38 4 247 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
O30144 2.45e-45 158 38 4 226 1 wtpC Molybdate/tungstate import ATP-binding protein WtpC Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q1LNM0 2.54e-45 160 41 3 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q7VM95 2.91e-45 161 36 3 241 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q0I354 3.33e-45 157 41 0 207 3 thiQ Thiamine import ATP-binding protein ThiQ Histophilus somni (strain 129Pt)
Q8KZQ6 3.46e-45 159 41 3 216 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q8FYU9 4.16e-45 158 40 0 220 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8YJ04 4.16e-45 158 40 0 220 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9CK97 6.34e-45 160 35 3 241 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q73EL7 6.8e-45 160 35 3 241 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q57BC2 7.01e-45 157 40 0 220 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus biovar 1 (strain 9-941)
Q2YLW6 7.01e-45 157 40 0 220 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus (strain 2308)
Q02QT1 7.2e-45 158 37 6 246 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
P37774 9.21e-45 157 38 3 242 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q97KD5 9.94e-45 159 35 1 228 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q28K97 1.39e-44 157 39 5 241 3 tauB Taurine import ATP-binding protein TauB Jannaschia sp. (strain CCS1)
Q6KIP2 1.49e-44 162 42 5 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
Q6KIP2 6.68e-27 114 41 1 128 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
Q16BJ3 1.56e-44 157 43 2 199 3 tauB Taurine import ATP-binding protein TauB Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q9HYG4 2.15e-44 157 37 6 246 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8PHQ3 3.4e-44 157 41 4 223 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
P47288 3.68e-44 163 40 7 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47288 1.67e-26 114 43 3 144 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q92EZ6 4.42e-44 158 35 3 242 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q07LQ4 4.63e-44 156 41 4 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain BisA53)
Q3M5J9 4.67e-44 155 42 3 207 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q65VG9 5.44e-44 158 36 3 241 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1WVG9 8.25e-44 158 38 5 250 3 metN Methionine import ATP-binding protein MetN Ligilactobacillus salivarius (strain UCC118)
Q5WKG4 8.66e-44 155 39 2 209 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q87UI3 9.25e-44 155 40 2 212 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8YA75 1.01e-43 157 35 3 242 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q81IZ6 1.02e-43 157 35 3 251 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5ZUG5 1.09e-43 157 38 2 231 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P45769 1.34e-43 154 35 3 240 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q4JTG9 1.34e-43 157 38 1 222 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q6AE21 1.41e-43 157 34 2 242 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
P27675 1.44e-43 154 36 4 240 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q5WVL8 1.57e-43 157 38 2 231 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q1RDS4 1.58e-43 154 41 3 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 1.58e-43 154 41 3 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q724C0 1.95e-43 156 35 3 242 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q8DRR9 2.25e-43 154 36 4 233 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q3K506 2.32e-43 154 39 2 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q4ZLS1 2.4e-43 154 39 2 212 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q8XZQ4 2.45e-43 154 42 3 206 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q6LV32 2.46e-43 153 36 2 219 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
Q5X484 2.5e-43 156 38 2 231 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
Q48CA0 2.67e-43 154 39 2 212 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1IGL4 3.06e-43 154 41 3 208 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q0TJC1 3.73e-43 153 41 4 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FJ95 4.52e-43 153 41 3 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5HIL5 4.94e-43 155 34 2 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 4.94e-43 155 34 2 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 4.94e-43 155 34 2 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q4K441 5.65e-43 153 38 2 212 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q2YVT7 5.67e-43 155 33 2 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6D3Q6 5.87e-43 155 38 4 242 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q4A7I1 6.95e-43 157 40 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesomycoplasma hyopneumoniae (strain 7448)
Q4A7I1 2.04e-23 104 45 0 102 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesomycoplasma hyopneumoniae (strain 7448)
Q4A9E1 7.47e-43 157 40 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q4A9E1 2.14e-23 104 45 0 102 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q8DMX9 7.97e-43 153 38 5 229 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97N50 7.97e-43 153 38 5 229 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04HV7 7.97e-43 153 38 5 229 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q13RD3 9.52e-43 152 43 6 223 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Paraburkholderia xenovorans (strain LB400)
Q5NFU5 1.06e-42 155 35 2 241 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q0BMC9 1.13e-42 155 35 2 241 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 1.13e-42 155 35 2 241 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q9PR37 1.17e-42 158 39 7 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q9PR37 1.63e-26 114 47 1 109 3 potA Spermidine/putrescine import ATP-binding protein PotA Ureaplasma parvum serovar 3 (strain ATCC 700970)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS10550
Feature type CDS
Gene potA
Product spermidine/putrescine ABC transporter ATP-binding protein PotA
Location 241629 - 242744 (strand: 1)
Length 1116 (nucleotides) / 371 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1467
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF08402 TOBE domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3842 Amino acid transport and metabolism (E) E ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11072 spermidine/putrescine transport system ATP-binding protein [EC:7.6.2.11] ABC transporters -

Protein Sequence

MTATTSLTPLVTLKGLSKGFDGKNIINNFDLTINHGEFVTILGPSGCGKTTVLRLIAGLEEVDGGTIMLGTQDITHIPAEQRHINTVFQSYALFPHMTVFENVAFGLRMQKTPEHEITLRVEDALKMVQLQDFANRRPDQLSGGQQQRVAIARAVVNKPEVLLLDESLSALDYNLRKQMQSELKALQRQLGITFVFVTHDQEEALTMSDRIIVMREGKIEQDGTPREIYEEPKNLFVAQFIGEINIFGADVLHRIDDQRIRASVEGHECDIYTTLMVTPGQHVHVLLRPEDLRVEEIHDNAPVAGLIGYVRERNYKGMTLDSEIEMENGKRVMVSEFFNEDDPDVDHSLDQKIAVTWVESWEVVLSDEKDA

Flanking regions ( +/- flanking 50bp)

TTTTTTCAGTTACGGTTCTATCTGCATGACCTCCGGGATAGAGTATACAAATGACTGCAACAACTTCTCTGACACCACTTGTCACCCTGAAAGGCCTGAGCAAAGGCTTTGACGGCAAAAATATCATTAATAATTTCGATCTCACTATCAACCACGGTGAGTTTGTCACCATTCTTGGCCCGTCCGGGTGCGGTAAAACAACAGTTTTACGTTTGATTGCCGGACTTGAAGAGGTGGACGGCGGCACCATTATGCTTGGCACACAGGATATTACGCATATTCCTGCTGAACAGCGCCATATCAATACCGTATTCCAGAGCTACGCTCTTTTCCCGCACATGACGGTATTTGAAAACGTCGCATTCGGGCTGCGCATGCAGAAAACTCCCGAACATGAAATTACCCTGCGCGTGGAAGATGCACTGAAAATGGTGCAGTTGCAGGATTTTGCCAACCGCAGACCGGATCAGCTTTCCGGCGGGCAGCAACAGCGTGTTGCCATCGCCCGCGCCGTGGTGAACAAGCCGGAAGTTCTGCTGCTGGATGAGTCTCTTTCCGCACTCGATTATAATCTGCGCAAGCAGATGCAGAGTGAACTGAAAGCATTGCAGCGCCAACTGGGGATCACCTTTGTTTTTGTCACTCATGATCAGGAAGAAGCGCTGACCATGTCTGACCGCATTATTGTTATGCGGGAAGGAAAAATTGAGCAGGACGGCACGCCGCGTGAAATTTACGAAGAGCCGAAAAACTTGTTTGTGGCGCAATTTATTGGTGAGATAAATATATTCGGTGCCGATGTTCTGCACCGGATAGATGACCAGCGGATCCGCGCCAGTGTTGAAGGTCATGAGTGTGATATTTATACCACGCTCATGGTGACGCCGGGACAACATGTGCATGTGCTGCTGCGCCCGGAAGATCTGCGCGTTGAAGAGATCCATGATAATGCGCCGGTTGCCGGATTGATAGGCTATGTCCGCGAGCGCAACTATAAAGGCATGACGCTGGATTCTGAAATTGAAATGGAAAACGGCAAACGGGTGATGGTCAGCGAATTCTTTAATGAAGACGATCCGGATGTGGATCACTCGCTGGATCAGAAAATTGCAGTGACGTGGGTTGAAAGCTGGGAGGTGGTGCTGAGCGATGAAAAAGACGCGTAAACCTTTCCAGACTATTGTGATCACTCTGATTGTCGCGTGGTTACTGTTAT