Homologs in group_927

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05035 FBDBKF_05035 85.9 Morganella morganii S1 rsxC electron transport complex subunit RsxC
EHELCC_12555 EHELCC_12555 85.9 Morganella morganii S2 rsxC electron transport complex subunit RsxC
NLDBIP_12895 NLDBIP_12895 85.9 Morganella morganii S4 rsxC electron transport complex subunit RsxC
LHKJJB_12755 LHKJJB_12755 85.9 Morganella morganii S3 rsxC electron transport complex subunit RsxC
HKOGLL_11370 HKOGLL_11370 85.9 Morganella morganii S5 rsxC electron transport complex subunit RsxC
PMI_RS06300 PMI_RS06300 66.7 Proteus mirabilis HI4320 rsxC electron transport complex subunit RsxC

Distribution of the homologs in the orthogroup group_927

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_927

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q1CIY9 0.0 756 67 2 564 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8U6 0.0 756 67 2 564 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pestis bv. Antiqua (strain Angola)
B1JKN4 0.0 756 68 1 555 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q1C7K3 0.0 756 67 2 564 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pestis bv. Antiqua (strain Antiqua)
A7FHZ3 0.0 755 68 1 555 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2K4K0 0.0 754 67 1 555 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A1JM81 0.0 740 67 1 555 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B7LQP1 0.0 739 60 5 681 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P58324 0.0 739 60 6 688 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O157:H7
B5Z463 0.0 734 58 6 711 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q83RB9 0.0 734 61 6 649 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella flexneri
Q0T4E8 0.0 734 61 6 649 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella flexneri serotype 5b (strain 8401)
B5FIE7 0.0 731 62 6 667 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella dublin (strain CT_02021853)
Q32FE4 0.0 729 62 6 652 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella dysenteriae serotype 1 (strain Sd197)
B4TV17 0.0 728 61 6 691 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella schwarzengrund (strain CVM19633)
A9MRW8 0.0 728 66 0 540 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q0THJ8 0.0 728 62 6 651 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7M0I6 0.0 728 62 6 649 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O8 (strain IAI1)
B7L5I2 0.0 728 62 6 649 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain 55989 / EAEC)
A8A0H2 0.0 728 62 6 649 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O9:H4 (strain HS)
Q1RBG7 0.0 727 62 6 649 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain UTI89 / UPEC)
B7NB83 0.0 727 62 6 649 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FH95 0.0 727 62 6 649 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MVA7 0.0 727 62 6 649 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O81 (strain ED1a)
B7M9Y3 0.0 727 62 6 649 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O45:K1 (strain S88 / ExPEC)
B7URX0 0.0 727 62 6 649 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q3Z1Y4 0.0 727 62 6 649 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella sonnei (strain Ss046)
A8AH10 0.0 727 65 0 541 3 rnfC Ion-translocating oxidoreductase complex subunit C Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B1LEQ7 0.0 726 61 6 688 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain SMS-3-5 / SECEC)
A1ABH4 0.0 724 62 6 649 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O1:K1 / APEC
Q320Y6 0.0 723 64 2 566 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella boydii serotype 4 (strain Sb227)
A7ZM89 0.0 723 60 6 673 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O139:H28 (strain E24377A / ETEC)
B2U2C8 0.0 723 64 2 566 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6IB67 0.0 721 60 6 673 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain SE11)
P77611 0.0 721 60 6 673 1 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain K12)
B1IQC5 0.0 721 60 6 673 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XFU1 0.0 721 60 6 673 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain K12 / DH10B)
C4ZY92 0.0 721 60 6 673 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain K12 / MC4100 / BW2952)
A8GE00 0.0 721 66 3 562 3 rnfC Ion-translocating oxidoreductase complex subunit C Serratia proteamaculans (strain 568)
B7NU04 0.0 720 60 6 673 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B4THD4 0.0 719 65 1 563 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella heidelberg (strain SL476)
A9N025 0.0 718 65 1 563 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5F6J0 0.0 718 66 0 529 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella agona (strain SL483)
B4T594 0.0 718 66 0 529 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella newport (strain SL254)
B5BKB2 0.0 717 66 0 529 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi A (strain AKU_12601)
Q5PIB9 0.0 717 66 0 529 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RAK2 0.0 716 66 0 529 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q8ZPM2 0.0 716 66 0 529 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0Q508 0.0 715 66 0 529 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi C (strain RKS4594)
B5QV02 0.0 715 66 0 529 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella enteritidis PT4 (strain P125109)
Q57PI0 0.0 712 66 0 529 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella choleraesuis (strain SC-B67)
B5XWP9 0.0 712 64 3 607 3 rnfC Ion-translocating oxidoreductase complex subunit C Klebsiella pneumoniae (strain 342)
C6DH15 0.0 688 62 3 605 3 rnfC Ion-translocating oxidoreductase complex subunit C Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D4W2 0.0 684 61 7 689 3 rnfC Ion-translocating oxidoreductase complex subunit C Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7MMK9 0.0 682 61 4 682 3 rnfC Ion-translocating oxidoreductase complex subunit C Cronobacter sakazakii (strain ATCC BAA-894)
B2VEQ3 0.0 670 61 2 566 3 rnfC Ion-translocating oxidoreductase complex subunit C Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C5BDE7 0.0 622 64 1 502 3 rnfC Ion-translocating oxidoreductase complex subunit C Edwardsiella ictaluri (strain 93-146)
Q9CNP2 0.0 604 51 4 572 3 rnfC Ion-translocating oxidoreductase complex subunit C Pasteurella multocida (strain Pm70)
P71397 0.0 602 52 8 567 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q65U33 0.0 599 52 3 547 3 rnfC Ion-translocating oxidoreductase complex subunit C Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A5UBJ0 0.0 597 51 7 567 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus influenzae (strain PittEE)
Q4QJQ6 0.0 596 52 8 567 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus influenzae (strain 86-028NP)
A6VQ42 0.0 567 52 2 509 3 rnfC Ion-translocating oxidoreductase complex subunit C Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7VNT4 0.0 544 48 5 560 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9KT88 1.94e-176 525 49 6 580 3 rnfC Ion-translocating oxidoreductase complex subunit C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AJC2 2.96e-176 524 49 6 580 3 rnfC Ion-translocating oxidoreductase complex subunit C Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9HYB8 3.32e-130 405 49 3 454 3 rnfC Ion-translocating oxidoreductase complex subunit C Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P57215 4.87e-106 333 38 3 434 3 rnfC Ion-translocating oxidoreductase complex subunit C Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AW8 5.02e-100 318 37 4 431 3 rnfC Ion-translocating oxidoreductase complex subunit C Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
D5ARZ1 1.78e-96 310 39 5 459 3 rnfC Ion-translocating oxidoreductase complex subunit C Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q52716 1.78e-96 310 39 5 459 1 rnfC Ion-translocating oxidoreductase complex subunit C Rhodobacter capsulatus
D8GR66 2.32e-95 305 37 8 433 2 rnfC Proton-translocating ferredoxin:NAD(+) oxidoreductase complex subunit C Clostridium ljungdahlii (strain ATCC 55383 / DSM 13528 / PETC)
H6LC32 2.79e-87 283 37 6 437 1 rnfC Na(+)-translocating ferredoxin:NAD(+) oxidoreductase complex subunit C Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
Q8TSY4 5.27e-32 132 28 15 455 1 rnfC Ion-translocating oxidoreductase complex subunit C Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9XDM9 1.13e-25 114 30 10 342 1 pduS Cobalamin reductase PduS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B1VB77 4.37e-21 100 29 8 310 1 pduS Cobalamin reductase PduS Citrobacter freundii
P81292 0.00034 45 28 3 106 4 MJ0514.1 Uncharacterized polyferredoxin-like protein MJ0514.1 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O30274 0.000543 47 30 3 88 3 cdhA2 Acetyl-CoA decarbonylase/synthase complex subunit alpha 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A6MMR2 0.000619 42 33 1 62 3 psaC Photosystem I iron-sulfur center Dioscorea elephantipes
Q50570 0.000653 46 30 3 100 3 fdhB Formate dehydrogenase subunit beta Methanothermobacter thermautotrophicus
A1E9X5 0.000775 42 31 2 79 3 psaC Photosystem I iron-sulfur center Sorghum bicolor
P11601 0.000783 42 33 1 62 3 psaC Photosystem I iron-sulfur center Zea mays

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS05475
Feature type CDS
Gene rsxC
Product electron transport complex subunit RsxC
Location 1163888 - 1165921 (strand: 1)
Length 2034 (nucleotides) / 677 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_927
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01512 Respiratory-chain NADH dehydrogenase 51 Kd subunit
PF10531 SLBB domain
PF12838 4Fe-4S dicluster domain
PF13375 RnfC Barrel sandwich hybrid domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4656 Energy production and conversion (C) C Na+-translocating ferredoxin:NAD+ oxidoreductase RNF, RnfC subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03615 H+/Na+-translocating ferredoxin:NAD+ oxidoreductase subunit C [EC:7.1.1.11 7.2.1.2] - -

Protein Sequence

MFNLLNLLKKDRVWDFDGGIHPPEMKVQSSRTPMRVCPVPPELIIPLQQHIGNEGDLIVRPGEHVLKGQPLTSGTGRTLPVHATSSGIITAIEPCVTAHPSGLTAPCVRIQTDGLDTAYPSEKTPDFCSLSKTELTDRIHQAGIAGLGGAGFPTASKLKGGGDLIRTLIINAAECEPYITADDRLMQEHGGEILTGIHILMHLLAPEQVLIGIEDNKQEAIAALREVTAGETQIHVRVIPTKYPSGGAKQLTKILTGREVPSGGRSSDIGVLMQNVGTVVAIKRAIVDGEPLIERVVTVTGEAVQTPGNFRTRLGTPVRFLLEQAGFNPQHQQMVVMGGPLMGFTLPDLNVPVVKICNCILAPTSDEMQPEAPEEACIRCSHCVDACPAGLLPQQLYWFSKGKEHEKAEQHHLFDCIECGACAWVCPSNIPLVQYYRQEKAQIIEIRSETQRAAEAKVRFEARQARLAREKEARDARHKKAAVQVDEKDSSAISAALARVKEKNTTAGGTITINPTVLPDNSAVIAAREARKAQARARQAEKAAESESKPNDVIAETETDPRKAAVAAAIARAKAKKTAQAAEQNGETHSAPEPVAAAEADVDPRKAAVAAAIARAKAKKAAQAAEQSNETHSAPEPLAVAEADIDPRKAAVAAAIARAKAKKAAQAAEKTTDNEAI

Flanking regions ( +/- flanking 50bp)

CCTGCTGCATCCCCGGTCAAACCCGTTCAGATTGAGGCGTCATAAGTTTTATGTTTAATTTACTCAATTTATTGAAAAAAGACCGGGTCTGGGATTTTGACGGCGGCATTCATCCGCCGGAAATGAAAGTGCAATCATCCCGCACGCCTATGCGTGTCTGCCCTGTCCCGCCGGAGCTGATTATTCCGCTGCAACAGCATATCGGCAACGAAGGCGACCTGATTGTCCGCCCGGGTGAACATGTTCTCAAAGGTCAGCCGCTGACAAGCGGCACCGGGCGCACATTACCGGTTCACGCCACATCCTCCGGGATTATCACCGCGATTGAACCTTGTGTAACCGCGCACCCGTCCGGACTGACCGCACCGTGTGTCCGTATACAGACTGACGGGTTGGATACAGCTTATCCTTCTGAAAAAACACCGGATTTCTGCTCCCTGAGTAAGACAGAACTGACTGATCGTATTCATCAGGCGGGAATTGCCGGTCTGGGTGGCGCGGGTTTCCCGACTGCCAGCAAACTCAAAGGCGGCGGTGACCTTATCCGCACCCTGATTATCAATGCCGCAGAGTGTGAACCCTATATCACGGCGGATGATCGTCTGATGCAGGAGCATGGCGGCGAAATTCTGACCGGTATTCACATCCTGATGCATCTTTTGGCTCCGGAGCAGGTGTTAATCGGCATTGAAGATAATAAACAGGAAGCAATTGCCGCCCTGCGAGAGGTAACCGCCGGGGAAACACAGATACATGTGCGTGTGATCCCGACAAAATACCCGTCCGGCGGCGCTAAACAACTGACAAAAATTCTGACCGGGCGGGAAGTGCCGTCCGGCGGGCGTTCATCTGATATCGGCGTGCTGATGCAGAACGTCGGCACCGTCGTTGCCATAAAACGCGCCATTGTTGATGGTGAGCCGCTGATTGAGCGCGTGGTCACCGTTACGGGTGAAGCGGTTCAGACTCCCGGTAACTTCCGGACGCGCCTCGGCACACCGGTACGTTTCCTGCTGGAACAAGCCGGGTTTAACCCGCAGCACCAGCAAATGGTGGTGATGGGCGGTCCGCTGATGGGCTTTACCCTGCCGGATCTTAATGTGCCGGTGGTAAAAATCTGTAACTGTATTCTTGCGCCGACCTCAGATGAAATGCAGCCCGAAGCCCCGGAAGAGGCCTGTATCCGTTGCAGTCACTGTGTGGATGCCTGTCCTGCCGGTTTGCTGCCGCAGCAATTATACTGGTTCAGTAAAGGCAAAGAGCATGAGAAAGCCGAACAACACCATTTATTTGACTGTATAGAGTGCGGTGCCTGCGCCTGGGTCTGCCCGTCCAATATTCCGCTGGTGCAATATTACCGGCAGGAAAAAGCACAGATTATTGAGATCCGCAGCGAAACGCAGCGGGCAGCGGAAGCGAAAGTTCGTTTTGAAGCCAGACAGGCACGGCTTGCCCGCGAAAAAGAAGCCCGCGATGCACGGCATAAAAAAGCCGCTGTACAGGTGGATGAAAAAGACAGTTCTGCCATCAGCGCTGCTCTCGCCCGGGTGAAAGAAAAAAATACCACCGCAGGCGGTACAATTACCATCAATCCGACGGTATTACCGGATAACAGTGCTGTTATTGCTGCCCGTGAAGCCAGAAAGGCACAGGCGCGGGCACGCCAGGCAGAAAAAGCCGCTGAATCCGAATCCAAACCTAATGATGTGATCGCAGAAACTGAAACCGATCCGCGTAAAGCCGCTGTTGCCGCTGCCATTGCCCGCGCCAAAGCAAAGAAAACTGCACAAGCTGCTGAGCAAAACGGCGAAACGCACAGCGCACCTGAACCGGTAGCTGCGGCAGAAGCCGATGTTGATCCGCGCAAAGCCGCTGTCGCCGCTGCCATTGCCCGCGCCAAAGCAAAAAAAGCGGCACAGGCCGCTGAGCAAAGTAACGAAACGCACAGCGCACCTGAACCGCTAGCTGTTGCAGAGGCAGATATTGATCCGCGCAAAGCCGCTGTCGCGGCTGCTATTGCCCGCGCCAAAGCAAAGAAAGCTGCTCAGGCTGCTGAAAAAACCACTGATAATGAAGCGATATAAGCATGAAATTCAGACCCGTTAACTCAAATACACCGCACCGGCTGAAAATC