Homologs in group_2549

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_03005 EHELCC_03005 100.0 Morganella morganii S2 fepD ABC-type Fe3+-siderophore transport system, permease component
NLDBIP_00455 NLDBIP_00455 100.0 Morganella morganii S4 fepD ABC-type Fe3+-siderophore transport system, permease component
LHKJJB_01580 LHKJJB_01580 100.0 Morganella morganii S3 fepD ABC-type Fe3+-siderophore transport system, permease component
HKOGLL_01620 HKOGLL_01620 100.0 Morganella morganii S5 fepD ABC-type Fe3+-siderophore transport system, permease component
F4V73_RS04960 F4V73_RS04960 89.9 Morganella psychrotolerans - iron ABC transporter permease

Distribution of the homologs in the orthogroup group_2549

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2549

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q56992 2.08e-45 160 36 6 295 1 hmuU Hemin transport system permease protein HmuU Yersinia pestis
O34832 6e-44 156 36 5 329 3 yfmE Fe(3+)-citrate import system permease protein YfmE Bacillus subtilis (strain 168)
O34451 6.28e-44 157 36 6 294 3 yvrB Uncharacterized ABC transporter permease protein YvrB Bacillus subtilis (strain 168)
Q57552 1.6e-43 155 29 8 338 3 MJ0087 Putative ABC transporter permease protein MJ0087 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P40411 1.59e-40 147 32 6 327 1 feuC Iron-uptake system permease protein FeuC Bacillus subtilis (strain 168)
O31569 1.65e-39 145 35 7 319 1 yfhA Probable siderophore transport system permease protein YfhA Bacillus subtilis (strain 168)
A6TAH6 1.68e-39 144 36 5 304 3 btuC Vitamin B12 import system permease protein BtuC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P15029 6.38e-39 143 35 4 278 1 fecD Fe(3+) dicitrate transport system permease protein FecD Escherichia coli (strain K12)
A8GDR2 3e-38 141 32 4 310 3 btuC Vitamin B12 import system permease protein BtuC Serratia proteamaculans (strain 568)
A9MFB6 1.83e-37 139 35 6 311 3 btuC Vitamin B12 import system permease protein BtuC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5BA35 3.53e-37 138 34 6 312 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi A (strain AKU_12601)
Q5PH87 3.53e-37 138 34 6 312 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z6I5 3.72e-37 138 34 6 312 3 btuC Vitamin B12 import system permease protein BtuC Salmonella typhi
B4T4N5 4.21e-37 138 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella newport (strain SL254)
B5RAW6 4.21e-37 138 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QVW1 4.21e-37 138 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella enteritidis PT4 (strain P125109)
Q7MLE7 4.65e-37 138 35 4 281 3 btuC Vitamin B12 import system permease protein BtuC Vibrio vulnificus (strain YJ016)
Q8ZPS8 7.27e-37 137 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TUF7 7.27e-37 137 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella schwarzengrund (strain CVM19633)
A9N235 7.27e-37 137 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TGH8 7.27e-37 137 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella heidelberg (strain SL476)
B5FJA1 7.27e-37 137 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella dublin (strain CT_02021853)
B5F7F5 7.27e-37 137 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella agona (strain SL483)
Q8D927 1.24e-36 137 35 4 281 3 btuC Vitamin B12 import system permease protein BtuC Vibrio vulnificus (strain CMCP6)
Q57PU6 1.92e-36 136 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Salmonella choleraesuis (strain SC-B67)
A8AHA4 5.26e-36 135 33 5 316 3 btuC Vitamin B12 import system permease protein BtuC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6LQ76 7.35e-36 135 35 7 322 3 btuC Vitamin B12 import system permease protein BtuC Photobacterium profundum (strain SS9)
Q81L64 9.34e-36 140 35 8 304 1 fpuB Petrobactin import system permease protein FpuB Bacillus anthracis
Q81L64 1.5e-19 92 30 10 297 1 fpuB Petrobactin import system permease protein FpuB Bacillus anthracis
Q57130 2.65e-35 134 33 6 289 1 molB Molybdate import system permease protein MolB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B1JJ25 3.55e-35 133 32 9 322 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669Z9 3.55e-35 133 32 9 322 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype I (strain IP32953)
A9R099 3.55e-35 133 32 9 322 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pestis bv. Antiqua (strain Angola)
Q8ZDX4 3.55e-35 133 32 9 322 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pestis
B2K660 3.55e-35 133 32 9 322 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FHG9 3.55e-35 133 32 9 322 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q32FI8 1.18e-34 132 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z259 1.27e-34 132 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Shigella sonnei (strain Ss046)
P49937 2.39e-34 131 33 6 326 3 fhuG Iron(3+)-hydroxamate import system permease protein FhuG Bacillus subtilis (strain 168)
A1JPQ9 9.83e-34 129 32 7 307 3 btuC Vitamin B12 import system permease protein BtuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
O05731 1.92e-33 128 33 9 306 3 HP_0889 Probable iron chelatin transport system permease protein HP_0889 Helicobacter pylori (strain ATCC 700392 / 26695)
Q87Q39 2.31e-32 125 35 5 259 3 btuC Vitamin B12 import system permease protein BtuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B7LQ78 8.84e-32 124 33 5 304 3 btuC Vitamin B12 import system permease protein BtuC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q9ZKW2 1.51e-31 123 33 9 306 3 jhp_0822 Probable iron chelatin transport system permease protein jhp_0822 Helicobacter pylori (strain J99 / ATCC 700824)
Q6D656 2.28e-31 123 32 7 310 3 btuC Vitamin B12 import system permease protein BtuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1IPL6 2.94e-31 122 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A0Q3 2.94e-31 122 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O9:H4 (strain HS)
Q0T4S1 3.22e-31 122 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Shigella flexneri serotype 5b (strain 8401)
B6I8R6 3.84e-31 122 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain SE11)
Q7C1M5 4.13e-31 122 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Shigella flexneri
B7N549 5.35e-31 122 33 4 307 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q1RB84 5.81e-31 122 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain UTI89 / UPEC)
B1LE19 5.81e-31 122 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain SMS-3-5 / SECEC)
P06609 5.81e-31 122 34 5 310 1 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12)
A1ABP7 5.81e-31 122 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O1:K1 / APEC
B1XG18 5.81e-31 122 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12 / DH10B)
C4ZYH3 5.81e-31 122 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12 / MC4100 / BW2952)
B7NT65 5.81e-31 122 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MAS2 5.81e-31 122 34 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O45:K1 (strain S88 / ExPEC)
B7M1C0 8.87e-31 121 33 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O8 (strain IAI1)
A7ZMH9 8.87e-31 121 33 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O139:H28 (strain E24377A / ETEC)
B7L6I4 1.03e-30 121 33 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain 55989 / EAEC)
Q9HQ19 2.83e-30 121 37 5 276 1 btuC Cobalamin import system permease protein BtuC Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5G3 2.83e-30 121 37 5 276 3 btuC Cobalamin import system permease protein BtuC Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P49936 2.96e-30 121 33 9 305 3 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Bacillus subtilis (strain 168)
B2U360 3.88e-30 119 33 5 310 3 btuC Vitamin B12 import system permease protein BtuC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YPZ9 4.39e-30 119 33 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X4L7 4.39e-30 119 33 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O157:H7
B7MVJ0 1.5e-29 118 33 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O81 (strain ED1a)
Q47085 1.95e-29 118 33 7 322 3 cbrB Achromobactin transport system permease protein CbrB Dickeya dadantii (strain 3937)
O34933 2.39e-29 117 32 4 290 3 yfmD Fe(3+)-citrate import system permease protein YfmD Bacillus subtilis (strain 168)
Q0THB7 2.5e-29 117 33 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7US50 3.7e-29 117 33 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q8FH26 4.69e-29 117 33 5 310 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q321G8 9.72e-29 116 33 5 310 3 btuC Vitamin B12 import system permease protein BtuC Shigella boydii serotype 4 (strain Sb227)
Q9KSL2 3.19e-28 114 33 6 305 3 btuC Vitamin B12 import system permease protein BtuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7N3Q3 6.02e-27 111 34 8 311 3 btuC Vitamin B12 import system permease protein BtuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2YX91 1.78e-26 110 33 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain bovine RF122 / ET3-1)
P23876 3.05e-26 109 34 6 299 1 fepD Ferric enterobactin transport system permease protein FepD Escherichia coli (strain K12)
O31568 3.78e-25 106 31 11 335 1 yfiZ Probable siderophore transport system permease protein YfiZ Bacillus subtilis (strain 168)
P15030 2.08e-24 104 30 6 291 1 fecC Fe(3+) dicitrate transport system permease protein FecC Escherichia coli (strain K12)
P06972 3.34e-24 106 32 4 282 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Escherichia coli (strain K12)
P06972 3.8e-14 76 33 10 303 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Escherichia coli (strain K12)
Q8NX64 4.36e-24 103 33 7 287 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MW2)
Q6GA81 4.36e-24 103 33 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MSSA476)
Q6GHV2 4.77e-24 103 33 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MRSA252)
Q7A651 4.77e-24 103 33 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain N315)
Q99UX0 4.77e-24 103 33 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QG35 4.77e-24 103 33 7 287 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Newman)
Q5HGV0 4.77e-24 103 33 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain COL)
Q2FHU7 4.77e-24 103 33 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain USA300)
A7X154 4.77e-24 103 33 7 287 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Mu3 / ATCC 700698)
O87656 6.58e-24 105 31 3 281 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O87656 2.28e-15 80 32 10 288 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23877 1.33e-23 102 35 9 293 1 fepG Ferric enterobactin transport system permease protein FepG Escherichia coli (strain K12)
Q47086 3.47e-23 101 35 6 307 3 cbrC Achromobactin transport system permease protein CbrC Dickeya dadantii (strain 3937)
P37738 7.23e-23 99 30 4 276 1 fatD Ferric-anguibactin transport system permease protein FatD Vibrio anguillarum (strain ATCC 68554 / 775)
P40410 3.58e-22 98 26 5 299 1 feuB Iron-uptake system permease protein FeuB Bacillus subtilis (strain 168)
Q2FZE5 3.05e-21 95 32 8 287 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain NCTC 8325 / PS 47)
P94418 8.94e-21 94 27 5 326 1 yclN Petrobactin import system permease protein YclN Bacillus subtilis (strain 168)
Q81XB1 4.93e-14 75 26 9 279 1 fatD Petrobactin import system permease protein FatD Bacillus anthracis
Q58286 5.27e-13 72 24 8 313 3 MJ0876 Putative ABC transporter permease protein MJ0876 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P94419 2.65e-08 58 22 8 299 1 yclO Petrobactin import system permease protein YclO Bacillus subtilis (strain 168)
Q58287 4.36e-05 45 27 1 86 3 MJ0877 Putative ABC transporter permease protein MJ0877 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P37737 0.000467 45 25 11 290 1 fatC Ferric-anguibactin transport system permease protein FatC Vibrio anguillarum (strain ATCC 68554 / 775)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_02535
Feature type CDS
Gene fepD
Product ABC-type Fe3+-siderophore transport system, permease component
Location 205269 - 206252 (strand: 1)
Length 984 (nucleotides) / 327 (amino acids)

Contig

Accession contig_2
Length 292399 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2549
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01032 FecCD transport family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0609 Inorganic ion transport and metabolism (P) P ABC-type Fe3+-siderophore transport system, permease component

Protein Sequence

MKIVSLLLILFAAFIFSACAGHTWESPLKVVSALFYSDDLTSRLLTEWRLPRVITAGFTGALLGLSGAIFQGVFRNPLAEPWLLGSSGGAAIGGTVALLVPLGLPLAVSLPLFAFSGALAAIFIVLSVSRIAGSLDTATLLLTGVAVSAVLNAARSFMMMALSDESTSLQVVLSWILGGIQTPSGEGLIISLILTLAAILLSVYLLSDGLDLMGLDRTMAMSFGLSVERFTVLALIAGSAIVAIAVSLGGVVGFIGLIAPHIARWQVGARHKYVLPASAVIGAALVMFSDALSRSLLPPGEIPLGLITAFIGGPFFIYLLAKRVRKS

Flanking regions ( +/- flanking 50bp)

GATGGCATTGAATATATGTCTGACATCTTTGTGCAATGGAGCCTGAGACAGTGAAAATAGTCAGTCTGTTACTCATTCTCTTCGCTGCATTTATTTTCTCTGCCTGTGCGGGACATACATGGGAGAGTCCGCTGAAGGTGGTAAGCGCCCTGTTTTACAGTGATGATTTAACATCCCGCCTATTAACCGAATGGCGTTTACCGCGTGTGATTACCGCCGGATTTACCGGGGCATTACTGGGATTAAGCGGTGCCATTTTTCAGGGGGTATTCCGCAATCCTCTGGCAGAGCCGTGGTTATTAGGATCCTCCGGCGGGGCCGCGATCGGCGGAACAGTGGCATTATTAGTGCCGCTCGGCTTACCGCTGGCGGTATCGCTGCCCTTATTTGCCTTCAGCGGGGCACTGGCGGCGATATTTATTGTGTTATCCGTCTCCCGGATTGCGGGGTCACTGGATACCGCCACGCTGTTATTAACCGGGGTGGCGGTCAGTGCGGTATTAAATGCCGCCCGTTCGTTTATGATGATGGCATTATCCGATGAAAGTACCAGCCTCCAGGTGGTATTAAGCTGGATTCTGGGCGGAATACAAACTCCGTCCGGAGAAGGTCTGATCATCAGCCTGATATTAACCCTGGCCGCCATTTTATTATCCGTTTATCTGTTATCTGACGGGCTGGATTTAATGGGACTGGACAGAACAATGGCCATGAGTTTCGGTTTATCCGTTGAACGGTTTACCGTGCTGGCCTTAATTGCCGGGTCTGCCATTGTGGCGATTGCCGTTTCACTCGGCGGCGTTGTTGGTTTTATCGGGCTGATTGCTCCGCATATTGCCCGCTGGCAGGTCGGTGCCCGTCATAAATATGTACTGCCCGCCTCAGCTGTTATTGGTGCCGCACTGGTAATGTTCTCCGATGCATTATCGCGCAGCCTGCTGCCGCCGGGGGAAATACCGCTCGGGCTGATCACCGCCTTTATCGGCGGCCCTTTCTTTATTTATCTGCTGGCGAAACGGGTGAGAAAATCATGATCACAGTGAATAAACTGAACGTCCGTAAACAGGATAAAACAATACTGACG