Homologs in group_2549

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02535 FBDBKF_02535 89.9 Morganella morganii S1 fepD ABC-type Fe3+-siderophore transport system, permease component
EHELCC_03005 EHELCC_03005 89.9 Morganella morganii S2 fepD ABC-type Fe3+-siderophore transport system, permease component
NLDBIP_00455 NLDBIP_00455 89.9 Morganella morganii S4 fepD ABC-type Fe3+-siderophore transport system, permease component
LHKJJB_01580 LHKJJB_01580 89.9 Morganella morganii S3 fepD ABC-type Fe3+-siderophore transport system, permease component
HKOGLL_01620 HKOGLL_01620 89.9 Morganella morganii S5 fepD ABC-type Fe3+-siderophore transport system, permease component

Distribution of the homologs in the orthogroup group_2549

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2549

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O34451 1.33e-45 161 35 5 293 3 yvrB Uncharacterized ABC transporter permease protein YvrB Bacillus subtilis (strain 168)
Q56992 2.18e-44 157 35 6 293 1 hmuU Hemin transport system permease protein HmuU Yersinia pestis
O34832 1.34e-43 155 34 5 323 3 yfmE Fe(3+)-citrate import system permease protein YfmE Bacillus subtilis (strain 168)
P40411 1.53e-41 150 32 6 327 1 feuC Iron-uptake system permease protein FeuC Bacillus subtilis (strain 168)
Q57552 3.99e-41 149 29 7 337 3 MJ0087 Putative ABC transporter permease protein MJ0087 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q7MLE7 2.13e-38 142 36 4 281 3 btuC Vitamin B12 import system permease protein BtuC Vibrio vulnificus (strain YJ016)
O31569 3.76e-38 141 34 5 323 1 yfhA Probable siderophore transport system permease protein YfhA Bacillus subtilis (strain 168)
Q8D927 4.22e-38 141 36 4 282 3 btuC Vitamin B12 import system permease protein BtuC Vibrio vulnificus (strain CMCP6)
A6TAH6 6.56e-38 140 35 5 305 3 btuC Vitamin B12 import system permease protein BtuC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8GDR2 2.31e-37 139 31 5 316 3 btuC Vitamin B12 import system permease protein BtuC Serratia proteamaculans (strain 568)
P15029 5.26e-37 137 33 4 296 1 fecD Fe(3+) dicitrate transport system permease protein FecD Escherichia coli (strain K12)
Q81L64 1.07e-36 142 32 4 303 1 fpuB Petrobactin import system permease protein FpuB Bacillus anthracis
Q81L64 4.59e-19 91 31 11 306 1 fpuB Petrobactin import system permease protein FpuB Bacillus anthracis
B4T4N5 2.72e-36 136 35 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella newport (strain SL254)
B5RAW6 2.72e-36 136 35 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QVW1 2.72e-36 136 35 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella enteritidis PT4 (strain P125109)
B5BA35 2.75e-36 136 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi A (strain AKU_12601)
Q5PH87 2.75e-36 136 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z6I5 3.15e-36 136 35 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella typhi
Q8ZPS8 4.58e-36 135 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TUF7 4.58e-36 135 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella schwarzengrund (strain CVM19633)
A9N235 4.58e-36 135 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TGH8 4.58e-36 135 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella heidelberg (strain SL476)
B5FJA1 4.58e-36 135 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella dublin (strain CT_02021853)
B5F7F5 4.58e-36 135 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella agona (strain SL483)
A9MFB6 6.02e-36 135 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q57PU6 1.28e-35 134 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella choleraesuis (strain SC-B67)
Q6LQ76 1.7e-34 131 33 6 316 3 btuC Vitamin B12 import system permease protein BtuC Photobacterium profundum (strain SS9)
A8AHA4 5.28e-34 130 34 6 314 3 btuC Vitamin B12 import system permease protein BtuC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P49937 5.9e-34 130 31 6 328 3 fhuG Iron(3+)-hydroxamate import system permease protein FhuG Bacillus subtilis (strain 168)
B1JJ25 6.62e-34 130 32 8 325 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669Z9 6.62e-34 130 32 8 325 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype I (strain IP32953)
A9R099 6.62e-34 130 32 8 325 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pestis bv. Antiqua (strain Angola)
Q8ZDX4 6.62e-34 130 32 8 325 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pestis
B2K660 6.62e-34 130 32 8 325 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FHG9 6.62e-34 130 32 8 325 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q57130 9.71e-34 129 32 8 328 1 molB Molybdate import system permease protein MolB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87Q39 1.88e-33 129 35 4 257 3 btuC Vitamin B12 import system permease protein BtuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1JPQ9 2.86e-33 128 33 8 314 3 btuC Vitamin B12 import system permease protein BtuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q3Z259 3.98e-33 127 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Shigella sonnei (strain Ss046)
Q32FI8 1.44e-32 126 33 6 310 3 btuC Vitamin B12 import system permease protein BtuC Shigella dysenteriae serotype 1 (strain Sd197)
Q6D656 6.18e-32 124 31 7 310 3 btuC Vitamin B12 import system permease protein BtuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O05731 1.65e-30 120 31 8 305 3 HP_0889 Probable iron chelatin transport system permease protein HP_0889 Helicobacter pylori (strain ATCC 700392 / 26695)
B7LQ78 2.6e-30 120 33 5 305 3 btuC Vitamin B12 import system permease protein BtuC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1IPL6 1e-29 119 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A0Q3 1e-29 119 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O9:H4 (strain HS)
B6I8R6 1.03e-29 118 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain SE11)
Q0T4S1 1.51e-29 118 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Shigella flexneri serotype 5b (strain 8401)
Q1RB84 1.68e-29 118 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain UTI89 / UPEC)
B1LE19 1.68e-29 118 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain SMS-3-5 / SECEC)
P06609 1.68e-29 118 34 6 310 1 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12)
A1ABP7 1.68e-29 118 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O1:K1 / APEC
B1XG18 1.68e-29 118 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12 / DH10B)
C4ZYH3 1.68e-29 118 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12 / MC4100 / BW2952)
B7NT65 1.68e-29 118 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MAS2 1.68e-29 118 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O45:K1 (strain S88 / ExPEC)
Q7C1M5 1.71e-29 118 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Shigella flexneri
O34933 1.89e-29 118 31 5 303 3 yfmD Fe(3+)-citrate import system permease protein YfmD Bacillus subtilis (strain 168)
B7L6I4 2.98e-29 117 33 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain 55989 / EAEC)
B7N549 3.17e-29 117 34 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7M1C0 3.27e-29 117 33 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O8 (strain IAI1)
A7ZMH9 3.27e-29 117 33 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q9HQ19 4.5e-29 117 36 5 277 1 btuC Cobalamin import system permease protein BtuC Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5G3 4.5e-29 117 36 5 277 3 btuC Cobalamin import system permease protein BtuC Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P49936 5.22e-29 117 32 6 300 3 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Bacillus subtilis (strain 168)
Q9ZKW2 6.06e-29 116 30 8 305 3 jhp_0822 Probable iron chelatin transport system permease protein jhp_0822 Helicobacter pylori (strain J99 / ATCC 700824)
B5YPZ9 1.08e-28 115 33 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X4L7 1.08e-28 115 33 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O157:H7
Q47085 1.08e-28 116 33 9 317 3 cbrB Achromobactin transport system permease protein CbrB Dickeya dadantii (strain 3937)
B2U360 1.73e-28 115 33 6 310 3 btuC Vitamin B12 import system permease protein BtuC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q9KSL2 6.07e-28 114 31 7 321 3 btuC Vitamin B12 import system permease protein BtuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B7MVJ0 6.75e-28 114 33 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O81 (strain ED1a)
Q0THB7 9.08e-28 113 33 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7US50 1.33e-27 113 33 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q8FH26 1.59e-27 112 33 6 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q2YX91 1.77e-27 112 33 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q321G8 4.52e-27 111 33 6 310 3 btuC Vitamin B12 import system permease protein BtuC Shigella boydii serotype 4 (strain Sb227)
Q7N3Q3 5.22e-27 111 33 6 309 3 btuC Vitamin B12 import system permease protein BtuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
O31568 1.62e-25 107 29 9 331 1 yfiZ Probable siderophore transport system permease protein YfiZ Bacillus subtilis (strain 168)
Q8NX64 1.12e-24 105 32 7 287 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MW2)
Q6GA81 1.12e-24 105 32 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MSSA476)
Q6GHV2 1.15e-24 105 32 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MRSA252)
Q7A651 1.15e-24 105 32 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain N315)
Q99UX0 1.15e-24 105 32 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QG35 1.15e-24 105 32 7 287 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Newman)
Q5HGV0 1.15e-24 105 32 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain COL)
Q2FHU7 1.15e-24 105 32 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain USA300)
A7X154 1.15e-24 105 32 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q47086 2.08e-24 104 35 6 302 3 cbrC Achromobactin transport system permease protein CbrC Dickeya dadantii (strain 3937)
P23876 4.47e-24 103 33 7 289 1 fepD Ferric enterobactin transport system permease protein FepD Escherichia coli (strain K12)
P15030 7.62e-24 102 27 5 297 1 fecC Fe(3+) dicitrate transport system permease protein FecC Escherichia coli (strain K12)
P23877 1.47e-23 102 35 8 287 1 fepG Ferric enterobactin transport system permease protein FepG Escherichia coli (strain K12)
P06972 4.16e-23 103 31 4 288 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Escherichia coli (strain K12)
P06972 5.07e-13 73 31 11 310 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Escherichia coli (strain K12)
P94418 9.99e-23 99 28 5 323 1 yclN Petrobactin import system permease protein YclN Bacillus subtilis (strain 168)
P40410 1.09e-22 99 27 6 300 1 feuB Iron-uptake system permease protein FeuB Bacillus subtilis (strain 168)
P37738 7.07e-22 97 29 4 279 1 fatD Ferric-anguibactin transport system permease protein FatD Vibrio anguillarum (strain ATCC 68554 / 775)
Q2FZE5 8.08e-22 97 32 8 287 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain NCTC 8325 / PS 47)
O87656 1.83e-21 98 31 4 282 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O87656 4.04e-15 79 31 8 287 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q81XB1 2.22e-14 76 26 10 282 1 fatD Petrobactin import system permease protein FatD Bacillus anthracis
Q58286 1.09e-13 74 24 7 308 3 MJ0876 Putative ABC transporter permease protein MJ0876 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P94419 1.66e-09 61 24 8 300 1 yclO Petrobactin import system permease protein YclO Bacillus subtilis (strain 168)
Q58287 2.66e-05 46 29 1 86 3 MJ0877 Putative ABC transporter permease protein MJ0877 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04960
Feature type CDS
Gene -
Product iron ABC transporter permease
Location 1057243 - 1058226 (strand: 1)
Length 984 (nucleotides) / 327 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2549
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01032 FecCD transport family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0609 Inorganic ion transport and metabolism (P) P ABC-type Fe3+-siderophore transport system, permease component

Protein Sequence

MKVVSLLFLLIITFIFSTCAGHTWESPVKVISALFYADDLTSRLLVEWRLPRVITAGFTGALLGLSGAIFQGVFRNPLAEPWLLGSSGGAAIGGTIALLVPLALPMAITLPLFAFSGALAAIFIVISVSRIAGSLDTATLLLTGVAVSAVLNAARSFMMMALSDESTSLQVVLSWILGGIQTPSPEGLFICLLLTASCILISVFILSDGLDLMGLDRTMAMSFGLSVERFTILALIAGSAIVAVAVSLGGIVGFIGLIAPHIARWQVGTRHKYVLPAAAVIGAALVMFSDALSRSLLPPGEIPLGLITAFIGGPFFIYLLAKRVRKI

Flanking regions ( +/- flanking 50bp)

GATGGTATTGAATACATGTCTGAACTATTTGAACAATGGAGCACAAAACAGTGAAGGTAGTCAGTCTGTTATTTCTGCTCATTATTACCTTTATTTTTTCCACCTGCGCCGGACATACATGGGAAAGCCCGGTTAAGGTCATCAGTGCATTATTTTATGCAGATGACCTGACATCCCGGCTATTAGTTGAGTGGCGTTTACCACGGGTGATTACCGCCGGGTTTACCGGCGCATTGCTGGGATTAAGCGGCGCTATATTCCAGGGAGTATTTCGTAACCCGCTGGCAGAGCCCTGGTTATTAGGTTCATCCGGTGGTGCGGCAATTGGCGGAACCATCGCATTATTAGTTCCGCTGGCATTACCGATGGCAATTACCCTGCCCTTATTTGCCTTCAGTGGCGCACTTGCAGCAATATTTATTGTTATCTCTGTTTCCCGGATAGCGGGCTCACTGGATACCGCCACATTATTATTAACCGGCGTTGCTGTCAGCGCGGTATTAAATGCCGCCCGTTCTTTTATGATGATGGCGTTATCTGATGAAAGCACCAGCCTTCAGGTTGTTCTCAGTTGGATCCTGGGTGGTATACAAACGCCTTCACCGGAAGGTTTATTTATCTGCCTGTTATTAACCGCATCCTGCATTCTGATTTCTGTCTTTATTTTATCTGACGGGCTGGATCTGATGGGACTCGACAGAACAATGGCGATGAGTTTTGGTTTATCCGTTGAGCGATTCACTATTTTAGCGTTAATTGCCGGGTCGGCTATTGTGGCTGTTGCGGTTTCACTCGGGGGAATTGTCGGGTTTATCGGGCTTATTGCGCCCCATATTGCCCGCTGGCAGGTCGGCACGCGTCATAAATATGTTTTACCGGCAGCCGCTGTTATTGGTGCGGCACTGGTTATGTTCTCTGATGCACTGTCCCGCAGTTTACTGCCGCCCGGTGAAATACCGCTGGGGCTGATTACTGCCTTTATCGGCGGACCTTTCTTTATTTACTTACTGGCAAAGCGGGTGCGGAAAATATGATCACAGTAAAAAATCTGCATATTTGCAAACAGGGAAAAACGCTTCTCGCA