Homologs in group_3844
1 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product | |
|---|---|---|---|---|---|
| PMI_RS09790 | PMI_RS09790 | 63.1 | Proteus mirabilis HI4320 | - | M15 family metallopeptidase |
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|---|---|---|---|---|---|---|---|---|
| Q6QGP7 | 5.3e-27 | 100 | 42 | 5 | 135 | 1 | lys | L-alanyl-D-glutamate peptidase | Escherichia phage T5 |
| Q37976 | 2.92e-05 | 45 | 27 | 5 | 134 | 2 | ply | L-alanyl-D-glutamate peptidase | Listeria phage A118 |
| Source | Morganella psychrotolerans |
|---|---|
| Locus tag | F4V73_RS06170 |
| Feature type | CDS |
| Gene | - |
| Product | M15 family metallopeptidase |
| Location | 1300051 - 1300449 (strand: -1) |
| Length | 399 (nucleotides) / 132 (amino acids) |
| In genomic island | GI68 |
| Accession | NZ_VXKB01000001 |
|---|---|
| Length | 2012992 nucleotides |
| Topology | linear |
| Plasmid | False |
| Orthogroup | group_3844 | |
|---|---|---|
| Orthogroup size | 2 | |
| N. genomes | 2 |
MIMSSFRFSKRSEDNLKGVNPDLVKVIRRALEITPVDFIVIEGLRTQARQKELVAAGKSQTNNSRHLTGHAVDIIPVNTKWQIEEFKPLLKAVKQAADELGVKLRFGINWKNDPSLPIETRFIDAPHIEIPA
GTCAGGTGCTGAGTTCATTAAGGCGCTTGAGAAACGGATAAAAAGGAAAATTGATAATGAGTAGCTTCAGATTCAGTAAGCGCAGTGAAGATAACCTGAAAGGCGTCAATCCTGACTTGGTGAAAGTTATCCGCCGCGCGCTGGAGATTACACCGGTGGATTTCATTGTTATTGAAGGTCTGCGCACACAAGCTCGCCAAAAAGAATTGGTCGCAGCTGGTAAATCACAAACAAATAACAGCCGACATCTGACCGGCCATGCAGTAGACATTATTCCGGTTAACACCAAGTGGCAGATTGAAGAATTCAAGCCGTTGCTGAAAGCAGTTAAACAGGCTGCTGATGAACTTGGCGTGAAGTTGCGGTTCGGTATCAACTGGAAGAATGACCCGTCATTGCCGATTGAGACACGGTTCATTGATGCGCCTCATATCGAAATACCGGCATGAGTACCGCGACAAAGATATGGCTCGGTATTTGCGGAACACTGGCTATCGGC
