Homologs in group_538

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00650 FBDBKF_00650 89.2 Morganella morganii S1 fliR flagellar biosynthetic protein FliR
EHELCC_00895 EHELCC_00895 89.2 Morganella morganii S2 fliR flagellar biosynthetic protein FliR
NLDBIP_02565 NLDBIP_02565 89.2 Morganella morganii S4 fliR flagellar biosynthetic protein FliR
LHKJJB_04080 LHKJJB_04080 89.2 Morganella morganii S3 fliR flagellar biosynthetic protein FliR
HKOGLL_02965 HKOGLL_02965 89.2 Morganella morganii S5 fliR flagellar biosynthetic protein FliR
PMI_RS08020 PMI_RS08020 58.8 Proteus mirabilis HI4320 fliR flagellar biosynthetic protein FliR

Distribution of the homologs in the orthogroup group_538

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_538

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P34202 9.38e-92 274 54 0 256 3 fliR Flagellar biosynthetic protein FliR Pectobacterium carotovorum subsp. carotovorum
P54702 6.56e-76 234 51 0 256 1 fliR Flagellar biosynthetic protein FliR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P33135 6.64e-74 229 52 0 256 3 fliR Flagellar biosynthetic protein FliR Escherichia coli (strain K12)
P57186 1.87e-55 181 41 0 246 3 fliR Flagellar biosynthetic protein FliR Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AZ0 4.12e-55 181 40 0 238 3 fliR Flagellar biosynthetic protein FliR Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8KA35 1.72e-51 171 41 0 246 3 fliR Flagellar biosynthetic protein FliR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P35537 1.78e-22 96 31 5 222 3 fliR Flagellar biosynthetic protein FliR Bacillus subtilis (strain 168)
O67773 5.53e-17 81 34 8 232 3 fliR Flagellar biosynthetic protein FliR Aquifex aeolicus (strain VF5)
Q45975 1.08e-16 80 27 3 208 3 fliR Flagellar biosynthetic protein FliR Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P74932 1.1e-07 55 22 2 148 3 fliR Flagellar biosynthetic protein FliR Treponema pallidum (strain Nichols)
P40701 5.87e-07 52 23 3 241 1 spaR Surface presentation of antigens protein SpaR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1M7 3.55e-06 50 22 2 150 3 spaR Surface presentation of antigens protein SpaR Shigella sonnei
P96068 4.48e-06 50 25 1 146 3 ssaT Secretion system apparatus protein SsaT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1M6 4.49e-06 50 22 2 150 1 spaR Surface presentation of antigens protein SpaR Shigella flexneri
Q44907 9.54e-05 46 24 5 243 3 fliR Flagellar biosynthetic protein FliR Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS06660
Feature type CDS
Gene fliR
Product flagellar biosynthetic protein FliR
Location 1384229 - 1385011 (strand: 1)
Length 783 (nucleotides) / 260 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_538
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01311 Bacterial export proteins, family 1

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1684 Cell motility (N) N Flagellar biosynthesis protein FliR

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02421 flagellar biosynthesis protein FliR Flagellar assembly -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG002340 flagellar biosynthetic protein FliR VF0394 Motility

Protein Sequence

MLTITSETLTLWLSQGFYPFIRILALLSTAPFFNEKQSIGKVRVMLAFFTVLIVSPQLPVVNIPLFSAPGLWVILQQMVIGITMGLAMQIAFAAVRHAGEVIGLQMGLSFATFFDPSGGPNMPIIARIFNLIVLLLFLSFDGHLWLIHIVVNSFDLLPIQILPLNRDGFWILVQSANHIFLNGLMLALPFITLFLILNLALGILNRMTPQLSVFVVGFPLTLTVGISMLGLIISVLPSYTERVINQAFEQLSLIFTLYAG

Flanking regions ( +/- flanking 50bp)

ACTATATGCGCAGCCTGTTAAGTAATCTGCCGTTCATTATTGGTTAATCTATGTTAACCATTACCAGCGAAACACTCACATTATGGCTGAGCCAGGGATTTTATCCGTTTATCCGGATCCTGGCACTGCTGAGCACCGCACCCTTTTTCAATGAAAAACAGTCCATTGGTAAAGTCCGGGTCATGCTGGCCTTTTTTACGGTGCTGATTGTCTCGCCACAGTTACCGGTGGTGAATATTCCGCTGTTTTCCGCGCCCGGCTTATGGGTCATTCTGCAACAAATGGTGATTGGTATAACCATGGGGCTGGCGATGCAGATAGCATTTGCCGCTGTGCGTCATGCCGGTGAAGTGATTGGTTTACAGATGGGTCTATCTTTCGCGACTTTTTTTGACCCGAGCGGCGGTCCGAATATGCCGATTATCGCGCGTATATTTAACCTGATCGTTCTGTTGCTGTTTCTCTCTTTTGACGGGCATCTGTGGCTGATTCATATTGTGGTTAATTCATTTGATCTGCTTCCCATACAGATACTCCCGCTGAACCGCGATGGCTTCTGGATACTGGTGCAATCAGCTAACCATATATTTTTAAACGGATTGATGCTGGCACTGCCGTTTATTACCTTATTTCTGATTCTTAACCTGGCGTTAGGTATCTTAAATCGCATGACACCTCAGTTATCTGTCTTTGTGGTCGGTTTTCCACTGACGCTGACCGTCGGAATAAGTATGCTCGGTCTGATTATTTCTGTTCTTCCGAGCTATACCGAGCGGGTGATTAATCAGGCGTTTGAACAATTATCACTGATTTTCACACTCTACGCAGGTTGATTGTAAACACCGGACAAAAAAAACGGTAACCACTGAGAAAGTGGTTACCG