Homologs in group_233

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02980 FBDBKF_02980 33.6 Morganella morganii S1 lysR DNA-binding transcriptional regulator, LysR family
EHELCC_03450 EHELCC_03450 33.6 Morganella morganii S2 lysR DNA-binding transcriptional regulator, LysR family
NLDBIP_00010 NLDBIP_00010 33.6 Morganella morganii S4 lysR DNA-binding transcriptional regulator, LysR family
LHKJJB_02025 LHKJJB_02025 33.6 Morganella morganii S3 lysR DNA-binding transcriptional regulator, LysR family
HKOGLL_02065 HKOGLL_02065 33.6 Morganella morganii S5 lysR DNA-binding transcriptional regulator, LysR family
F4V73_RS05420 F4V73_RS05420 32.4 Morganella psychrotolerans - LysR family transcriptional regulator
PMI_RS06240 PMI_RS06240 30.4 Proteus mirabilis HI4320 - LysR family transcriptional regulator

Distribution of the homologs in the orthogroup group_233

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_233

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q04778 6.9e-54 181 33 2 294 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
P77559 8.08e-41 147 33 3 262 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
O68014 3.97e-39 142 36 6 250 1 benM HTH-type transcriptional regulator BenM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P07774 1.02e-37 139 37 3 248 1 catM HTH-type transcriptional regulator CatM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q47141 9.11e-37 136 31 6 295 1 hcaR Hca operon transcriptional activator HcaR Escherichia coli (strain K12)
P52670 1.7e-36 135 31 5 293 3 ilvR HTH-type transcriptional regulator IlvR Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A4QH19 4.41e-36 134 34 2 243 1 shiR HTH-type transcriptional regulator ShiR Corynebacterium glutamicum (strain R)
P20668 4.55e-36 134 31 4 289 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
P23841 1.94e-34 130 31 1 247 3 xapR HTH-type transcriptional regulator XapR Escherichia coli (strain K12)
O33945 4.13e-34 129 32 4 264 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii
P52666 1.82e-33 127 31 1 261 3 budR HTH-type transcriptional regulator BudR Raoultella terrigena
P20667 6.12e-33 125 33 6 262 3 catR HTH-type transcriptional regulator CatR Pseudomonas putida
P39592 2.23e-27 111 26 3 257 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
P27111 2.75e-26 108 30 3 253 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
P70785 1.22e-25 107 32 4 258 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
Q8X4M5 1.53e-25 106 30 3 253 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
Q05840 2.14e-25 105 31 2 247 3 clcR HTH-type transcriptional regulator ClcR Pseudomonas putida
P44418 3.94e-25 105 25 4 300 3 oxyR Hydrogen peroxide-inducible genes activator Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P52696 4.69e-25 105 30 3 242 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
P52669 2.49e-23 100 29 3 247 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
Q46M57 6.75e-23 99 33 2 249 1 tfdR HTH-type transcriptional regulator TdfR Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46M54 7.33e-23 99 33 2 249 1 tfdS HTH-type transcriptional regulator TfdS Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P42427 1.42e-22 97 30 2 211 3 tfdT HTH-type transcriptional regulator TfdT Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q9HWH8 1.78e-22 97 31 4 253 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9X725 4.49e-22 97 25 3 292 3 oxyR Hydrogen peroxide-inducible genes activator Dickeya chrysanthemi
P71318 6.35e-22 96 25 3 291 3 oxyR Hydrogen peroxide-inducible genes activator Pectobacterium carotovorum subsp. carotovorum
P37499 6.67e-21 94 24 4 267 3 yybE Uncharacterized HTH-type transcriptional regulator YybE Bacillus subtilis (strain 168)
P94403 7.29e-21 93 26 4 248 3 bsdA HTH-type transcriptional regulator BsdA Bacillus subtilis (strain 168)
O32255 1.16e-20 93 27 6 253 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
P0ACQ4 1.83e-20 92 24 4 294 1 oxyR DNA-binding transcriptional dual regulator OxyR Escherichia coli (strain K12)
P0ACQ5 1.83e-20 92 24 4 294 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ6 1.83e-20 92 24 4 294 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O157:H7
Q9X5P2 6.92e-20 91 28 3 254 2 oxyR Probable hydrogen peroxide-inducible genes activator Streptomyces viridosporus
A0T0G2 2.18e-19 89 28 6 249 3 rbcR Probable RuBisCO transcriptional regulator Phaeodactylum tricornutum (strain CCAP 1055/1)
P94387 2.86e-19 89 24 8 313 3 ycgK Uncharacterized HTH-type transcriptional regulator YcgK Bacillus subtilis (strain 168)
Q5N5I5 3.79e-19 89 31 2 194 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 3.79e-19 89 31 2 194 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P52678 1.44e-18 87 26 4 306 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium leprae (strain TN)
P94501 1.65e-18 87 23 6 290 1 gltR HTH-type transcriptional regulator GltR Bacillus subtilis (strain 168)
P49518 1.93e-18 87 27 5 253 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
P27102 7.26e-18 85 28 3 279 3 tcbR HTH-type transcriptional regulator TcbR Pseudomonas sp. (strain P51)
P96725 1.27e-17 84 27 4 244 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
B4E8S9 2.37e-17 84 27 3 235 1 ssuR HTH-type transcriptional regulator SsuR Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
P39647 2.88e-17 84 25 4 246 1 cysL HTH-type transcriptional regulator CysL Bacillus subtilis (strain 168)
O35038 6.65e-17 82 29 4 200 3 ytlI HTH-type transcriptional regulator YtlI Bacillus subtilis (strain 168)
P52677 7.83e-17 82 29 5 258 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium avium
P51205 8.37e-17 82 28 5 253 3 rbcR Probable RuBisCO transcriptional regulator Porphyra purpurea
O87324 9.52e-17 82 28 4 256 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium marinum
Q1XDT2 1.38e-16 82 28 5 253 3 rbcR Probable RuBisCO transcriptional regulator Neopyropia yezoensis
P77744 2.83e-16 80 25 5 257 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
P73123 2.99e-16 81 27 3 248 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P52661 3.4e-16 81 26 6 290 1 gbpR HTH-type transcriptional regulator GbpR Azospirillum brasilense
P42722 4.74e-16 80 25 4 244 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P52693 1.39e-15 79 24 3 239 3 ntcB Probable nitrogen assimilation transcriptional activator Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A2CI69 1.62e-15 79 27 1 194 3 rbcR Probable RuBisCO transcriptional regulator Chlorokybus atmophyticus
P48271 3.42e-15 78 27 4 240 3 rbcR Probable RuBisCO transcriptional regulator Cyanophora paradoxa
P74422 4.98e-15 77 25 5 248 3 ntcB Probable nitrogen assimilation transcriptional activator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q3MCB5 7.35e-15 77 26 5 252 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P05827 7.55e-15 77 25 4 248 3 ilvY HTH-type transcriptional regulator IlvY Escherichia coli (strain K12)
P52665 1.2e-14 73 32 1 143 3 budR HTH-type transcriptional regulator BudR (Fragment) Klebsiella aerogenes
P77309 1.54e-14 75 26 7 253 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
O87883 2.13e-14 73 29 1 189 3 oxyR Probable hydrogen peroxide-inducible genes activator (Fragment) Mycobacterium xenopi
Q44311 2.15e-14 75 24 5 245 3 soxR HTH-type transcriptional regulator SoxR Arthrobacter sp. (strain TE1826)
Q8YQ82 2.57e-14 75 26 5 252 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P25544 2.64e-14 75 24 7 251 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
P45105 3.63e-14 75 23 5 240 3 cysB HTH-type transcriptional regulator CysB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q47083 3.65e-14 75 25 4 235 1 cbl HTH-type transcriptional regulator cbl Escherichia coli (strain K12)
Q85G62 3.67e-14 75 28 3 199 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
P0A2Q2 5.17e-14 74 25 4 248 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q3 5.17e-14 74 25 4 248 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhi
P77171 5.23e-14 74 28 3 200 3 ydcI Uncharacterized HTH-type transcriptional regulator YdcI Escherichia coli (strain K12)
O34685 1.45e-13 73 28 4 238 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
Q55459 1.48e-13 73 25 3 242 1 cmpR HTH-type transcriptional activator CmpR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6B936 1.68e-13 73 24 3 250 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
O19892 1.8e-13 73 26 5 237 3 rbcR Probable RuBisCO transcriptional regulator Cyanidium caldarium
O78432 4.41e-13 72 27 3 196 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
P71025 5.38e-13 71 24 5 244 3 czcR HTH-type transcriptional regulator CzcR Bacillus subtilis (strain 168)
Q06610 5.77e-13 71 25 3 245 3 rbcR RuBisCO operon transcriptional regulator Acidithiobacillus ferrooxidans
P33634 6.04e-13 71 28 7 250 3 yfiE Uncharacterized HTH-type transcriptional regulator YfiE Escherichia coli (strain K12)
A7Z5E4 1.42e-12 70 26 4 246 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P52595 1.51e-12 70 26 4 244 3 cbbR HTH-type transcriptional regulator CbbR Rhodospirillum rubrum
Q4G384 1.54e-12 70 24 5 252 3 rbcR Probable RuBisCO transcriptional regulator Emiliania huxleyi
Q6HPH4 1.87e-12 70 23 5 244 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
O06703 1.96e-12 70 27 1 186 3 bbuR HTH-type transcriptional regulator BbuR Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q81IX0 2.51e-12 69 23 5 244 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A0T0V5 2.55e-12 69 25 3 250 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
B4E8V9 2.88e-12 69 22 3 247 1 cysB HTH-type transcriptional regulator CysB Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
P56885 2.88e-12 69 27 2 208 3 cbbR HTH-type transcriptional regulator CbbR Sinorhizobium medicae (strain WSM419)
P52684 2.99e-12 69 23 4 269 3 mauR Malonate utilization transcriptional regulator Klebsiella pneumoniae
P52686 3.2e-12 69 35 2 125 3 sdsB SDS degradation transcriptional activation protein Pseudomonas sp. (strain ATCC 19151)
Q63H01 3.64e-12 68 23 5 244 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ZK / E33L)
Q73EY2 3.64e-12 68 23 5 244 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81VJ1 3.82e-12 68 23 5 244 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
A0R8S0 4.22e-12 68 23 5 244 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis (strain Al Hakam)
P52691 4.4e-12 68 27 4 236 3 lrrA Probable HTH-type transcriptional regulator LrrA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P06614 5.29e-12 68 23 5 235 1 cysB HTH-type transcriptional regulator CysB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A9F3 5.29e-12 68 22 5 235 3 cysB HTH-type transcriptional regulator CysB Escherichia coli (strain K12)
P0A9F4 5.29e-12 68 22 5 235 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F5 5.29e-12 68 22 5 235 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O157:H7
P0ACR8 1.23e-11 67 23 5 256 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 1.23e-11 67 23 5 256 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
P58332 1.57e-11 67 26 2 208 3 cbbR HTH-type transcriptional regulator CbbR Rhizobium meliloti (strain 1021)
P45600 2.47e-11 67 22 5 235 1 cysB HTH-type transcriptional regulator CysB Klebsiella pneumoniae
P16931 4.39e-11 65 25 5 239 3 dgdR HTH-type transcriptional regulator DgdR Burkholderia cepacia
Q47005 2.22e-10 63 24 4 251 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
P44821 3.73e-10 63 26 0 141 3 ilvY HTH-type transcriptional activator IlvY Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P55181 4.63e-10 62 30 3 149 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
P77333 4.72e-10 63 34 0 116 1 pgrR HTH-type transcriptional regulator PgrR Escherichia coli (strain K12)
O07906 5.4e-10 62 22 5 235 3 yraN Uncharacterized HTH-type transcriptional regulator YraN Bacillus subtilis (strain 168)
P44876 6.18e-10 62 22 6 257 3 HI_0775 Uncharacterized HTH-type transcriptional regulator HI_0775 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P55576 1.19e-09 61 28 7 206 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P30864 2.33e-09 60 25 1 172 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
P52667 5.58e-09 59 22 4 250 3 estR HTH-type transcriptional regulator EstR Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P0A4T7 7.86e-09 59 24 2 199 3 pcaQ HTH-type transcriptional regulator PcaQ Rhizobium radiobacter
P0A4T6 7.86e-09 59 24 2 199 3 pcaQ HTH-type transcriptional regulator PcaQ Agrobacterium fabrum (strain C58 / ATCC 33970)
Q08597 1.09e-08 58 23 5 247 3 nac Nitrogen assimilation regulatory protein nac Klebsiella aerogenes
O32186 1.27e-08 58 24 6 247 3 yusT Uncharacterized HTH-type transcriptional regulator YusT Bacillus subtilis (strain 168)
O34701 1.95e-08 58 22 11 290 3 yoaU Uncharacterized HTH-type transcriptional regulator YoaU Bacillus subtilis (strain 168)
Q08598 2.33e-08 58 23 2 236 3 cbl HTH-type transcriptional regulator cbl Klebsiella aerogenes
P0ACR4 1.52e-07 55 28 5 195 1 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli (strain K12)
P0ACR5 1.52e-07 55 28 5 195 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACR6 1.52e-07 55 28 5 195 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O157:H7
P0ACR0 1.78e-07 55 40 1 87 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 1.78e-07 55 40 1 87 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
Q8FK66 1.92e-07 55 40 1 87 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 1.92e-07 55 40 1 87 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P52690 1.94e-07 55 26 6 199 3 cbbR HTH-type transcriptional regulator CbbR Cereibacter sphaeroides
Q9JPU9 2.51e-07 54 25 3 179 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
P94678 2.59e-07 54 24 1 177 1 tsaR HTH-type transcriptional regulator TsaR Comamonas testosteroni
Q1RF30 2.95e-07 54 40 1 87 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 2.95e-07 54 40 1 87 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC
P0ACR2 3.09e-07 54 39 0 81 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli (strain K12)
P0ACR3 3.09e-07 54 39 0 81 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli O157:H7
Q9L127 6.33e-07 53 25 8 258 3 mprR Small neutral protease regulatory protein Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P75836 7.79e-07 53 24 1 170 3 ycaN Uncharacterized HTH-type transcriptional regulator YcaN Escherichia coli (strain K12)
P43161 8e-07 53 25 8 258 3 mprR Small neutral protease regulatory protein Streptomyces lividans
P0ACQ9 8.43e-07 53 20 3 232 3 tdcA HTH-type transcriptional regulator TdcA Shigella flexneri
P0ACQ7 8.43e-07 53 20 3 232 3 tdcA HTH-type transcriptional regulator TdcA Escherichia coli (strain K12)
P0ACQ8 8.43e-07 53 20 3 232 3 tdcA HTH-type transcriptional regulator TdcA Escherichia coli O157:H7
Q765S2 2.17e-06 51 26 6 201 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae
Q9JXW7 2.22e-06 52 25 3 179 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P37641 2.86e-06 51 32 2 126 3 yhjC Uncharacterized HTH-type transcriptional regulator YhjC Escherichia coli (strain K12)
P67662 3.71e-06 51 26 1 143 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli (strain K12)
P67663 3.71e-06 51 26 1 143 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67664 3.71e-06 51 26 1 143 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O157:H7
P43160 4.73e-06 51 25 8 248 3 mprR Small neutral protease regulatory protein Streptomyces coelicolor
O33812 5.3e-06 50 24 9 241 3 None Uncharacterized HTH-type transcriptional regulator in lacR 5'region (Fragment) Staphylococcus xylosus
Q9S4Y7 9.08e-06 50 44 1 68 3 allS HTH-type transcriptional activator AllS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PCH2 9.08e-06 50 44 1 68 3 allS HTH-type transcriptional activator AllS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q88JX7 1.08e-05 50 23 4 195 3 galR HTH-type transcriptional regulator GalR Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q57S50 1.09e-05 50 44 1 68 3 allS HTH-type transcriptional activator AllS Salmonella choleraesuis (strain SC-B67)
O34827 1.44e-05 49 21 0 146 3 ykuM Uncharacterized HTH-type transcriptional regulator YkuM Bacillus subtilis (strain 168)
P96194 2.03e-05 47 33 1 90 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
Q8Z8R3 2.04e-05 48 44 1 68 3 allS HTH-type transcriptional activator AllS Salmonella typhi
P39376 3.84e-05 48 25 3 173 1 yjiE HTH-type transcriptional regulator YjiE Escherichia coli (strain K12)
P0A9F6 7.1e-05 47 27 3 144 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 7.1e-05 47 27 3 144 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 7.1e-05 47 27 3 144 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
P52658 0.000102 47 27 3 155 3 ampR HTH-type transcriptional activator AmpR Citrobacter koseri
P72131 0.000128 46 23 3 257 1 ptxR HTH-type transcriptional regulator PtxR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P76369 0.000167 46 25 0 135 3 yeeY Uncharacterized HTH-type transcriptional regulator YeeY Escherichia coli (strain K12)
Q01610 0.000171 46 30 0 94 3 PA2220 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZDG9 0.00023 45 23 1 143 3 PA14_22550 HTH-type transcriptional repressor PA14_22550 Pseudomonas aeruginosa (strain UCBPP-PA14)
A1JI47 0.00026 45 22 7 254 3 hdfR HTH-type transcriptional regulator HdfR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P67660 0.000269 45 30 0 88 1 yhaJ Probable HTH-type transcriptional regulator YhaJ Escherichia coli (strain K12)
P67661 0.000269 45 30 0 88 1 yhaJ HTH-type transcriptional regulator YhaJ Escherichia coli O157:H7
P25547 0.000342 45 23 4 196 3 gbpR HTH-type transcriptional regulator GbpR Rhizobium radiobacter
P25545 0.00035 45 26 6 245 3 cbbR HTH-type transcriptional regulator CbbR Xanthobacter flavus
Q8VWE6 0.000375 45 22 4 247 3 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli O157:H7
P45349 0.000382 45 18 2 244 3 metR HTH-type transcriptional regulator MetR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1R4H3 0.000456 44 26 3 146 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain UTI89 / UPEC)
P59369 0.000456 44 26 3 146 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAV4 0.000456 44 26 3 146 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N260 0.000456 44 26 3 146 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O81 (strain ED1a)
B7MGH6 0.000456 44 26 3 146 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O45:K1 (strain S88 / ExPEC)
P12529 0.000486 44 26 2 133 1 ampR HTH-type transcriptional activator AmpR Citrobacter freundii
P36771 0.0005 44 22 4 247 1 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli (strain K12)
B7LUJ5 0.000822 43 26 3 146 3 hdfR HTH-type transcriptional regulator HdfR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P52660 0.000823 43 25 5 189 3 blaA HTH-type transcriptional regulator BlaA Proteus vulgaris
P03030 0.000849 44 22 2 243 3 lysR Transcriptional activator protein LysR Escherichia coli (strain K12)
P52044 0.001 43 22 6 249 3 ygfI Uncharacterized HTH-type transcriptional regulator YgfI Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS05020
Feature type CDS
Gene -
Product LysR family transcriptional regulator
Location 1068869 - 1069807 (strand: 1)
Length 939 (nucleotides) / 312 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_233
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Protein Sequence

MHNNKNRITLRAMAQFIAVAEELSFHRAAQKLNMSQPPLTNAIRKLEEDMNVVLIERNNRISGLTAAGKHFLYQARTVIKQAEAAVTSTQDLACGRTGFIRLGYVGSALYGRLPDIIQQFRLLHPGIRLELREATTAAQIDAIRNDELDISIIIPPLTSADDITQKPFDTDRLCIALPKAHPLNAHTDVTLSQLSDLPFILWPADEGRSFHLKVFQLCIRAGFVPVVAQEAHSMHAVLSLVAAGAGVSVVPQSMRGFYHDKIRYHALGGHEPEFALMLGFRELSPSGQAFVRIAENTDTLLSSIPNVIQEFE

Flanking regions ( +/- flanking 50bp)

ATGATATCTTTTATGTATCATCATCGGCTAATTCCCCGGGTAAAAAGACAATGCATAACAATAAAAACCGGATTACCTTACGTGCAATGGCGCAATTTATTGCCGTTGCCGAAGAGCTTAGTTTTCATCGCGCAGCACAAAAATTAAATATGTCCCAGCCTCCGCTGACGAATGCTATCCGTAAGCTGGAAGAGGATATGAATGTTGTTTTAATTGAACGTAACAACCGGATATCCGGTTTAACTGCTGCGGGAAAACACTTTTTATATCAGGCGCGTACCGTTATAAAACAGGCAGAAGCGGCAGTTACATCAACGCAGGATCTCGCCTGCGGACGCACCGGGTTTATCCGGCTGGGCTATGTGGGCAGTGCGCTTTACGGGCGGCTACCGGATATCATTCAGCAATTCAGATTATTGCATCCGGGGATCCGCCTGGAATTGCGGGAAGCCACAACGGCGGCGCAAATTGATGCCATACGCAATGATGAGTTAGATATCAGTATTATTATTCCTCCACTGACAAGTGCGGATGATATAACGCAAAAACCGTTTGATACTGACCGGTTATGTATCGCCTTACCCAAAGCGCATCCGTTAAATGCGCACACAGACGTGACATTGAGCCAACTCTCTGATTTACCCTTTATACTCTGGCCGGCCGATGAGGGGCGCAGCTTTCATCTGAAAGTGTTTCAGCTTTGTATCCGGGCGGGGTTTGTTCCTGTGGTTGCCCAGGAGGCTCACAGCATGCATGCCGTGCTTTCACTGGTTGCCGCAGGTGCGGGGGTTTCTGTTGTGCCACAGAGTATGCGCGGCTTTTATCATGATAAAATACGTTATCATGCGTTGGGCGGGCATGAGCCTGAATTCGCATTAATGCTGGGATTTCGTGAACTATCGCCATCCGGGCAGGCATTTGTCCGTATTGCAGAAAATACGGACACATTGCTTTCATCTATACCCAACGTCATTCAAGAGTTTGAATGAGTAAGGGTATATTTTGATTTGAAATTTTACTTCTGCTCTGCCGTGGCTTT