Homologs in group_242

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02225 FBDBKF_02225 93.6 Morganella morganii S1 fadD long-chain-fatty-acid--CoA ligase FadD
EHELCC_02695 EHELCC_02695 93.6 Morganella morganii S2 fadD long-chain-fatty-acid--CoA ligase FadD
NLDBIP_00765 NLDBIP_00765 93.6 Morganella morganii S4 fadD long-chain-fatty-acid--CoA ligase FadD
LHKJJB_01270 LHKJJB_01270 93.6 Morganella morganii S3 fadD long-chain-fatty-acid--CoA ligase FadD
HKOGLL_01310 HKOGLL_01310 93.6 Morganella morganii S5 fadD long-chain-fatty-acid--CoA ligase FadD
PMI_RS05625 PMI_RS05625 83.8 Proteus mirabilis HI4320 fadD long-chain-fatty-acid--CoA ligase FadD
PMI_RS13090 PMI_RS13090 30.0 Proteus mirabilis HI4320 caiC crotonobetaine/carnitine-CoA ligase

Distribution of the homologs in the orthogroup group_242

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_242

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZES9 0.0 928 79 0 553 3 fadD Long-chain-fatty-acid--CoA ligase Yersinia pestis
P69451 0.0 895 75 0 560 1 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli (strain K12)
P69452 0.0 895 75 0 560 3 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XDR6 0.0 894 75 0 560 3 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli O157:H7
P63521 0.0 887 74 0 560 3 fadD Long-chain-fatty-acid--CoA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63522 0.0 887 74 0 560 3 fadD Long-chain-fatty-acid--CoA ligase Salmonella typhi
P46450 0.0 758 64 2 560 3 fadD Long-chain-fatty-acid--CoA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P94547 4.17e-120 369 39 9 558 3 lcfA Long-chain-fatty-acid--CoA ligase Bacillus subtilis (strain 168)
O07610 5.63e-105 328 37 8 529 2 lcfB Long-chain-fatty-acid--CoA ligase Bacillus subtilis (strain 168)
S5M744 2.15e-83 271 36 12 513 1 fcs Feruloyl-CoA synthase Streptomyces sp.
Q9EY88 2.15e-83 271 36 12 513 1 fcs Feruloyl-CoA synthase Amycolatopsis sp.
Q9S725 8.44e-71 240 30 15 537 1 4CL2 4-coumarate--CoA ligase 2 Arabidopsis thaliana
P41636 1.33e-68 234 30 14 533 2 4CL 4-coumarate--CoA ligase Pinus taeda
O31826 8.91e-68 232 29 12 544 3 yngI Putative acyl-CoA synthetase YngI Bacillus subtilis (strain 168)
I3PB37 4.45e-67 230 29 14 533 1 4CL1 4-coumarate:CoA ligase 1 Petunia hybrida
Q6ETN3 1.32e-66 229 30 14 548 1 4CL3 4-coumarate--CoA ligase 3 Oryza sativa subsp. japonica
O24145 2.13e-66 228 29 11 531 2 4CL1 4-coumarate--CoA ligase 1 Nicotiana tabacum
M4ISH0 2.22e-66 228 29 12 531 1 CCL1 4-coumarate--CoA ligase CCL1 Humulus lupulus
A0A2H5AIX5 4.65e-66 227 29 13 529 2 4CL1 4-coumarate-CoA ligase 1 Narcissus pseudonarcissus
M4IRL6 1.28e-63 221 29 14 549 2 CCL7 Probable CoA ligase CCL7 Humulus lupulus
Q499N5 1.41e-63 222 29 16 552 2 Acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Rattus norvegicus
Q4WR83 1.92e-63 221 29 17 557 2 sidI Acyl-CoA ligase sidI Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q8VCW8 2.07e-63 222 29 14 551 1 Acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Mus musculus
O24146 2.61e-63 219 29 13 531 1 4CL2 4-coumarate--CoA ligase 2 Nicotiana tabacum
Q9M0X9 3.78e-62 216 30 14 524 1 4CLL7 4-coumarate--CoA ligase-like 7 Arabidopsis thaliana
Q7XXL2 1.37e-61 215 29 14 543 2 4CLL9 4-coumarate--CoA ligase-like 9 Oryza sativa subsp. japonica
Q42524 2.62e-61 215 29 13 549 1 4CL1 4-coumarate--CoA ligase 1 Arabidopsis thaliana
P31685 4.39e-61 214 29 15 533 3 4CL2 4-coumarate--CoA ligase 2 Solanum tuberosum
P31684 4.58e-61 214 29 11 531 3 4CL1 4-coumarate--CoA ligase 1 Solanum tuberosum
Q84P24 8.38e-61 213 27 17 564 1 4CLL6 4-coumarate--CoA ligase-like 6 Arabidopsis thaliana
Q42982 9.97e-61 213 29 14 547 1 4CL2 4-coumarate--CoA ligase 2 Oryza sativa subsp. japonica
Q67W82 1.18e-60 213 29 16 550 1 4CL4 4-coumarate--CoA ligase 4 Oryza sativa subsp. japonica
Q9LU36 1.33e-60 213 29 13 518 1 4CL4 4-coumarate--CoA ligase 4 Arabidopsis thaliana
Q7WSH3 2.27e-60 212 31 13 554 3 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Comamonas testosteroni
Q4R4Z9 3.17e-60 213 28 16 554 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Macaca fascicularis
M4IQR7 8.93e-60 210 27 15 519 2 CCL5 Probable CoA ligase CCL5 Humulus lupulus
P0DX14 1.06e-59 209 31 13 525 1 scoC Fatty acid--[acyl-carrier-protein] ligase ScoC Streptomyces coeruleorubidus
Q0DV32 2.12e-59 209 30 12 508 2 4CLL1 4-coumarate--CoA ligase-like 1 Oryza sativa subsp. japonica
Q0S7V5 1.09e-58 207 29 14 534 1 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Rhodococcus jostii (strain RHA1)
P96575 1.7e-58 206 29 13 508 3 ydaB Putative acyl--CoA ligase YdaB Bacillus subtilis (strain 168)
Q6ZAC1 1.76e-58 207 29 12 518 1 4CL5 4-coumarate--CoA ligase 5 Oryza sativa subsp. japonica
P14912 5.11e-58 206 29 13 532 2 4CL1 4-coumarate--CoA ligase 1 Petroselinum crispum
Q96CM8 8.69e-58 206 28 15 550 1 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Homo sapiens
P14913 1.99e-57 204 29 13 532 2 4CL2 4-coumarate--CoA ligase 2 Petroselinum crispum
Q17QJ1 2.61e-57 205 28 11 549 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Bos taurus
Q84P25 4.15e-57 204 29 15 501 2 4CLL2 4-coumarate--CoA ligase-like 2 Arabidopsis thaliana
A0A2H5AIY4 1.03e-56 202 28 12 536 2 4CL2 4-coumarate-CoA ligase 2 Narcissus pseudonarcissus
A0A6B9HER0 1.04e-56 202 28 14 526 1 None Piperic acid--CoA ligase Piper nigrum
P9WQ37 1.56e-56 201 29 11 507 1 fadD13 Long-chain-fatty-acid--CoA ligase FadD13 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ36 1.56e-56 201 29 11 507 3 fadD13 Long-chain-fatty-acid--CoA ligase FadD13 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
M4IQS1 2.06e-56 201 26 16 568 2 CCL10 Probable CoA ligase CCL10 Humulus lupulus
Q5R9G9 2.28e-56 202 28 16 554 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Pongo abelii
Q0P4F7 2.42e-56 202 27 15 566 2 acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Danio rerio
C0SPB0 3.93e-56 200 27 8 515 3 ytcI Uncharacterized acyl--CoA ligase YtcI Bacillus subtilis (strain 168)
Q0K844 4.55e-56 199 29 16 553 2 sauT Sulfoacetate--CoA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q84P21 9.36e-56 199 27 18 551 1 4CLL5 Peroxisomal OPC-8:0-CoA ligase 1 Arabidopsis thaliana
Q10S72 2.38e-55 198 28 16 546 2 4CLL4 4-coumarate--CoA ligase-like 4 Oryza sativa subsp. japonica
Q84P23 1.16e-54 197 29 13 511 1 4CLL9 4-coumarate--CoA ligase-like 9 Arabidopsis thaliana
P17814 1.77e-54 196 28 16 545 1 4CL1 4-coumarate--CoA ligase 1 Oryza sativa subsp. japonica
Q9SMT7 2.49e-54 195 28 13 535 1 AAE3 Oxalate--CoA ligase Arabidopsis thaliana
Q9S777 2.94e-54 196 27 16 561 1 4CL3 4-coumarate--CoA ligase 3 Arabidopsis thaliana
Q54P78 1.26e-53 194 30 15 499 3 4cl2 Probable 4-coumarate--CoA ligase 2 Dictyostelium discoideum
C5D6U5 2.02e-53 192 28 13 507 3 menE 2-succinylbenzoate--CoA ligase Geobacillus sp. (strain WCH70)
O24540 2.46e-53 193 27 12 529 2 4CL 4-coumarate--CoA ligase Vanilla planifolia
Q54P79 3.09e-53 192 31 18 505 3 4cl3 Probable 4-coumarate--CoA ligase 3 Dictyostelium discoideum
Q54P77 3.98e-53 192 31 16 503 3 4cl1 Probable 4-coumarate--CoA ligase 1 Dictyostelium discoideum
Q3E6Y4 6.82e-53 192 26 12 552 2 4CLL3 4-coumarate--CoA ligase-like 3 Arabidopsis thaliana
B2KWI3 8.57e-53 192 27 16 571 2 SID4 Acyl-CoA ligase SID4 Ajellomyces capsulatus
Q8RU95 1.02e-52 192 27 14 568 2 4CLL6 4-coumarate--CoA ligase-like 6 Oryza sativa subsp. japonica
P0C5B6 1.19e-52 191 26 14 552 2 4CLL4 OPC-6:CoA ligase Arabidopsis thaliana
W3X8X8 1.63e-52 197 29 20 541 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
Q8GQN9 2.68e-52 189 28 14 554 1 bclA Benzoate--CoA ligase Thauera aromatica
A7Z809 2.95e-52 189 28 13 521 3 menE 2-succinylbenzoate--CoA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q0S4D9 4.83e-52 189 29 13 544 1 casG Steroid-24-oyl-CoA synthetase Rhodococcus jostii (strain RHA1)
M4IQQ7 7.36e-52 188 27 14 536 2 CCL9 Probable CoA ligase CCL9 Humulus lupulus
P31687 5.2e-51 187 28 15 542 2 None 4-coumarate--CoA ligase 2 Glycine max
A9VM74 7.03e-51 185 27 11 512 3 menE 2-succinylbenzoate--CoA ligase Bacillus mycoides (strain KBAB4)
B9J2F2 2.9e-50 183 28 13 512 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain Q1)
Q816I1 4.36e-50 182 28 13 512 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5KVX9 4.62e-50 182 29 13 518 3 menE 2-succinylbenzoate--CoA ligase Geobacillus kaustophilus (strain HTA426)
Q3UNX5 5.01e-50 184 27 13 542 1 Acsm3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Mus musculus
Q72YK9 5.3e-50 182 28 13 512 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
P08659 6.81e-50 184 28 19 556 1 None Luciferin 4-monooxygenase Photinus pyralis
B7HTW3 7.05e-50 182 28 13 512 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain AH187)
Q6NUN0 7.9e-50 184 28 14 529 1 ACSM5 Acyl-coenzyme A synthetase ACSM5, mitochondrial Homo sapiens
B7JDD6 1.31e-49 181 27 13 535 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain AH820)
Q84P26 1.91e-49 182 27 14 496 2 4CLL8 4-coumarate--CoA ligase-like 8 Arabidopsis thaliana
Q17577 1.96e-49 182 27 15 529 1 acs-7 Acyl-CoA synthetase 7 Caenorhabditis elegans
Q6SKG1 3.48e-49 182 27 12 538 2 Acsm3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Rattus norvegicus
Q6HC29 6.03e-49 179 27 13 535 3 menE 2-succinylbenzoate--CoA ligase Bacillus thuringiensis subsp. konkukian (strain 97-27)
A0RK73 1.17e-48 179 27 13 535 3 menE 2-succinylbenzoate--CoA ligase Bacillus thuringiensis (strain Al Hakam)
Q6YYZ2 1.4e-48 181 27 10 505 3 4CLL3 4-coumarate--CoA ligase-like 3 Oryza sativa subsp. japonica
P13129 2.51e-48 179 29 21 553 1 None Luciferin 4-monooxygenase Nipponoluciola cruciata
P38135 2.56e-48 179 28 19 545 1 fadK Medium-chain fatty-acid--CoA ligase Escherichia coli (strain K12)
C3LB87 2.97e-48 177 27 12 509 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PCK3 2.97e-48 177 27 12 509 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis (strain A0248)
Q27757 3.39e-48 179 27 18 566 2 None Luciferin 4-monooxygenase Photuris pensylvanica
Q7F1X5 3.63e-48 179 28 15 561 2 4CLL5 4-coumarate--CoA ligase-like 5 Oryza sativa subsp. japonica
Q81K97 3.72e-48 177 27 12 509 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis
Q8BGA8 4.35e-48 179 27 13 526 1 Acsm5 Acyl-coenzyme A synthetase ACSM5, mitochondrial Mus musculus
Q6AYT9 7.62e-48 178 28 16 529 2 Acsm5 Acyl-coenzyme A synthetase ACSM5, mitochondrial Rattus norvegicus
Q53FZ2 8.68e-48 178 27 13 534 1 ACSM3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Homo sapiens
Q5REV5 9.41e-48 178 27 10 519 2 ACSM3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Pongo abelii
Q632I5 9.74e-48 176 27 13 520 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ZK / E33L)
I3PB36 1.93e-47 177 26 13 546 1 CNL Trans-cinnamate:CoA ligase, peroxisomal Petunia hybrida
Q01158 2.07e-47 177 30 22 555 2 None Luciferin 4-monooxygenase Aquatica lateralis
Q53005 3.22e-47 176 27 11 520 1 hbaA 4-hydroxybenzoate--CoA/benzoate--CoA ligase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q65FT5 3.58e-47 174 27 15 518 3 menE 2-succinylbenzoate--CoA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P23971 2.93e-46 172 26 13 521 1 menE 2-succinylbenzoate--CoA ligase Bacillus subtilis (strain 168)
Q9LQ12 4.68e-46 173 27 19 565 1 4CLL1 4-coumarate--CoA ligase-like 1 Arabidopsis thaliana
P40871 3.17e-45 171 26 15 550 1 dhbE 2,3-dihydroxybenzoate-AMP ligase Bacillus subtilis (strain 168)
Q8ENZ7 2.34e-44 167 27 13 510 3 menE 2-succinylbenzoate--CoA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q08AH1 3.68e-44 168 26 13 568 1 ACSM1 Acyl-coenzyme A synthetase ACSM1, mitochondrial Homo sapiens
Q5P603 3.84e-44 167 33 8 363 1 iaaB Indoleacetate--CoA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q9AJS8 4.39e-44 167 25 12 524 1 hcl 3-hydroxybenzoate--CoA/4-hydroxybenzoate--CoA ligase Thauera aromatica
Q69RG7 6.03e-44 167 27 16 529 2 4CLL7 4-coumarate--CoA ligase-like 7 Oryza sativa subsp. japonica
P96843 1.1e-43 166 27 12 500 1 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9BEA2 1.14e-43 167 27 13 522 1 ACSM1 Acyl-coenzyme A synthetase ACSM1, mitochondrial Bos taurus
Q26304 4.1e-43 165 28 18 522 1 None Luciferin 4-monooxygenase Luciola mingrelica
O80658 4.28e-43 165 28 20 557 2 AEE4 Probable acyl-activating enzyme 4 Arabidopsis thaliana
B7UI83 1.28e-42 163 27 16 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q7TN78 1.66e-42 164 26 11 534 1 Acsm4 Acyl-coenzyme A synthetase ACSM4, mitochondrial Rattus norvegicus
B4EY25 2.76e-42 162 26 14 518 3 caiC Crotonobetaine/carnitine--CoA ligase Proteus mirabilis (strain HI4320)
A7GU88 4.23e-42 160 27 15 516 3 menE 2-succinylbenzoate--CoA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q68CK6 1.02e-41 161 24 14 562 1 ACSM2B Acyl-coenzyme A synthetase ACSM2B, mitochondrial Homo sapiens
B5BL55 1.12e-41 160 26 19 553 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi A (strain AKU_12601)
Q5PIL0 1.12e-41 160 26 19 553 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q3Z5X2 1.34e-41 160 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Shigella sonnei (strain Ss046)
A8ALR6 1.34e-41 160 25 13 506 3 caiC Crotonobetaine/carnitine--CoA ligase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B4TWR4 1.51e-41 160 26 18 551 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella schwarzengrund (strain CVM19633)
Q8GB18 1.58e-41 160 26 14 518 3 caiC Crotonobetaine/carnitine--CoA ligase Proteus sp. (strain LE138)
Q5SKN9 1.73e-41 160 27 19 556 1 TTHA0604 Long-chain-fatty-acid--CoA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q80W40 1.89e-41 160 25 9 534 2 Acsm4 Acyl-coenzyme A synthetase ACSM4, mitochondrial Mus musculus
P0C7M7 2.03e-41 160 25 10 517 1 ACSM4 Acyl-coenzyme A synthetase ACSM4, mitochondrial Homo sapiens
A8FGK6 2.18e-41 159 27 12 516 3 menE 2-succinylbenzoate--CoA ligase Bacillus pumilus (strain SAFR-032)
B7L4G0 2.22e-41 159 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli (strain 55989 / EAEC)
Q8Z9L4 2.76e-41 159 26 18 551 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella typhi
B5FHG5 2.93e-41 159 26 18 551 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella dublin (strain CT_02021853)
B7MNP4 2.99e-41 159 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O81 (strain ED1a)
A9MYJ6 3.11e-41 159 26 18 551 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B1LFX0 3.14e-41 159 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli (strain SMS-3-5 / SECEC)
A7ZVY7 3.4e-41 159 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O9:H4 (strain HS)
B7M0D4 3.4e-41 159 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O8 (strain IAI1)
B4T6J6 3.57e-41 159 26 15 506 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella newport (strain SL254)
Q83MG9 6.03e-41 158 26 14 498 3 caiC Crotonobetaine/carnitine--CoA ligase Shigella flexneri
B1IRD9 6.03e-41 158 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B6HYY8 7.07e-41 158 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli (strain SE11)
B5YYD1 7.21e-41 158 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA34 7.21e-41 158 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O157:H7
S3DB78 7.43e-41 159 26 16 549 1 gloD Acyl-CoA ligase gloD Glarea lozoyensis (strain ATCC 20868 / MF5171)
Q32K60 8.12e-41 158 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Shigella dysenteriae serotype 1 (strain Sd197)
A7ZHC8 8.44e-41 158 26 14 498 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NHE1 9.79e-41 157 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q08AH3 1.09e-40 158 24 14 562 1 ACSM2A Acyl-coenzyme A synthetase ACSM2A, mitochondrial Homo sapiens
Q1RGG1 1.15e-40 157 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli (strain UTI89 / UPEC)
A1A787 1.15e-40 157 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O1:K1 / APEC
A2QTE5 1.17e-40 158 25 15 531 3 epaB Phenylacetyl-CoA ligase epaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A9MQH7 1.24e-40 157 26 19 549 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7MAG0 1.4e-40 157 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O45:K1 (strain S88 / ExPEC)
P39062 1.83e-40 157 25 14 526 1 acsA Acetyl-coenzyme A synthetase Bacillus subtilis (strain 168)
A0A2I2F2N6 2.32e-40 160 27 17 526 1 cfoA Chalcone synthase cfoA Aspergillus candidus
Q57TJ0 2.38e-40 156 25 18 551 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella choleraesuis (strain SC-B67)
B5F750 2.5e-40 156 25 18 551 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella agona (strain SL483)
C8VTR6 2.72e-40 157 28 14 496 3 AN10074 Putative acyl-coenzyme A synthetase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C0Q4L3 2.73e-40 156 25 18 551 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi C (strain RKS4594)
Q8FLA5 3.14e-40 156 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLV2 3.14e-40 156 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7LWM8 3.3e-40 156 27 17 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q91VA0 3.36e-40 157 26 18 573 1 Acsm1 Acyl-coenzyme A synthetase ACSM1, mitochondrial Mus musculus
Q8ZRX4 3.94e-40 156 25 18 551 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TIH0 3.94e-40 156 25 18 551 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella heidelberg (strain SL476)
P31552 5.78e-40 155 27 15 500 1 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli (strain K12)
B1XBG2 5.78e-40 155 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli (strain K12 / DH10B)
C4ZPW3 5.78e-40 155 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli (strain K12 / MC4100 / BW2952)
Q8K0L3 5.89e-40 156 25 14 526 1 Acsm2 Acyl-coenzyme A synthetase ACSM2, mitochondrial Mus musculus
B5R1R0 6.32e-40 155 25 18 551 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella enteritidis PT4 (strain P125109)
O74976 7.51e-40 155 26 14 488 1 pcs60 Oxalate--CoA ligase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q3URE1 7.64e-40 156 25 16 556 1 Acsf3 Malonate--CoA ligase ACSF3, mitochondrial Mus musculus
Q838K1 7.79e-40 154 26 11 528 3 menE 2-succinylbenzoate--CoA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
B7N7R2 1.44e-39 154 27 15 500 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P80436 2.75e-39 154 27 19 544 1 trsA Triostin synthetase I Streptomyces triostinicus
A0A0A2J5U8 3.07e-39 152 31 8 354 3 cnsG Acyl-CoA ligase cnsG Penicillium expansum
Q8H151 3.41e-39 154 26 18 517 1 AAE13 Malonate--CoA ligase Arabidopsis thaliana
Q6GLK6 9.19e-39 153 26 17 557 2 acsf3 Malonate--CoA ligase ACSF3, mitochondrial Xenopus laevis
G3XMC0 1.02e-38 152 25 15 524 2 azaF Acyl-CoA ligase azaF Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
Q9HWG3 1.03e-38 152 25 14 533 1 pchD Pyochelin synthase PchD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
K0E2F3 1.71e-38 152 27 16 494 1 ecdI Fatty-acyl-AMP ligase ecdI Aspergillus rugulosus
Q5B7J0 1.79e-38 152 29 14 503 2 inpC Acyl-CoA ligase inpC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
M4IS90 5.26e-38 151 26 15 501 2 CCL8 Probable CoA ligase CCL8 Humulus lupulus
C5NN18 1.33e-37 150 28 19 520 3 ACTT5 Acyl-CoA synthetase ACTT5 Alternaria alternata
F4HUK6 1.71e-37 149 27 19 567 1 AAE1 Butanoate--CoA ligase AAE1 Arabidopsis thaliana
Q9LPK6 1.79e-37 149 26 21 567 2 AEE9 Probable acyl-activating enzyme 9 Arabidopsis thaliana
A0A0H2ZF83 2.38e-37 148 25 14 516 1 pchD Pyochelin synthase PchD Pseudomonas aeruginosa (strain UCBPP-PA14)
Q4G176 2.81e-37 149 25 13 554 1 ACSF3 Malonate--CoA ligase ACSF3, mitochondrial Homo sapiens
Q71YZ5 3.75e-37 146 26 15 533 3 menE 2-succinylbenzoate--CoA ligase Listeria monocytogenes serotype 4b (strain F2365)
A4YDR9 6.36e-37 147 26 18 555 1 Msed_0394 4-hydroxybutyrate--CoA ligase 2 Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q00594 8.96e-37 147 25 15 526 1 alkK Medium-chain-fatty-acid--CoA ligase Pseudomonas oleovorans
O70490 1.88e-36 146 25 19 572 2 Acsm2 Acyl-coenzyme A synthetase ACSM2, mitochondrial Rattus norvegicus
Q9LPK7 2.09e-36 146 26 19 558 2 AEE10 Probable acyl-activating enzyme 10 Arabidopsis thaliana
A0A0S6XHF8 2.23e-36 146 26 17 539 1 frbC Acyl-CoA ligase frbB Fungal sp. (strain No.11243)
Q84HC5 2.65e-36 145 26 20 569 1 ncsB2 2-hydroxy-7-methoxy-5-methyl-1-naphthoate--CoA ligase Streptomyces carzinostaticus
M4ISH2 2.71e-36 145 28 23 565 2 CCL11 Probable CoA ligase CCL11 Humulus lupulus
G3J455 4.54e-36 146 26 21 588 1 cm3C Acyl-CoA ligase cm3C Cordyceps militaris (strain CM01)
Q8GVF9 7.17e-36 145 26 14 540 3 4CLL8 Putative 4-coumarate--CoA ligase-like 8 Oryza sativa subsp. japonica
W7NDP3 9.16e-36 144 25 15 546 2 FVEG_12633 CoA ligase FVEG_12633 Gibberella moniliformis (strain M3125 / FGSC 7600)
Q336M7 1.29e-35 144 30 8 318 3 4CLL2 4-coumarate--CoA ligase-like 2 Oryza sativa subsp. japonica
A0A179HJB8 1.39e-35 140 31 12 351 2 lcsD Acyl-CoA ligase lcsD Purpureocillium lilacinum
F8J3D9 2.45e-35 144 25 13 512 1 tmlU Marinolic acid--CoA ligase Pseudoalteromonas sp. (strain SANK 73390)
A7MR36 3.46e-35 144 31 12 351 3 aas Bifunctional protein Aas Cronobacter sakazakii (strain ATCC BAA-894)
P0DX84 8.95e-35 141 25 14 508 1 dmdB 3-methylmercaptopropionyl-CoA ligase Ruegeria lacuscaerulensis (strain DSM 11314 / KCTC 2953 / ITI-1157)
A8AP56 1.02e-34 142 27 20 514 3 aas Bifunctional protein Aas Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
O06417 1.14e-34 141 32 7 289 1 fadD8 Medium/long-chain-fatty-acid--CoA ligase FadD8 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
M4IS88 1.38e-34 141 28 24 587 1 CCL3 Acetate--CoA ligase CCL3 Humulus lupulus
A6TDH2 1.5e-34 142 27 19 514 3 aas Bifunctional protein Aas Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P58730 2.02e-34 139 24 15 536 3 menE 2-succinylbenzoate--CoA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
M4IQQ5 2.87e-34 140 27 23 557 1 CCL4 2-methylpropanoate--CoA ligase CCL4 Humulus lupulus
A4WE11 3.69e-34 141 27 19 517 3 aas Bifunctional protein Aas Enterobacter sp. (strain 638)
Q9FFE9 4.04e-34 139 26 19 552 2 AAE6 Probable acyl-activating enzyme 6 Arabidopsis thaliana
Q9FFE6 5.33e-34 139 26 21 559 1 AAE5 Probable acyl-activating enzyme 5, peroxisomal Arabidopsis thaliana
B5XUP2 5.8e-34 140 27 19 514 3 aas Bifunctional protein Aas Klebsiella pneumoniae (strain 342)
P31686 1.01e-33 133 32 6 283 2 None 4-coumarate--CoA ligase 1 (Fragment) Glycine max
Q3YY21 1.27e-33 139 27 19 490 3 aas Bifunctional protein Aas Shigella sonnei (strain Ss046)
B6I6W1 1.27e-33 139 27 19 490 3 aas Bifunctional protein Aas Escherichia coli (strain SE11)
B7LF13 1.27e-33 139 27 19 490 3 aas Bifunctional protein Aas Escherichia coli (strain 55989 / EAEC)
B1IU08 1.3e-33 139 27 19 490 3 aas Bifunctional protein Aas Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A3X0 1.3e-33 139 27 19 490 3 aas Bifunctional protein Aas Escherichia coli O9:H4 (strain HS)
B5Z4F4 1.3e-33 139 27 19 490 3 aas Bifunctional protein Aas Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X6J8 1.3e-33 139 27 19 490 3 aas Bifunctional protein Aas Escherichia coli O157:H7
A7ZQU2 1.3e-33 139 27 19 490 3 aas Bifunctional protein Aas Escherichia coli O139:H28 (strain E24377A / ETEC)
B2TYQ5 1.4e-33 139 27 19 490 3 aas Bifunctional protein Aas Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7N768 1.48e-33 139 27 21 513 3 aas Bifunctional protein Aas Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q83JV7 1.84e-33 139 27 19 490 3 aas Bifunctional protein Aas Shigella flexneri
Q0T128 1.84e-33 139 27 19 490 3 aas Bifunctional protein Aas Shigella flexneri serotype 5b (strain 8401)
Q5LRT0 2.17e-33 137 24 12 524 1 dmdB 3-methylmercaptopropionyl-CoA ligase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q8FEA6 2.36e-33 138 27 19 490 3 aas Bifunctional protein Aas Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UHQ4 2.36e-33 138 27 19 490 3 aas Bifunctional protein Aas Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7NVY2 2.41e-33 138 27 19 490 3 aas Bifunctional protein Aas Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5BFH6 2.43e-33 138 27 20 515 3 aas Bifunctional protein Aas Salmonella paratyphi A (strain AKU_12601)
Q5PEN7 2.43e-33 138 27 20 515 3 aas Bifunctional protein Aas Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P31119 2.54e-33 138 27 19 490 1 aas Bifunctional protein Aas Escherichia coli (strain K12)
B1XDP2 2.54e-33 138 27 19 490 3 aas Bifunctional protein Aas Escherichia coli (strain K12 / DH10B)
C4ZZY9 2.54e-33 138 27 19 490 3 aas Bifunctional protein Aas Escherichia coli (strain K12 / MC4100 / BW2952)
B7LNJ2 3.39e-33 138 27 20 513 3 aas Bifunctional protein Aas Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5FUB9 3.65e-33 138 27 20 515 3 aas Bifunctional protein Aas Salmonella dublin (strain CT_02021853)
Q92AY8 3.88e-33 135 25 15 540 3 menE 2-succinylbenzoate--CoA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B5F4V4 4.04e-33 138 27 20 515 3 aas Bifunctional protein Aas Salmonella agona (strain SL483)
B1LR34 7.91e-33 137 27 19 490 3 aas Bifunctional protein Aas Escherichia coli (strain SMS-3-5 / SECEC)
Q1R7H5 8.28e-33 137 27 19 490 3 aas Bifunctional protein Aas Escherichia coli (strain UTI89 / UPEC)
A1AF47 8.28e-33 137 27 19 490 3 aas Bifunctional protein Aas Escherichia coli O1:K1 / APEC
B7MLI2 8.28e-33 137 27 19 490 3 aas Bifunctional protein Aas Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8Z406 1.2e-32 136 26 20 515 3 aas Bifunctional protein Aas Salmonella typhi
B4TGR5 1.41e-32 136 26 20 515 3 aas Bifunctional protein Aas Salmonella heidelberg (strain SL476)
B5QWU2 1.41e-32 136 26 20 515 3 aas Bifunctional protein Aas Salmonella enteritidis PT4 (strain P125109)
Q58DN7 1.45e-32 135 25 19 560 2 ACSF3 Malonate--CoA ligase ACSF3, mitochondrial Bos taurus
B5RDY6 1.46e-32 136 26 20 515 3 aas Bifunctional protein Aas Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9N3H8 1.48e-32 136 26 20 515 3 aas Bifunctional protein Aas Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q0T8F7 1.55e-32 134 26 14 477 3 caiC Crotonobetaine/carnitine--CoA ligase Shigella flexneri serotype 5b (strain 8401)
B4TUM9 1.56e-32 136 26 21 515 3 aas Bifunctional protein Aas Salmonella schwarzengrund (strain CVM19633)
A0A3G1DJF8 1.71e-32 134 24 13 499 3 M9 Acyl-CoA ligase M9 Phoma sp. (strain ATCC 20986 / MF5453)
P38137 1.88e-32 134 26 19 524 1 PCS60 Oxalate--CoA ligase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C6DE43 1.97e-32 135 27 19 511 3 aas Bifunctional protein Aas Pectobacterium carotovorum subsp. carotovorum (strain PC1)
C0PXJ8 2.02e-32 135 26 20 515 3 aas Bifunctional protein Aas Salmonella paratyphi C (strain RKS4594)
Q57KA7 2.02e-32 135 26 20 515 3 aas Bifunctional protein Aas Salmonella choleraesuis (strain SC-B67)
Q8ZMA4 2.59e-32 135 27 20 514 3 aas Bifunctional protein Aas Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6D107 2.88e-32 135 31 15 378 3 aas Bifunctional protein Aas Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1IAK8 3.02e-32 134 26 19 537 1 pmsE Pseudomonine synthase PmsE Pseudomonas entomophila (strain L48)
Q9SS00 3.08e-32 134 27 23 572 2 AAE12 Probable acyl-activating enzyme 12, peroxisomal Arabidopsis thaliana
B4T503 3.08e-32 135 27 20 514 3 aas Bifunctional protein Aas Salmonella newport (strain SL254)
Q5BA81 4.26e-32 134 25 22 592 3 easD Acyl-CoA ligase easD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q0TDZ6 4.66e-32 134 27 19 490 3 aas Bifunctional protein Aas Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A0R4Q2 4.95e-32 133 26 18 552 3 fadD19 Medium/long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
O07899 7.73e-32 132 23 11 554 3 vibE Vibriobactin-specific 2,3-dihydroxybenzoate-AMP ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9SS01 8.08e-32 133 26 19 569 1 AAE20 Benzoate--CoA ligase, peroxisomal Arabidopsis thaliana
P40806 8.11e-32 135 23 15 563 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 2.18e-24 112 27 15 402 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
B2VFS7 1.06e-31 133 31 11 354 3 aas Bifunctional protein Aas Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P9WQ51 1.58e-31 132 26 20 571 1 fadD19 Medium/long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ50 1.58e-31 132 26 20 571 3 fadD19 Medium/long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TWB7 1.58e-31 132 26 20 571 3 fadD19 Medium/long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9L9F6 1.77e-31 131 28 11 363 1 novL 8-demethylnovobiocic acid synthase Streptomyces niveus
P9WEQ8 1.79e-31 131 25 18 533 3 olcI Nicotinic acid-CoA ligase olcI Penicillium canescens
Q9CHK3 1.97e-31 130 26 14 429 3 menE 2-succinylbenzoate--CoA ligase Lactococcus lactis subsp. lactis (strain IL1403)
Q5HNB2 3.07e-31 130 24 16 510 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9C8D4 3.16e-31 131 25 19 566 1 AAE11 Butyrate--CoA ligase AAE11, peroxisomal Arabidopsis thaliana
Q8CS21 7.76e-31 129 23 16 513 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
K3VAW3 1.04e-30 129 25 19 540 3 FPSE_09184 Acyl-CoA ligase FPSE_09184 Fusarium pseudograminearum (strain CS3096)
O30409 1.53e-30 131 25 12 540 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 6.59e-27 120 23 13 551 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 2.26e-24 112 23 15 532 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 7.02e-24 110 22 14 542 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 9.23e-21 100 27 11 373 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 6.88e-19 95 23 14 553 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 5.06e-05 50 26 2 105 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
A0A345BJN3 1.72e-30 125 38 4 178 1 clz12 Acyl-CoA ligase clz12 Cochliobolus lunatus
Q7BQ71 1.79e-30 128 25 19 559 1 zmaJ Zwittermicin A synthase ZmaJ Bacillus cereus
Q6GFR0 2.91e-30 127 25 18 515 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MRSA252)
P27206 3.69e-30 130 23 13 539 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
P27206 5.79e-26 117 23 14 547 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
P27206 1.92e-21 103 22 13 541 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
P71716 4.77e-30 127 25 16 560 1 mbtA Salicyl-AMP ligase / salicyl-S-ArCP synthetase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9R9I9 5.6e-30 129 24 14 544 3 mycC Mycosubtilin synthase subunit C Bacillus subtilis
Q9R9I9 8.31e-23 107 23 18 560 3 mycC Mycosubtilin synthase subunit C Bacillus subtilis
O93730 6.89e-30 128 26 18 533 3 acsA Acetyl-coenzyme A synthetase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
B2HKM1 8.38e-30 126 28 12 381 1 mmaC Fatty acid--[acyl-carrier-protein] ligase MmaC Mycobacterium marinum (strain ATCC BAA-535 / M)
Q70LM7 8.53e-30 129 24 13 533 1 lgrA Linear gramicidin synthase subunit A Brevibacillus parabrevis
Q70LM7 9.65e-22 103 23 15 542 1 lgrA Linear gramicidin synthase subunit A Brevibacillus parabrevis
P63526 1.17e-29 125 25 19 522 1 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain N315)
P63525 1.17e-29 125 25 19 522 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ITW2 1.17e-29 125 25 19 522 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain JH9)
A6U2Q7 1.17e-29 125 25 19 522 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain JH1)
A7X3P0 1.17e-29 125 25 19 522 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YTP0 1.38e-29 125 24 16 516 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q08787 1.4e-29 128 24 15 540 1 srfAC Surfactin synthase subunit 3 Bacillus subtilis (strain 168)
Q9JID6 1.68e-29 127 27 20 517 2 ACSL1 Long-chain-fatty-acid--CoA ligase 1 Cavia porcellus
P10378 2.21e-29 125 24 22 533 1 entE Enterobactin synthase component E Escherichia coli (strain K12)
Q8J2R0 2.59e-29 125 24 18 570 3 FUM10 Acyl-CoA synthetase FUM10 Gibberella moniliformis (strain M3125 / FGSC 7600)
P41216 2.75e-29 126 28 22 520 1 Acsl1 Long-chain-fatty-acid--CoA ligase 1 Mus musculus
Q9R9J1 2.76e-29 127 25 15 541 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
Q9R9J1 1.11e-27 122 24 23 556 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
P9WQ55 3.12e-29 125 26 15 474 1 fadD10 Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase FadD10 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ54 3.12e-29 125 26 15 474 3 fadD10 Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase FadD10 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8NVZ4 3.22e-29 124 27 12 348 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MW2)
Q6G8D6 3.22e-29 124 27 12 348 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MSSA476)
A4YDT1 3.44e-29 125 28 13 519 1 Msed_0406 4-hydroxybutyrate--CoA ligase 1 Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q70LM4 3.48e-29 127 23 14 518 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 1.1e-25 116 22 14 556 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 1.28e-21 103 22 17 555 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 6.4e-20 98 23 15 552 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q4KCY5 3.98e-29 124 25 13 541 1 pltF L-proline--[L-prolyl-carrier protein] ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B2HI05 4.18e-29 124 24 19 567 3 fadD19 Medium/long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase Mycobacterium marinum (strain ATCC BAA-535 / M)
D9XF47 4.38e-29 126 25 20 576 1 phsC Phosphinothricin tripeptide synthase PhsC Streptomyces viridochromogenes (strain DSM 40736 / JCM 4977 / BCRC 1201 / Tue 494)
P0DUV3 4.43e-29 127 25 17 526 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 5.89e-21 101 23 21 547 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 2.92e-19 96 22 17 549 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 3.76e-19 95 23 16 544 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 3.02e-16 86 28 13 370 1 mpcA Malpicyclin synthetase Mortierella alpina
Q70LM6 4.48e-29 127 24 13 533 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 2.27e-21 102 24 17 524 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 2.68e-21 102 22 16 546 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 1.03e-18 94 22 16 556 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q9LQS1 4.9e-29 124 25 22 560 2 AAE8 Probable acyl-activating enzyme 8 Arabidopsis thaliana
Q8XBV3 5.8e-29 124 24 23 533 3 entE Enterobactin synthase component E Escherichia coli O157:H7
O54154 6.45e-29 124 26 17 545 1 redM L-proline--[L-prolyl-carrier protein] ligase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P33121 7.46e-29 125 27 18 485 1 ACSL1 Long-chain-fatty-acid--CoA ligase 1 Homo sapiens
P27095 8.24e-29 124 25 16 579 1 acsA Acetyl-coenzyme A synthetase Methanothrix soehngenii
O31782 9e-29 125 25 14 551 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
P18163 9.38e-29 124 27 21 519 1 Acsl1 Long-chain-fatty-acid--CoA ligase 1 Rattus norvegicus
Q53634 1.14e-28 122 24 19 522 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus
A8Z4L9 1.14e-28 122 24 19 522 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain USA300 / TCH1516)
A6QHX6 1.14e-28 122 24 19 522 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Newman)
Q5HEY2 1.14e-28 122 24 19 522 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain COL)
Q2G2V3 1.14e-28 122 24 19 522 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FFU9 1.14e-28 122 24 19 522 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain USA300)
P9WQ61 1.19e-28 124 25 15 529 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ60 1.19e-28 124 25 15 529 3 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TXK7 1.19e-28 124 25 15 529 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0AFF1 1.43e-28 124 23 19 585 3 acsA Acetyl-coenzyme A synthetase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q82SI5 1.93e-28 123 24 16 578 3 acsA Acetyl-coenzyme A synthetase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B1JQC1 2.07e-28 123 26 21 512 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667F1 2.07e-28 123 26 21 512 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JZ75 2.07e-28 123 26 21 512 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FFD1 2.07e-28 123 26 21 512 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
M4IS92 2.33e-28 122 25 19 563 2 CCL13 Probable CoA ligase CCL13 Humulus lupulus
Q6E7K9 2.57e-28 122 25 25 579 1 jamA Medium-chain-fatty-acid--[acyl-carrier-protein] ligase JamA Moorena producens (strain JHB)
Q7X279 2.69e-28 122 25 18 548 1 sdgA Salicylyl-CoA synthase / salicylate adenylyltransferase Streptomyces sp.
Q7TYX8 2.81e-28 122 26 14 471 3 fadD15 Long-chain-fatty-acid--CoA ligase FadD15 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A1JPF0 3.03e-28 123 26 18 493 3 aas Bifunctional protein Aas Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A4TLD3 3.06e-28 123 26 21 512 3 aas Bifunctional protein Aas Yersinia pestis (strain Pestoides F)
A9R2S1 3.06e-28 123 26 21 512 3 aas Bifunctional protein Aas Yersinia pestis bv. Antiqua (strain Angola)
P9WQ45 3.62e-28 122 26 21 521 1 fadD25 Putative fatty-acid--CoA ligase fadD25 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ44 3.62e-28 122 26 21 521 3 fadD25 Putative fatty-acid--CoA ligase fadD25 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O30408 7.21e-28 123 22 12 541 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
O30408 1.04e-27 122 25 19 557 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
O30408 4.93e-27 120 23 16 561 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
P19409 1e-27 120 24 18 512 1 baiB Bile acid--coenzyme A ligase Clostridium scindens (strain JCM 10418 / VPI 12708)
Q9I4X3 1.47e-27 119 25 16 516 1 pqsA Anthranilate--CoA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O60135 1.7e-27 120 26 19 462 3 lcf1 Long-chain-fatty-acid--CoA ligase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
M4IRL4 1.72e-27 120 25 19 562 1 CCL2 Isovalerate--CoA ligase CCL2 Humulus lupulus
O93800 2.06e-27 120 24 21 593 4 AKT1 Acyl-CoA ligase AKT1 Alternaria alternata
Q74RZ6 2.34e-27 120 25 21 512 3 aas Bifunctional protein Aas Yersinia pestis
Q1CAS8 2.34e-27 120 25 21 512 3 aas Bifunctional protein Aas Yersinia pestis bv. Antiqua (strain Antiqua)
Q96VB5 2.45e-27 119 24 20 593 3 AFT1-1 Acyl-CoA ligase AFT1-1 Alternaria alternata
Q8VZF1 3.58e-27 119 25 17 584 1 AAE7 Acetate/butyrate--CoA ligase AAE7, peroxisomal Arabidopsis thaliana
Q04747 4.02e-27 120 24 14 550 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q04747 7.17e-26 117 24 15 563 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q04747 7.75e-22 104 22 13 541 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
O68007 4.18e-27 120 22 11 530 3 bacB Bacitracin synthase 2 Bacillus licheniformis
O68007 1.05e-22 107 23 19 564 3 bacB Bacitracin synthase 2 Bacillus licheniformis
O07619 5.04e-27 117 24 13 541 2 yhfT Uncharacterized acyl--CoA ligase YhfT Bacillus subtilis (strain 168)
A4G3L8 5.12e-27 119 25 21 585 3 acsA Acetyl-coenzyme A synthetase Herminiimonas arsenicoxydans
Q9SEY5 5.14e-27 119 25 20 582 1 AAE2 Isovalerate--CoA ligase AAE2 Arabidopsis thaliana
O53521 5.31e-27 119 26 14 471 1 fadD15 Long-chain-fatty-acid--CoA ligase FadD15 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q70LM5 6.31e-27 120 24 18 565 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 1.54e-26 119 23 15 543 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 1.84e-26 119 24 16 539 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 1.54e-25 115 23 16 551 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 1.49e-19 97 21 15 546 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 1.19e-18 94 23 20 571 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
P94459 1.15e-26 119 24 13 538 1 ppsD Plipastatin synthase subunit D Bacillus subtilis (strain 168)
P94459 2.47e-25 115 22 14 556 1 ppsD Plipastatin synthase subunit D Bacillus subtilis (strain 168)
P94459 8.91e-24 110 22 10 538 1 ppsD Plipastatin synthase subunit D Bacillus subtilis (strain 168)
A0R5G1 1.25e-26 118 25 17 537 3 acsA Acetyl-coenzyme A synthetase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0A3G9H9I5 1.34e-26 117 27 12 388 3 ALT10 Acyl-CoA synthetase ALT10 Alternaria alternata
C1AA44 1.46e-26 117 23 16 586 3 acsA Acetyl-coenzyme A synthetase Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
C1D6V9 1.52e-26 117 25 15 540 3 acsA Acetyl-coenzyme A synthetase Laribacter hongkongensis (strain HLHK9)
P09095 1.52e-26 118 22 16 562 1 tycA Tyrocidine synthase 1 Brevibacillus parabrevis
Q8DKH2 1.64e-26 117 26 18 548 3 acsA Acetyl-coenzyme A synthetase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8NJN3 2.13e-26 117 25 19 578 1 ACS2 Acetyl-coenzyme A synthetase 2 Candida albicans (strain SC5314 / ATCC MYA-2876)
E3UUE6 3.78e-26 115 25 21 553 1 fadD19 3-oxocholest-4-en-26-oate--CoA ligase Rhodococcus rhodochrous
O68008 4.06e-26 117 24 17 559 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 1.91e-25 115 22 10 539 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 3.51e-24 111 22 12 538 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 4.3e-23 108 22 19 558 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 2.52e-19 96 21 14 558 3 bacC Bacitracin synthase 3 Bacillus licheniformis
A1W1D6 4.48e-26 116 25 23 578 3 acsA Acetyl-coenzyme A synthetase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PMD2 4.48e-26 116 25 23 578 3 acsA Acetyl-coenzyme A synthetase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B2HIL6 4.56e-26 116 25 15 531 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium marinum (strain ATCC BAA-535 / M)
Q9L9G0 4.64e-26 115 25 18 562 1 novH Novobiocin biosynthesis protein H Streptomyces niveus
Q7NSY7 4.73e-26 116 25 20 551 3 acsA Acetyl-coenzyme A synthetase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7N7A9 5.35e-26 115 26 12 394 3 aas Bifunctional protein Aas Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9UKU0 5.4e-26 116 29 11 344 1 ACSL6 Long-chain-fatty-acid--CoA ligase 6 Homo sapiens
P39846 6.28e-26 117 22 15 549 1 ppsB Plipastatin synthase subunit B Bacillus subtilis (strain 168)
P39846 8.58e-25 113 25 18 536 1 ppsB Plipastatin synthase subunit B Bacillus subtilis (strain 168)
P0C064 8.7e-26 116 23 14 539 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 5.79e-25 114 23 14 547 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 4.72e-22 105 23 17 538 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 8.75e-20 97 22 15 555 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
A0B8F1 9.61e-26 115 22 17 581 1 acsA Acetyl-coenzyme A synthetase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q9C7W4 9.96e-26 115 25 13 463 2 LACS3 Long chain acyl-CoA synthetase 3 Arabidopsis thaliana
A0R618 1.07e-25 115 23 21 606 1 fadD32 Long-chain-fatty-acid--AMP ligase FadD32 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0A024F9J0 1.08e-25 114 28 15 367 3 vlmC AMP-dependent ligase vlmC Lecanicillium sp.
Q1AXQ5 1.09e-25 115 24 19 548 3 acsA Acetyl-coenzyme A synthetase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q973W5 1.2e-25 115 25 23 559 1 STK_07830 3-hydroxypropionyl-coenzyme A synthetase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q9CMW1 1.2e-25 115 25 20 564 3 acsA Acetyl-coenzyme A synthetase Pasteurella multocida (strain Pm70)
P0DUV4 1.31e-25 116 25 18 543 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 1.58e-24 112 24 18 556 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 6.24e-24 110 24 16 544 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 7.13e-24 110 24 17 543 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 9.81e-22 103 25 18 542 1 mpbA Malpibaldin synthetase Mortierella alpina
P9WQ62 1.51e-25 115 24 14 554 1 mbtB Phenyloxazoline synthase MbtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TYQ4 1.53e-25 115 24 14 554 3 mbtB Phenyloxazoline synthase MbtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A8FNJ7 1.61e-25 114 25 23 578 3 acsA Acetyl-coenzyme A synthetase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9VP61 1.76e-25 114 27 18 551 2 AcCoAS Acetyl-coenzyme A synthetase Drosophila melanogaster
P9WQ63 1.77e-25 115 24 14 554 1 mbtB Phenyloxazoline synthase MbtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B2HGV4 1.79e-25 114 26 17 469 3 fadD15 Long-chain-fatty-acid--CoA ligase FadD15 Mycobacterium marinum (strain ATCC BAA-535 / M)
P86832 1.86e-25 113 24 13 527 1 fcbA2 4-chlorobenzoate--CoA ligase Arthrobacter sp.
P86831 1.86e-25 113 24 13 527 1 fcbA1 4-chlorobenzoate--CoA ligase Arthrobacter sp.
B2JD61 2.17e-25 114 25 19 573 3 acsA Acetyl-coenzyme A synthetase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q9C9G2 2.22e-25 113 25 17 556 3 AEE22 Probable acyl-activating enzyme 22 Arabidopsis thaliana
P0C061 2.84e-25 114 23 17 545 1 grsA Gramicidin S synthase 1 Aneurinibacillus migulanus
B2HIM0 3.18e-25 113 26 25 532 3 fadD28 Long-chain-fatty-acid--AMP ligase FadD28 Mycobacterium marinum (strain ATCC BAA-535 / M)
Q9R9J0 3.48e-25 114 22 13 550 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 4.02e-25 114 23 12 563 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 7.65e-15 82 22 15 559 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 5.86e-14 79 21 21 554 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
P0C062 3.58e-25 114 23 17 545 1 grsA Gramicidin S synthase 1 Brevibacillus brevis
P0C063 3.95e-25 114 23 14 539 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 6.73e-25 114 23 14 547 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 5.06e-22 104 23 17 538 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 5.24e-18 92 22 17 560 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
Q01574 4.81e-25 113 25 19 555 1 ACS1 Acetyl-coenzyme A synthetase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P54200 5.51e-25 112 24 20 516 3 fadD21 Putative fatty-acid--CoA ligase fadD21 Mycobacterium leprae (strain TN)
Q8JZR0 5.8e-25 113 26 20 510 1 Acsl5 Long-chain-fatty-acid--CoA ligase 5 Mus musculus
P59871 6.51e-25 112 25 18 554 3 acsA Acetyl-coenzyme A synthetase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQD1 7.12e-25 112 25 18 554 1 acsA Acetyl-coenzyme A synthetase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD0 7.12e-25 112 25 18 554 3 acsA Acetyl-coenzyme A synthetase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B2U6V1 7.3e-25 112 26 26 616 3 acsA Acetyl-coenzyme A synthetase Ralstonia pickettii (strain 12J)
Q8XY11 1.03e-24 112 25 25 605 3 acsA Acetyl-coenzyme A synthetase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A8NS27 1.08e-24 112 23 15 518 1 CC1G_03009 Adenylate-forming reductase 03009 Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
A1WY97 1.09e-24 112 27 20 565 3 acsA Acetyl-coenzyme A synthetase Halorhodospira halophila (strain DSM 244 / SL1)
P9WQ47 1.35e-24 111 23 24 621 1 fadD23 Long-chain-fatty-acid--AMP ligase FadD23 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ46 1.35e-24 111 23 24 621 3 fadD23 Long-chain-fatty-acid--AMP ligase FadD23 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TVK7 1.35e-24 111 23 24 621 3 fadD23 Long-chain-fatty-acid--AMP ligase FadD23 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8LKS5 1.42e-24 112 25 19 521 1 LACS7 Long chain acyl-CoA synthetase 7, peroxisomal Arabidopsis thaliana
B8FIN2 1.72e-24 111 25 18 556 3 acsA Acetyl-coenzyme A synthetase Desulfatibacillum aliphaticivorans
Q6W4T3 1.98e-24 112 25 22 544 1 angR Anguibactin system regulator Vibrio anguillarum (strain ATCC 68554 / 775)
P0DJH0 2.05e-24 112 25 22 544 3 angR Anguibactin system regulator Vibrio anguillarum
Q2NR28 2.19e-24 111 24 14 572 3 acs Acetyl-coenzyme A synthetase Sodalis glossinidius (strain morsitans)
O68006 2.63e-24 112 23 17 550 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 1.29e-22 106 23 18 558 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 5.51e-21 101 20 11 533 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 1.83e-20 100 21 10 541 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 7.16e-13 75 21 9 364 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O88813 3.39e-24 110 28 14 345 1 Acsl5 Long-chain-fatty-acid--CoA ligase 5 Rattus norvegicus
P39847 4.63e-24 111 22 13 520 1 ppsC Plipastatin synthase subunit C Bacillus subtilis (strain 168)
P39847 7.21e-17 88 22 13 550 1 ppsC Plipastatin synthase subunit C Bacillus subtilis (strain 168)
Q8VYJ1 4.99e-24 109 26 15 392 1 AAE14 2-succinylbenzoate--CoA ligase, chloroplastic/peroxisomal Arabidopsis thaliana
Q9F7R5 7.21e-24 109 24 18 560 3 acsA Acetyl-coenzyme A synthetase Gamma-proteobacterium EBAC31A08
P33124 9.49e-24 109 28 12 343 1 Acsl6 Long-chain-fatty-acid--CoA ligase 6 Rattus norvegicus
B2HIL4 9.49e-24 108 25 20 513 1 fadD29 4-hydroxyphenylalkanoate adenylyltransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
P45745 1.02e-23 110 24 19 554 1 dhbF Dimodular nonribosomal peptide synthase Bacillus subtilis (strain 168)
P45745 6.79e-23 107 24 18 554 1 dhbF Dimodular nonribosomal peptide synthase Bacillus subtilis (strain 168)
Q8ZKF6 1.08e-23 108 23 14 555 1 acs Acetyl-coenzyme A synthetase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9X928 1.13e-23 108 25 18 547 3 acsA Acetyl-coenzyme A synthetase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8FAY8 1.14e-23 108 24 14 555 3 acs Acetyl-coenzyme A synthetase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B2HIN2 1.42e-23 108 23 20 606 1 fadD26 Long-chain-fatty-acid--AMP ligase FadD26 Mycobacterium marinum (strain ATCC BAA-535 / M)
Q8Z1R0 1.44e-23 108 23 14 555 3 acs Acetyl-coenzyme A synthetase Salmonella typhi
Q8EYG2 1.67e-23 108 25 21 545 3 acsA Acetyl-coenzyme A synthetase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P27550 1.71e-23 108 24 14 555 1 acs Acetyl-coenzyme A synthetase Escherichia coli (strain K12)
Q72LY9 1.79e-23 108 25 21 545 3 acsA Acetyl-coenzyme A synthetase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A7MPJ7 1.85e-23 108 24 15 554 3 acs Acetyl-coenzyme A synthetase Cronobacter sakazakii (strain ATCC BAA-894)
Q01757 1.88e-23 108 23 15 568 3 pcbAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase (Fragment) Streptomyces clavuligerus
Q91WC3 1.89e-23 108 28 11 344 1 Acsl6 Long-chain-fatty-acid--CoA ligase 6 Mus musculus
Q46Z41 1.94e-23 108 24 17 571 3 acsA Acetyl-coenzyme A synthetase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A1S7C8 2.12e-23 108 25 18 569 3 acsA Acetyl-coenzyme A synthetase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
P9WQ59 2.22e-23 107 25 23 513 1 fadD28 Long-chain-fatty-acid--AMP ligase FadD28 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ58 2.22e-23 107 25 23 513 3 fadD28 Long-chain-fatty-acid--AMP ligase FadD28 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P27742 2.27e-23 108 22 12 553 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P27742 8.76e-17 88 21 18 565 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P27742 2.27e-14 80 20 19 566 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q02278 2.45e-23 107 25 23 513 3 fadD28 Long-chain-fatty-acid--AMP ligase FadD28 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1B6A7 2.68e-23 108 24 16 532 3 mbtB Phenyloxazoline synthase MbtB Mycobacterium sp. (strain MCS)
Q82EL5 3.46e-23 107 25 18 557 3 acsA Acetyl-coenzyme A synthetase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P9WER8 3.68e-23 108 23 16 564 1 malA Malpinin synthetase Mortierella alpina
P9WER8 8.7e-22 104 22 17 564 1 malA Malpinin synthetase Mortierella alpina
P9WER8 1.32e-21 103 23 13 560 1 malA Malpinin synthetase Mortierella alpina
P9WER8 7.42e-21 101 24 16 557 1 malA Malpinin synthetase Mortierella alpina
P9WER8 8.27e-19 94 22 13 553 1 malA Malpinin synthetase Mortierella alpina
P9WER8 7.62e-18 91 24 14 552 1 malA Malpinin synthetase Mortierella alpina
P9WER8 2.08e-12 74 25 11 376 1 malA Malpinin synthetase Mortierella alpina
P9WQ49 4.13e-23 107 26 22 486 1 fadD21 Putative fatty-acid--CoA ligase FadD21 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ48 4.13e-23 107 26 22 486 3 fadD21 Putative fatty-acid--CoA ligase fadD21 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63524 4.13e-23 107 26 22 486 3 fadD21 Putative fatty-acid--CoA ligase fadD21 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9P7D7 4.69e-23 107 29 12 305 3 lcf2 Long-chain-fatty-acid--CoA ligase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A8H5P1 4.83e-23 107 24 17 578 3 acsA Acetyl-coenzyme A synthetase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q55DR6 4.9e-23 107 27 19 475 1 fcsA Fatty acyl-CoA synthetase A Dictyostelium discoideum
Q9ULC5 5.49e-23 107 29 12 313 1 ACSL5 Long-chain-fatty-acid--CoA ligase 5 Homo sapiens
A1JIK3 6.46e-23 106 24 15 559 3 acs Acetyl-coenzyme A synthetase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P9WQ43 6.6e-23 106 24 23 608 1 fadD26 Long-chain-fatty-acid--AMP ligase FadD26 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ42 6.6e-23 106 24 23 608 3 fadD26 Long-chain-fatty-acid--AMP ligase FadD26 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B5Z6E9 6.98e-23 106 23 19 570 3 acsA Acetyl-coenzyme A synthetase Helicobacter pylori (strain G27)
P16928 7.24e-23 106 27 23 551 2 facA Acetyl-coenzyme A synthetase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q7TXM1 8.42e-23 105 24 23 608 1 fadD26 Long-chain-fatty-acid--AMP ligase FadD26 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0VSR6 9.84e-23 105 25 20 567 3 acsA Acetyl-coenzyme A synthetase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q1CUA3 1.06e-22 105 23 20 572 3 acsA Acetyl-coenzyme A synthetase Helicobacter pylori (strain HPAG1)
Q758X0 1.13e-22 105 24 16 547 3 ACS1 Acetyl-coenzyme A synthetase 1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q8X5T5 1.14e-22 105 24 15 556 3 acs Acetyl-coenzyme A synthetase Escherichia coli O157:H7
A7IFD4 1.17e-22 105 25 17 559 3 acsA Acetyl-coenzyme A synthetase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q7M9Y2 1.26e-22 105 24 21 595 3 acsA Acetyl-coenzyme A synthetase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A0A5K6CNB8 1.5e-22 106 22 19 567 1 posA Delta-poly-L-ornithine synthetase Acinetobacter baumannii (strain AB307-0294)
O25686 1.67e-22 105 23 19 570 3 acsA Acetyl-coenzyme A synthetase Helicobacter pylori (strain ATCC 700392 / 26695)
Q8XBV9 2.13e-22 105 23 18 560 3 entF Enterobactin synthase component F Escherichia coli O157:H7
P78773 2.15e-22 105 25 22 564 1 SPCC191.02c Probable acetyl-coenzyme A synthetase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6FLU2 2.27e-22 105 24 22 563 3 ACS1 Acetyl-coenzyme A synthetase 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q0CWD0 2.35e-22 105 25 13 385 1 apvA Nonribosomal peptide synthetase apvA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q17WR1 2.52e-22 104 22 17 567 3 acsA Acetyl-coenzyme A synthetase Helicobacter acinonychis (strain Sheeba)
B0TPY4 2.66e-22 104 24 17 578 3 acsA Acetyl-coenzyme A synthetase Shewanella halifaxensis (strain HAW-EB4)
P95141 2.78e-22 104 24 17 517 1 fadD29 4-hydroxyphenylalkanoate adenylyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7TXK5 2.78e-22 104 24 17 517 3 fadD29 4-hydroxyphenylalkanoate adenylyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O60011 3.41e-22 104 25 19 546 3 ACS1 Acetyl-coenzyme A synthetase 1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9HV66 3.49e-22 104 25 16 526 3 acsA2 Acetyl-coenzyme A synthetase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A8NVB7 3.49e-22 104 24 17 532 1 CC1G_06235 Adenylate-forming reductase 06235 Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
B6JKX8 3.5e-22 104 23 20 572 3 acsA Acetyl-coenzyme A synthetase Helicobacter pylori (strain P12)
Q8LPS1 3.82e-22 104 29 14 356 1 LACS6 Long chain acyl-CoA synthetase 6, peroxisomal Arabidopsis thaliana
Q6Q883 3.93e-22 105 23 16 554 2 sirP Nonribosomal peptide synthetase sirP Leptosphaeria maculans
Q6Q883 2.11e-09 64 21 23 562 2 sirP Nonribosomal peptide synthetase sirP Leptosphaeria maculans
Q3SLF4 4.51e-22 103 24 17 564 3 acsA Acetyl-coenzyme A synthetase Thiobacillus denitrificans (strain ATCC 25259)
Q7TTR2 4.8e-22 103 24 20 498 3 fadD32 Long-chain-fatty-acid--AMP ligase FadD32 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
G3J456 5.05e-22 105 23 12 542 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
G3J456 7.26e-17 88 22 13 468 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
G3XNF4 5.1e-22 104 24 21 550 1 ATPKS PKS-NRPS hybrid synthetase ATPKS Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
O53580 5.35e-22 103 24 20 498 1 fadD32 Long-chain-fatty-acid--AMP ligase FadD32 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A8G8G7 5.74e-22 103 24 16 559 3 acs Acetyl-coenzyme A synthetase Serratia proteamaculans (strain 568)
Q73XY1 6.25e-22 104 25 9 363 3 mbtB Phenyloxazoline synthase MbtB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q66FM8 7.24e-22 103 25 16 558 3 acs Acetyl-coenzyme A synthetase Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FNG1 7.24e-22 103 25 16 558 3 acs Acetyl-coenzyme A synthetase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q9T0A0 7.53e-22 103 28 11 319 2 LACS4 Long chain acyl-CoA synthetase 4 Arabidopsis thaliana
O68040 7.64e-22 103 24 20 563 3 acsA Acetyl-coenzyme A synthetase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04595
Feature type CDS
Gene fadD
Product long-chain-fatty-acid--CoA ligase FadD
Location 972360 - 974051 (strand: 1)
Length 1692 (nucleotides) / 563 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_242
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00501 AMP-binding enzyme
PF13193 AMP-binding enzyme C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0318 Lipid transport and metabolism (I) I O-succinylbenzoic acid-CoA ligase MenE or related acyl-CoA synthetase (AMP-forming)

Kegg Ortholog Annotation(s)

Protein Sequence

MERVWLKHYPEDVPADINPDTYASMAEMLENAVSRFADQPAFINMGEVMTYRKLEERSRAFAAYLQNGLGLKKGDRVALMMPNLLQYPIAMFGVLRAGMVVVNVNPLYTPRELEHQLNDSGCAAIVIVSNFAHTLEKIVFNTQIRHVILTRMGDQLSRPKATLVDFVVKYIKRLVPKYNLPDAISFRRAIYQGYRMQYVKPDIHREDLAFLQYTGGTTGVAKGAMLTHRNMLANLEQARAAYIPELSVGKELIVTALPLYHVFALTVNCLLFLETGGRNLLITNPRDVSGTIKELGKYPFTAITGVNTLFNVWVNDPEFRKLDFSTLNLSVGGGMPVQKAVAERWEALTGKHLLEGYGLTECSPLVAGNPHNLKNYSGSIGFPVPSTDIRLVDDDGNDVPEGQPGEMWVSGPQVMKGYWNRPDATAEVLKDGWVATGDIAQFDENGFLHIVDRKKDMILVSGFNVYPNEVEEAVVLHPGVLECAAVGVESESSGETVKVFIVRKDPSLTEDELRSHCRRYLTGYKVPKIIEFRDELPKSNVGKILRRELRNEEKQKTQTQPVA

Flanking regions ( +/- flanking 50bp)

GTTAATACCGGCAGGGTCTGAGATAAGCAGCAATCATTAGGAGTAAAATCTTGGAAAGAGTCTGGCTTAAACACTATCCGGAAGACGTCCCGGCGGATATCAATCCTGACACCTACGCCTCTATGGCAGAGATGCTGGAAAATGCGGTATCCCGCTTTGCGGACCAACCTGCGTTCATTAATATGGGCGAGGTGATGACGTACCGGAAACTGGAAGAGCGCAGCCGTGCTTTTGCCGCCTATCTGCAAAACGGATTGGGGCTGAAAAAAGGGGACAGGGTTGCCCTGATGATGCCGAACTTACTGCAATACCCTATCGCGATGTTCGGGGTTCTGCGGGCAGGGATGGTTGTCGTCAATGTGAACCCGCTCTATACACCAAGAGAGTTAGAACATCAGTTAAATGACAGCGGTTGTGCCGCAATCGTCATTGTATCCAATTTTGCACACACGCTTGAAAAAATTGTATTTAACACACAAATTCGCCACGTTATCTTGACCCGCATGGGTGATCAACTCTCCCGTCCCAAAGCGACGCTGGTGGATTTTGTCGTCAAATACATCAAACGACTGGTACCGAAATATAACCTGCCGGATGCTATCTCTTTTCGCCGGGCTATCTATCAGGGCTACCGCATGCAGTATGTCAAACCGGATATTCACCGGGAAGACCTCGCTTTTTTGCAATACACCGGCGGAACAACCGGTGTTGCCAAAGGGGCGATGCTGACACACCGTAATATGCTGGCAAATCTGGAACAGGCGCGTGCTGCGTACATTCCTGAACTGAGTGTCGGAAAAGAGCTGATTGTGACGGCGCTGCCGCTGTATCATGTTTTTGCCCTGACAGTGAACTGCCTGTTATTCCTTGAAACCGGTGGACGCAACCTGTTAATCACTAATCCGCGGGATGTCAGCGGCACTATCAAAGAACTGGGCAAATACCCGTTCACGGCGATAACCGGGGTAAATACATTATTCAATGTCTGGGTAAATGACCCGGAGTTTCGCAAACTGGATTTTTCCACGCTGAACCTTTCTGTCGGCGGGGGCATGCCGGTGCAAAAAGCCGTGGCTGAGCGCTGGGAAGCCCTGACCGGCAAACACTTGCTGGAAGGTTACGGGCTGACAGAATGTTCGCCGCTGGTTGCCGGTAATCCACATAATCTGAAAAATTACAGCGGCAGTATCGGCTTTCCTGTGCCGTCCACGGATATCCGTCTGGTTGATGATGACGGTAACGACGTACCGGAAGGTCAGCCGGGCGAAATGTGGGTCAGTGGCCCGCAGGTTATGAAAGGGTACTGGAACCGGCCGGATGCCACTGCTGAAGTGTTAAAAGATGGCTGGGTGGCAACCGGGGACATCGCACAGTTTGATGAAAACGGTTTTCTGCATATTGTTGATCGCAAAAAAGACATGATCCTGGTGTCCGGGTTTAATGTTTACCCGAATGAAGTTGAAGAGGCGGTTGTATTGCATCCGGGCGTACTGGAATGTGCCGCTGTTGGTGTGGAGAGCGAAAGCTCCGGCGAAACTGTCAAAGTGTTTATTGTGCGCAAAGATCCCTCACTGACAGAAGATGAGCTGCGTTCACATTGCCGCCGTTATCTGACCGGTTATAAAGTACCGAAAATCATTGAATTTCGTGATGAGTTACCAAAATCCAATGTCGGTAAAATTTTACGCCGCGAATTACGTAACGAAGAAAAACAAAAAACACAGACTCAGCCGGTTGCATGACACCCCGTCCGGTTGCAAAATAATAACGCCGGTGCTTACCGGTGTTATTG