Homologs in group_1372

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08490 FBDBKF_08490 93.0 Morganella morganii S1 rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
EHELCC_13035 EHELCC_13035 93.0 Morganella morganii S2 rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
NLDBIP_13375 NLDBIP_13375 93.0 Morganella morganii S4 rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
LHKJJB_13180 LHKJJB_13180 93.0 Morganella morganii S3 rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
HKOGLL_11850 HKOGLL_11850 93.0 Morganella morganii S5 rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
PMI_RS16785 PMI_RS16785 84.2 Proteus mirabilis HI4320 rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB

Distribution of the homologs in the orthogroup group_1372

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1372

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MYU6 7.15e-151 422 83 0 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8ZIV4 9.87e-145 407 80 0 243 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Yersinia pestis
P63180 8.95e-144 404 78 0 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Shigella flexneri
P63177 8.95e-144 404 78 0 242 1 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Escherichia coli (strain K12)
P63178 8.95e-144 404 78 0 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63179 8.95e-144 404 78 0 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Escherichia coli O157:H7
Q8ZKA2 1.16e-143 404 78 0 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z182 5.29e-143 402 78 0 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Salmonella typhi
Q6D127 1.22e-142 402 79 0 243 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q87L11 1.48e-126 361 68 0 241 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KNY2 1.11e-125 359 69 0 241 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MH13 7.69e-124 354 67 0 241 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Vibrio vulnificus (strain YJ016)
Q8DCT8 7.69e-124 354 67 0 241 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Vibrio vulnificus (strain CMCP6)
P44906 9.25e-124 354 69 1 243 1 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6LM40 6.04e-121 347 67 0 241 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Photobacterium profundum (strain SS9)
Q9CJP3 1.97e-120 345 69 1 243 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Pasteurella multocida (strain Pm70)
Q7VP36 1.01e-118 341 67 1 243 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8EAG8 1.01e-110 321 61 0 240 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9HUM8 5.74e-95 281 60 4 243 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87VK2 1.78e-92 275 58 2 241 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8Y016 4.61e-91 271 59 2 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q88DE7 4.76e-91 271 58 2 241 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q7NYX3 1.29e-88 265 56 2 240 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9JZR3 4.8e-83 251 53 2 239 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q7VQP0 1.16e-82 250 48 1 244 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Blochmanniella floridana
Q9JUU8 4.64e-81 246 53 2 239 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q7VTK4 4.64e-80 243 52 2 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W7I7 4.64e-80 243 52 2 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WKX5 4.64e-80 243 52 2 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q83CW6 2.17e-77 236 49 3 245 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q82XD1 5.8e-74 228 49 2 244 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q9PC00 9.46e-74 227 50 1 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Xylella fastidiosa (strain 9a5c)
Q87D65 1.16e-72 224 50 1 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q6FF50 1.02e-69 217 47 2 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8PAG5 3.92e-67 210 49 1 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PM64 4.63e-66 207 48 1 242 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Xanthomonas axonopodis pv. citri (strain 306)
Q9RED7 7.41e-66 207 49 2 243 3 rlmB 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB Burkholderia sp.
Q06753 9.68e-59 189 41 4 244 3 yacO Putative TrmH family tRNA/rRNA methyltransferase YacO Bacillus subtilis (strain 168)
Q7A1Q9 4.65e-50 167 40 5 244 3 MW0487 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain MW2)
Q6GBV6 4.65e-50 167 40 5 244 3 SAS0489 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain MSSA476)
Q6GJD7 4.65e-50 167 40 5 244 3 SAR0535 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain MRSA252)
Q7A794 4.65e-50 167 40 5 244 1 SA0490 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain N315)
Q99W72 4.65e-50 167 40 5 244 3 SAV0531 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9AGT0 5.65e-50 167 40 5 244 3 NWMN_0494 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain Newman)
Q5HIE3 5.65e-50 167 40 5 244 3 SACOL0578 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus aureus (strain COL)
P74328 7.43e-50 170 39 3 243 3 slr0955 Uncharacterized tRNA/rRNA methyltransferase slr0955 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q49V41 2.85e-49 165 46 2 180 3 SSP2224 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4L3J1 2.87e-48 162 37 4 243 3 SH2477 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus haemolyticus (strain JCSC1435)
Q8CTT9 6.17e-48 161 39 5 247 3 SE_0294 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRM1 6.17e-48 161 39 5 247 3 SERP0172 Putative TrmH family tRNA/rRNA methyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A1TG08 2.62e-43 151 39 5 246 3 Mvan_5337 Uncharacterized tRNA/rRNA methyltransferase Mvan_5337 Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
B1MGY6 5.87e-41 145 37 4 246 3 MAB_0572 Uncharacterized tRNA/rRNA methyltransferase MAB_0572 Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
A4T5L0 2.31e-40 144 38 8 249 3 Mflv_1447 Uncharacterized tRNA/rRNA methyltransferase Mflv_1447 Mycolicibacterium gilvum (strain PYR-GCK)
Q9CCW4 1.64e-39 141 37 3 221 3 ML0324 Uncharacterized tRNA/rRNA methyltransferase ML0324 Mycobacterium leprae (strain TN)
B8ZUB0 1.64e-39 141 37 3 221 3 MLBr00324 Uncharacterized tRNA/rRNA methyltransferase MLBr00324 Mycobacterium leprae (strain Br4923)
B2HJ20 2.64e-38 138 37 7 247 3 MMAR_5079 Uncharacterized tRNA/rRNA methyltransferase MMAR_5079 Mycobacterium marinum (strain ATCC BAA-535 / M)
A0PV26 3.2e-38 138 37 7 247 3 MUL_4155 Uncharacterized tRNA/rRNA methyltransferase MUL_4155 Mycobacterium ulcerans (strain Agy99)
A0QAB6 3.74e-38 138 36 3 243 3 MAV_0574 Uncharacterized tRNA/rRNA methyltransferase MAV_0574 Mycobacterium avium (strain 104)
Q743W2 1.52e-37 136 36 5 245 3 MAP_0479 Uncharacterized tRNA/rRNA methyltransferase MAP_0479 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
O51468 3.44e-36 130 34 4 211 3 BB_0516 Uncharacterized tRNA/rRNA methyltransferase BB_0516 Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
A0R557 1.42e-34 129 38 4 244 3 MSMEG_6073 Uncharacterized tRNA/rRNA methyltransferase MSMEG_6073/MSMEI_5913 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A5U8Q4 1.41e-33 126 36 6 241 3 MRA_3618 Uncharacterized tRNA/rRNA methyltransferase MRA_3618 Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P9WFY5 1.41e-33 126 36 6 241 1 Rv3579c Uncharacterized tRNA/rRNA methyltransferase Rv3579c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFY4 1.41e-33 126 36 6 241 3 MT3685 Uncharacterized tRNA/rRNA methyltransferase MT3685 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TW55 5.19e-33 125 36 6 239 3 BQ2027_MB3610C Uncharacterized tRNA/rRNA methyltransferase Mb3610c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A1KPR5 7.99e-33 124 36 6 239 3 BCG_3644c Uncharacterized tRNA/rRNA methyltransferase BCG_3644c Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A3Q6V9 7.17e-32 121 38 6 247 3 Mjls_5122 Uncharacterized tRNA/rRNA methyltransferase Mjls_5122 Mycobacterium sp. (strain JLS)
A1UMF4 1.79e-31 120 38 6 247 3 Mkms_4822 Uncharacterized tRNA/rRNA methyltransferase Mkms_4822 Mycobacterium sp. (strain KMS)
Q1B2P4 1.79e-31 120 38 6 247 3 Mmcs_4736 Uncharacterized tRNA/rRNA methyltransferase Mmcs_4736 Mycobacterium sp. (strain MCS)
P47494 2.2e-25 103 31 4 206 3 MG252 Uncharacterized tRNA/rRNA methyltransferase MG252 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
O30272 2.67e-25 102 32 2 185 3 AF_2399 Uncharacterized tRNA/rRNA methyltransferase AF_2399 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P75424 7.21e-23 96 30 3 198 3 MPN_355 Uncharacterized tRNA/rRNA methyltransferase MG252 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q5SM16 3.35e-18 82 40 5 152 1 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72GI1 3.35e-18 82 40 5 152 1 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
O67577 4.45e-18 82 32 3 161 1 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Aquifex aeolicus (strain VF5)
Q99J25 1.25e-17 83 31 3 215 2 Mrm1 rRNA methyltransferase 1, mitochondrial Mus musculus
Q6IN84 5.3e-17 82 33 7 221 1 MRM1 rRNA methyltransferase 1, mitochondrial Homo sapiens
P0AGJ4 5.69e-17 80 33 3 159 3 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Shigella flexneri
P0AGJ2 5.69e-17 80 33 3 159 1 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Escherichia coli (strain K12)
P0AGJ3 5.69e-17 80 33 3 159 3 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Escherichia coli O157:H7
O94631 4.74e-16 79 25 8 273 3 mrm1 rRNA methyltransferase 1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0AGJ5 8.13e-16 79 27 6 247 1 yfiF Uncharacterized tRNA/rRNA methyltransferase YfiF Escherichia coli (strain K12)
P0AGJ6 8.13e-16 79 27 6 247 3 yfiF Uncharacterized tRNA/rRNA methyltransferase YfiF Escherichia coli O157:H7
P74261 8.14e-16 77 32 0 145 3 slr1673 Uncharacterized tRNA/rRNA methyltransferase slr1673 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9F5K6 9.93e-16 77 35 2 153 1 aviRb 23S rRNA (uridine(2479)-2'-O)-methyltransferase Streptomyces viridochromogenes
P94538 1.45e-15 77 33 3 143 1 rlmP 23S rRNA (guanosine(2553)-2'-O)-methyltransferase RlmP Bacillus subtilis (strain 168)
Q76NT0 1.04e-13 73 25 3 219 3 mrm1 rRNA methyltransferase 1, mitochondrial Dictyostelium discoideum
P25270 2.98e-13 72 24 7 286 1 MRM1 rRNA methyltransferase 1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P59968 1.28e-09 60 27 7 246 3 BQ2027_MB0905 Uncharacterized tRNA/rRNA methyltransferase Mb0905 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFY2 1.28e-09 60 27 7 246 3 MT0904 Uncharacterized tRNA/rRNA methyltransferase MT0904 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WFY3 1.09e-08 57 27 7 246 3 Rv0881 Uncharacterized tRNA/rRNA methyltransferase Rv0881 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A1L2E4 1.43e-07 55 25 5 207 2 rnmtl1b rRNA methyltransferase 3B, mitochondrial Danio rerio
Q5ND52 1.65e-06 52 23 8 254 2 Mrm3 rRNA methyltransferase 3, mitochondrial Mus musculus
Q9HC36 1.87e-06 51 23 9 273 1 MRM3 rRNA methyltransferase 3, mitochondrial Homo sapiens
A4QNL8 2.03e-06 51 23 8 264 2 mrm3 rRNA methyltransferase 3, mitochondrial Xenopus tropicalis
Q6GPJ4 3.65e-06 50 23 8 251 2 mrm3 rRNA methyltransferase 3, mitochondrial Xenopus laevis
O51081 4.13e-06 49 26 4 146 3 trmH tRNA (guanosine(18)-2'-O)-methyltransferase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q13395 4.87e-06 50 28 4 150 1 TARBP1 Probable methyltransferase TARBP1 Homo sapiens
P52391 1.4e-05 48 30 5 145 1 nshR 23S rRNA (adenosine(1067)-2'-O)-methyltransferase Streptomyces actuosus
P74516 2.35e-05 46 25 1 145 3 slr0992 Putative tRNA (cytidine(34)-2'-O)-methyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P18644 3.96e-05 47 27 5 147 1 tsnR 23S rRNA (adenosine(1067)-2'-O)-methyltransferase Streptomyces azureus
P52393 0.000585 43 28 11 237 3 tsnR 23S rRNA (adenosine(1067)-2'-O)-methyltransferase Streptomyces laurentii

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS09710
Feature type CDS
Gene rlmB
Product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
Location 46443 - 47177 (strand: 1)
Length 735 (nucleotides) / 244 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1372
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00588 SpoU rRNA Methylase family
PF08032 RNA 2'-O ribose methyltransferase substrate binding

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0566 Translation, ribosomal structure and biogenesis (J) J tRNA G18 (ribose-2'-O)-methylase SpoU

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03218 23S rRNA (guanosine2251-2'-O)-methyltransferase [EC:2.1.1.185] - -

Protein Sequence

MSEIIYGIHAVDALLASDPSRFIEVYILKGREDRRLIPVAQALEAAGIRVQVANRQWMDSQAEGGVHQGVIAKVKGGRQYQEQDLPDLLAEHETPFLLVLDGVTDPHNLGACLRTADAAGVHAVIIPKDRSAQLNATVKKVACGAAESVPLIRVTNLARTLRQLKDENIWIVGTAGEATHDLYQSKMTGPVALVMGAEGEGMRRLTRDLCDELISIPMAGAVSSLNVSVATGVCLFEAVRQRGK

Flanking regions ( +/- flanking 50bp)

GAGGCGGTAGCGCCTCACCGGGTATATTATCCTGCAACAAACGGAACGTTATGAGTGAAATTATTTATGGTATTCACGCCGTGGATGCCTTGCTGGCGAGTGATCCCAGCCGTTTTATTGAAGTCTATATCTTAAAAGGGCGCGAAGACCGCCGTCTTATCCCGGTTGCTCAGGCACTGGAAGCGGCCGGTATCCGTGTTCAGGTGGCAAACCGCCAGTGGATGGACAGCCAGGCTGAAGGTGGCGTGCATCAGGGTGTTATCGCTAAAGTTAAAGGCGGTCGTCAGTATCAGGAACAGGATCTGCCGGATTTACTGGCAGAGCATGAAACACCTTTCCTGCTGGTGCTGGATGGCGTGACTGATCCGCACAATTTGGGTGCTTGTCTGCGTACTGCGGACGCTGCCGGTGTTCATGCCGTGATTATCCCGAAAGACCGCTCGGCGCAACTGAATGCGACAGTTAAAAAAGTGGCATGTGGTGCGGCAGAAAGTGTTCCGCTGATCCGCGTGACCAATCTGGCCCGTACATTGCGCCAGCTGAAAGATGAAAATATCTGGATTGTCGGCACTGCAGGTGAAGCGACACACGATCTCTATCAGAGCAAGATGACCGGTCCTGTGGCGCTGGTCATGGGTGCGGAAGGCGAAGGTATGCGCCGCCTGACCCGCGACCTGTGCGATGAGCTGATCAGCATCCCGATGGCGGGGGCGGTATCCTCTCTGAATGTCTCTGTGGCAACGGGTGTGTGTCTGTTTGAAGCCGTACGCCAGCGCGGAAAATAATCGCGCACCGCGAACTATTGCCTTGTCTTTTGCATCGGGCGTGGGTATAG