Homologs in group_2509

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02000 FBDBKF_02000 67.7 Morganella morganii S1 - Adenylate cyclase
EHELCC_02470 EHELCC_02470 67.7 Morganella morganii S2 - Adenylate cyclase
NLDBIP_00990 NLDBIP_00990 67.7 Morganella morganii S4 - Adenylate cyclase
LHKJJB_01045 LHKJJB_01045 67.7 Morganella morganii S3 - Adenylate cyclase
HKOGLL_01085 HKOGLL_01085 67.7 Morganella morganii S5 - Adenylate cyclase

Distribution of the homologs in the orthogroup group_2509

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2509

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q6GPJ5 3.57e-30 122 33 3 254 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q6GPJ5 3.75e-20 93 28 2 259 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q6GPJ5 3.03e-17 85 30 2 218 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q6GPJ5 4.14e-13 72 27 6 285 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q6GPJ5 2.14e-09 61 26 3 181 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q6GPJ5 1.96e-07 55 24 9 306 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q6GPJ5 8.02e-07 53 26 2 160 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q6GPJ5 9.7e-07 53 23 4 220 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q5M8G4 8.02e-30 121 33 3 254 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q5M8G4 4.36e-20 93 32 1 187 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q5M8G4 2.42e-17 85 30 2 218 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q5M8G4 1.59e-15 80 31 1 185 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q5M8G4 2.66e-11 67 25 7 296 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q5M8G4 7.02e-10 63 24 5 268 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q5M8G4 7.39e-09 60 26 1 196 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q5M8G4 1.97e-05 49 22 5 273 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q7KRY7 1.34e-27 115 34 0 235 1 scrib Protein lap4 Drosophila melanogaster
Q7KRY7 6.6e-23 102 32 0 228 1 scrib Protein lap4 Drosophila melanogaster
Q7KRY7 3.28e-22 100 33 2 236 1 scrib Protein lap4 Drosophila melanogaster
Q7KRY7 1.4e-20 95 30 0 247 1 scrib Protein lap4 Drosophila melanogaster
O61967 2.3e-27 114 31 0 273 1 let-413 Protein lap1 Caenorhabditis elegans
O61967 2.29e-22 100 28 1 265 1 let-413 Protein lap1 Caenorhabditis elegans
O61967 8.34e-22 98 28 1 268 1 let-413 Protein lap1 Caenorhabditis elegans
O61967 1.75e-10 65 25 0 204 1 let-413 Protein lap1 Caenorhabditis elegans
Q9BTT6 5.71e-27 113 33 0 237 1 LRRC1 Leucine-rich repeat-containing protein 1 Homo sapiens
Q9BTT6 5.33e-24 104 30 0 241 1 LRRC1 Leucine-rich repeat-containing protein 1 Homo sapiens
Q9BTT6 3.76e-21 96 31 0 225 1 LRRC1 Leucine-rich repeat-containing protein 1 Homo sapiens
Q9BTT6 4.82e-21 96 30 1 249 1 LRRC1 Leucine-rich repeat-containing protein 1 Homo sapiens
Q9BTT6 1.75e-17 85 31 2 219 1 LRRC1 Leucine-rich repeat-containing protein 1 Homo sapiens
Q5ZLN0 2.13e-25 108 30 2 276 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
Q5ZLN0 8.4e-20 92 34 0 177 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
Q5ZLN0 9.31e-14 74 30 3 204 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
Q5ZLN0 5.12e-13 72 28 10 261 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
Q5ZLN0 2.93e-12 70 25 5 276 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
Q5ZLN0 1.79e-10 64 30 4 204 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
Q5ZLN0 5.2e-07 54 26 4 169 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
O88520 2.99e-25 108 32 1 210 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
O88520 2.64e-20 94 31 0 208 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
O88520 3.6e-18 87 30 3 257 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
O88520 4.32e-17 84 26 3 297 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
O88520 4.43e-15 78 30 5 271 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
O88520 5.76e-12 69 27 2 202 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
O88520 1.24e-08 59 42 0 87 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
Q5RAV5 3.14e-25 108 32 1 210 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q5RAV5 2.78e-21 97 31 0 208 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q5RAV5 8.8e-19 89 30 2 246 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q5RAV5 5.11e-17 84 30 4 250 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q5RAV5 1.93e-15 79 33 2 180 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q5RAV5 8.81e-12 68 27 2 202 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q5RAV5 1.1e-07 56 42 0 87 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q9UQ13 3.14e-25 108 32 1 210 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
Q9UQ13 2.78e-21 97 31 0 208 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
Q9UQ13 8.8e-19 89 30 2 246 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
Q9UQ13 5.11e-17 84 30 4 250 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
Q9UQ13 1.93e-15 79 33 2 180 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
Q9UQ13 8.81e-12 68 27 2 202 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
Q9UQ13 1.1e-07 56 42 0 87 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
A6QLV3 3.29e-25 108 32 1 210 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
A6QLV3 2.91e-21 97 31 0 208 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
A6QLV3 9.39e-19 89 30 2 246 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
A6QLV3 5.35e-17 84 30 4 250 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
A6QLV3 1.99e-15 79 33 2 180 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
A6QLV3 8.97e-12 68 27 2 202 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
A6QLV3 1.13e-07 56 42 0 87 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
Q7SXW3 4.52e-25 108 30 1 257 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q7SXW3 3e-21 97 31 1 232 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q7SXW3 4.71e-15 78 26 8 337 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q7SXW3 8.3e-09 59 25 6 278 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q7SXW3 1.1e-05 50 42 0 76 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q80VQ1 5.07e-25 107 33 0 218 1 Lrrc1 Leucine-rich repeat-containing protein 1 Mus musculus
Q80VQ1 2.24e-21 97 31 0 245 1 Lrrc1 Leucine-rich repeat-containing protein 1 Mus musculus
Q80VQ1 9.04e-21 95 31 1 249 1 Lrrc1 Leucine-rich repeat-containing protein 1 Mus musculus
Q80VQ1 3.52e-20 93 30 0 217 1 Lrrc1 Leucine-rich repeat-containing protein 1 Mus musculus
B4QVR7 6e-25 107 33 1 207 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
B4QVR7 2.07e-21 97 29 2 247 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
B4QVR7 2.16e-16 82 29 4 245 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
B4QVR7 3.09e-11 67 25 6 277 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
B4QVR7 4.95e-09 60 38 1 101 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
Q5F4C4 6.48e-25 107 31 1 210 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5F4C4 3e-23 102 29 2 263 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5F4C4 1.59e-22 100 30 3 255 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5F4C4 3.21e-21 96 29 4 261 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5F4C4 2.46e-17 85 25 2 330 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5F4C4 1.13e-16 83 30 5 258 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5F4C4 1.8e-07 55 41 0 87 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
B4IBI9 1.14e-24 107 32 1 210 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B4IBI9 2.84e-22 100 29 3 248 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B4IBI9 7.66e-20 92 28 2 246 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B4IBI9 1.74e-16 82 29 5 257 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B4IBI9 2.39e-11 67 25 6 277 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B4IBI9 1.97e-07 55 35 0 92 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B0M0P8 1.19e-24 107 31 2 252 2 gefL Ras guanine nucleotide exchange factor L Dictyostelium discoideum
B0M0P8 8.91e-17 84 28 1 228 2 gefL Ras guanine nucleotide exchange factor L Dictyostelium discoideum
B0M0P8 1.91e-10 65 25 1 198 2 gefL Ras guanine nucleotide exchange factor L Dictyostelium discoideum
B5DX45 1.59e-24 106 33 1 210 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
B5DX45 5.49e-22 99 28 1 247 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
B5DX45 2.12e-20 94 28 0 227 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
B5DX45 2.68e-16 82 29 4 236 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
B5DX45 9.73e-12 68 25 6 277 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
B5DX45 9.96e-09 59 36 0 92 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
Q8AVI4 2.26e-24 105 31 1 210 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
Q8AVI4 5.15e-21 96 31 2 240 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
Q8AVI4 1.4e-20 94 29 2 263 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
Q8AVI4 4.75e-20 93 30 4 250 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
Q8AVI4 6.12e-19 90 31 5 271 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
Q8AVI4 2.15e-15 79 24 2 276 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
Q8AVI4 1.26e-11 68 26 2 205 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
Q8AVI4 2.52e-07 55 41 0 87 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
B4PU77 2.42e-24 105 31 1 227 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
B4PU77 4.89e-22 99 29 3 248 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
B4PU77 4.85e-21 96 28 2 246 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
B4PU77 1.54e-16 83 29 5 257 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
B4PU77 2.02e-11 67 25 6 277 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
B4PU77 1.77e-08 58 36 0 92 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
Q9VEK6 2.7e-24 105 31 1 227 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
Q9VEK6 5.83e-22 99 29 3 248 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
Q9VEK6 5.57e-21 96 28 2 246 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
Q9VEK6 1.46e-16 83 29 4 245 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
Q9VEK6 1.05e-11 68 26 6 277 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
Q9VEK6 1.73e-08 58 36 0 92 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
Q1L8Y7 2.99e-24 105 31 1 217 2 shoc2 Leucine-rich repeat protein SHOC-2 Danio rerio
Q1L8Y7 2.34e-22 100 30 1 230 2 shoc2 Leucine-rich repeat protein SHOC-2 Danio rerio
Q1L8Y7 2.19e-17 85 30 4 250 2 shoc2 Leucine-rich repeat protein SHOC-2 Danio rerio
Q1L8Y7 1.15e-16 83 32 2 207 2 shoc2 Leucine-rich repeat protein SHOC-2 Danio rerio
Q1L8Y7 2.67e-16 82 29 2 246 2 shoc2 Leucine-rich repeat protein SHOC-2 Danio rerio
Q6AYI5 3.07e-24 105 31 1 208 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
Q6AYI5 2.05e-20 94 31 0 208 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
Q6AYI5 2.54e-18 88 30 3 257 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
Q6AYI5 3.72e-17 84 30 4 250 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
Q6AYI5 1.76e-15 79 33 2 180 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
Q6AYI5 8.1e-12 68 27 2 202 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
Q6AYI5 1.24e-08 59 42 0 87 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
B3LWU3 3.46e-24 105 30 1 227 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
B3LWU3 1.17e-21 98 29 3 248 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
B3LWU3 9.26e-21 95 28 2 240 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
B3LWU3 4.96e-16 81 27 3 266 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
B3LWU3 2.46e-12 70 26 6 277 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
B3LWU3 1.98e-07 55 34 0 92 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
Q4R3P6 6.76e-24 104 30 2 246 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
Q4R3P6 3.05e-19 90 32 1 187 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
Q4R3P6 4.04e-19 90 29 2 230 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
Q4R3P6 3.37e-12 70 24 6 338 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
Q4R3P6 3.3e-11 67 24 5 266 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
Q4R3P6 1.87e-08 58 28 1 149 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
Q4R3P6 0.000132 47 29 2 124 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
Q4R3P6 0.000222 46 24 6 262 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
B3P3E8 7.28e-24 104 31 1 227 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
B3P3E8 5.52e-22 99 29 3 248 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
B3P3E8 1.08e-20 95 28 2 246 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
B3P3E8 5.36e-16 81 29 5 257 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
B3P3E8 2.11e-11 67 25 6 277 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
B3P3E8 1.66e-08 58 36 0 92 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
Q80TH2 8.54e-24 104 28 1 247 1 Erbin Erbin Mus musculus
Q80TH2 4.63e-20 93 26 0 246 1 Erbin Erbin Mus musculus
Q80TH2 2.89e-19 91 29 1 260 1 Erbin Erbin Mus musculus
Q80TH2 7.85e-15 78 27 0 222 1 Erbin Erbin Mus musculus
Q80TH2 2.29e-13 73 29 1 205 1 Erbin Erbin Mus musculus
Q80TH2 3.99e-10 63 31 0 121 1 Erbin Erbin Mus musculus
Q80TH2 1.65e-07 56 21 0 195 1 Erbin Erbin Mus musculus
B4LXW1 9.1e-24 104 32 1 210 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila virilis
B4LXW1 3.71e-21 96 28 1 247 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila virilis
B4LXW1 6.8e-16 81 29 4 236 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila virilis
B4LXW1 6.01e-06 51 33 0 92 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila virilis
Q4H4B6 1.09e-23 104 34 0 231 1 scrib Protein scribble homolog Danio rerio
Q4H4B6 3.22e-20 94 34 3 202 1 scrib Protein scribble homolog Danio rerio
Q4H4B6 1.15e-18 89 36 2 219 1 scrib Protein scribble homolog Danio rerio
Q4H4B6 1.81e-17 86 30 3 240 1 scrib Protein scribble homolog Danio rerio
Q4H4B6 9.42e-05 47 25 1 169 1 scrib Protein scribble homolog Danio rerio
B4N9T4 1.19e-23 103 32 1 210 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
B4N9T4 2.4e-21 97 28 1 247 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
B4N9T4 3.33e-18 87 28 3 281 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
B4N9T4 3.76e-12 70 26 4 276 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
B4N9T4 5.15e-08 57 36 0 92 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
B0W6M9 1.45e-23 103 31 1 210 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 9.85e-22 98 29 1 243 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 2.4e-19 91 30 2 240 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 1.9e-17 85 28 3 282 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 8.06e-16 80 27 3 267 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 1.85e-11 67 31 1 154 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 1.15e-07 56 30 0 130 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
Q5RFE9 1.49e-23 103 30 2 246 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
Q5RFE9 4.01e-19 90 29 2 230 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
Q5RFE9 4.36e-19 90 32 0 173 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
Q5RFE9 1.39e-11 68 23 6 338 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
Q5RFE9 2.13e-11 67 24 5 266 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
Q5RFE9 1.38e-08 59 28 1 149 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
Q5RFE9 7.21e-05 47 25 7 261 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
Q5RFE9 0.000194 46 29 2 124 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
B4JTV9 1.63e-23 103 32 1 210 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila grimshawi
B4JTV9 1.01e-19 92 27 1 247 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila grimshawi
B4JTV9 9.75e-16 80 27 3 268 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila grimshawi
B4JTV9 7.49e-06 50 33 0 92 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila grimshawi
Q96RT1 2.2e-23 103 29 1 247 1 ERBIN Erbin Homo sapiens
Q96RT1 3.22e-20 94 28 0 246 1 ERBIN Erbin Homo sapiens
Q96RT1 7.69e-19 90 29 1 254 1 ERBIN Erbin Homo sapiens
Q96RT1 3.22e-15 79 27 0 222 1 ERBIN Erbin Homo sapiens
Q96RT1 7.47e-13 72 30 2 203 1 ERBIN Erbin Homo sapiens
Q9H9A6 2.35e-23 103 30 2 246 1 LRRC40 Leucine-rich repeat-containing protein 40 Homo sapiens
Q9H9A6 2.78e-19 91 29 2 230 1 LRRC40 Leucine-rich repeat-containing protein 40 Homo sapiens
Q9H9A6 5.02e-19 90 33 1 187 1 LRRC40 Leucine-rich repeat-containing protein 40 Homo sapiens
Q9H9A6 6.4e-11 66 24 6 283 1 LRRC40 Leucine-rich repeat-containing protein 40 Homo sapiens
Q9H9A6 8.23e-09 59 29 1 149 1 LRRC40 Leucine-rich repeat-containing protein 40 Homo sapiens
Q9H9A6 9.26e-09 59 23 8 337 1 LRRC40 Leucine-rich repeat-containing protein 40 Homo sapiens
Q9H9A6 1.49e-05 49 25 7 261 1 LRRC40 Leucine-rich repeat-containing protein 40 Homo sapiens
Q9H9A6 0.000191 46 29 2 124 1 LRRC40 Leucine-rich repeat-containing protein 40 Homo sapiens
Q54AX5 2.4e-23 102 30 2 243 1 lrrA Leucine-rich repeat protein lrrA Dictyostelium discoideum
Q54AX5 3.09e-22 99 26 2 282 1 lrrA Leucine-rich repeat protein lrrA Dictyostelium discoideum
Q54AX5 2.48e-21 97 29 3 257 1 lrrA Leucine-rich repeat protein lrrA Dictyostelium discoideum
Q54AX5 2.2e-15 79 26 2 243 1 lrrA Leucine-rich repeat protein lrrA Dictyostelium discoideum
Q54AX5 2.1e-13 73 27 1 191 1 lrrA Leucine-rich repeat protein lrrA Dictyostelium discoideum
Q54AX5 1.7e-08 58 31 1 138 1 lrrA Leucine-rich repeat protein lrrA Dictyostelium discoideum
A6H6A4 6.15e-23 101 29 1 249 2 Lrriq4 Leucine-rich repeat and IQ domain-containing protein 4 Mus musculus
A6H6A4 7.73e-21 95 28 3 267 2 Lrriq4 Leucine-rich repeat and IQ domain-containing protein 4 Mus musculus
A6H6A4 1.34e-14 77 28 2 239 2 Lrriq4 Leucine-rich repeat and IQ domain-containing protein 4 Mus musculus
A6H6A4 2.43e-13 73 29 4 263 2 Lrriq4 Leucine-rich repeat and IQ domain-containing protein 4 Mus musculus
A6H6A4 1.08e-05 50 31 4 163 2 Lrriq4 Leucine-rich repeat and IQ domain-containing protein 4 Mus musculus
A6H6A4 8.82e-05 47 21 3 230 2 Lrriq4 Leucine-rich repeat and IQ domain-containing protein 4 Mus musculus
A6NIV6 9.27e-23 101 27 3 279 1 LRRIQ4 Leucine-rich repeat and IQ domain-containing protein 4 Homo sapiens
A6NIV6 2.46e-19 91 28 1 249 1 LRRIQ4 Leucine-rich repeat and IQ domain-containing protein 4 Homo sapiens
A6NIV6 9.57e-19 89 29 3 238 1 LRRIQ4 Leucine-rich repeat and IQ domain-containing protein 4 Homo sapiens
A6NIV6 5.89e-15 78 31 4 240 1 LRRIQ4 Leucine-rich repeat and IQ domain-containing protein 4 Homo sapiens
A6NIV6 4.54e-13 72 28 1 184 1 LRRIQ4 Leucine-rich repeat and IQ domain-containing protein 4 Homo sapiens
A6NIV6 6.15e-07 53 24 1 184 1 LRRIQ4 Leucine-rich repeat and IQ domain-containing protein 4 Homo sapiens
A6NIV6 9.84e-07 53 29 2 153 1 LRRIQ4 Leucine-rich repeat and IQ domain-containing protein 4 Homo sapiens
A4D1F6 9.82e-23 101 28 1 269 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 4.49e-22 99 31 0 244 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 2.62e-21 97 26 3 278 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 8.33e-19 89 26 2 246 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 1.13e-18 89 25 4 288 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 3.18e-18 88 29 2 218 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 6.7e-14 75 28 1 236 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A7SFP1 1.08e-22 100 30 1 236 3 v1g189306 Leucine-rich repeat protein soc-2 homolog Nematostella vectensis
A7SFP1 1.14e-18 89 29 2 247 3 v1g189306 Leucine-rich repeat protein soc-2 homolog Nematostella vectensis
A7SFP1 9.97e-17 83 27 3 266 3 v1g189306 Leucine-rich repeat protein soc-2 homolog Nematostella vectensis
A7SFP1 7.92e-15 77 27 4 267 3 v1g189306 Leucine-rich repeat protein soc-2 homolog Nematostella vectensis
A7SFP1 1.44e-14 77 27 7 233 3 v1g189306 Leucine-rich repeat protein soc-2 homolog Nematostella vectensis
Q9Y4C4 1.39e-22 101 29 0 245 1 MFHAS1 Malignant fibrous histiocytoma-amplified sequence 1 Homo sapiens
Q9Y4C4 2.29e-18 88 28 1 225 1 MFHAS1 Malignant fibrous histiocytoma-amplified sequence 1 Homo sapiens
Q9Y4C4 6.71e-05 48 29 1 160 1 MFHAS1 Malignant fibrous histiocytoma-amplified sequence 1 Homo sapiens
Q22875 2.08e-22 100 29 0 206 1 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis elegans
Q22875 1.22e-20 95 28 0 228 1 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis elegans
Q22875 3.5e-18 87 27 2 269 1 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis elegans
Q22875 1.27e-11 68 26 2 268 1 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis elegans
Q22875 2.93e-06 52 27 1 203 1 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis elegans
Q8C0R9 2.12e-22 100 27 1 268 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 7.31e-22 99 31 0 242 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 2.19e-19 91 25 0 263 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 2.6e-19 91 26 1 265 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 5.87e-19 90 25 2 269 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 7.5e-19 90 26 3 265 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 2.84e-18 88 27 0 266 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 4.98e-18 87 27 2 243 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 1.75e-12 71 26 1 193 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 9.35e-12 68 27 2 225 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q9HB75 2.62e-22 100 40 0 164 1 PIDD1 p53-induced death domain-containing protein 1 Homo sapiens
Q9HB75 9.76e-16 80 31 0 173 1 PIDD1 p53-induced death domain-containing protein 1 Homo sapiens
Q9HB75 1.28e-08 59 35 0 131 1 PIDD1 p53-induced death domain-containing protein 1 Homo sapiens
Q9HB75 1.21e-07 56 30 0 130 1 PIDD1 p53-induced death domain-containing protein 1 Homo sapiens
Q9HB75 2.83e-07 55 34 0 102 1 PIDD1 p53-induced death domain-containing protein 1 Homo sapiens
Q9HB75 1.96e-05 49 30 2 134 1 PIDD1 p53-induced death domain-containing protein 1 Homo sapiens
Q4R6F0 7.55e-22 99 29 1 268 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 1.59e-21 97 31 0 244 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 1.35e-20 95 26 2 278 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 4.54e-20 93 30 2 238 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 5.95e-19 90 25 1 249 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 4.81e-18 87 26 2 246 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 5.81e-18 87 27 0 245 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 1.09e-17 86 29 2 218 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 3.97e-13 73 29 1 236 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q80TE7 7.72e-22 99 29 1 247 1 Lrrc7 Leucine-rich repeat-containing protein 7 Mus musculus
Q80TE7 7.42e-20 93 30 0 234 1 Lrrc7 Leucine-rich repeat-containing protein 7 Mus musculus
Q80TE7 1.32e-19 92 29 0 248 1 Lrrc7 Leucine-rich repeat-containing protein 7 Mus musculus
Q80TE7 5.24e-16 81 28 0 228 1 Lrrc7 Leucine-rich repeat-containing protein 7 Mus musculus
Q80TE7 6.08e-16 81 29 0 221 1 Lrrc7 Leucine-rich repeat-containing protein 7 Mus musculus
Q80TE7 4.25e-15 79 28 0 198 1 Lrrc7 Leucine-rich repeat-containing protein 7 Mus musculus
Q80TE7 8.73e-13 72 28 2 230 1 Lrrc7 Leucine-rich repeat-containing protein 7 Mus musculus
Q80TE7 9.92e-10 62 29 0 163 1 Lrrc7 Leucine-rich repeat-containing protein 7 Mus musculus
P70587 8.02e-22 99 29 1 247 1 Lrrc7 Leucine-rich repeat-containing protein 7 Rattus norvegicus
P70587 7.85e-20 93 30 0 234 1 Lrrc7 Leucine-rich repeat-containing protein 7 Rattus norvegicus
P70587 1.37e-19 92 29 0 248 1 Lrrc7 Leucine-rich repeat-containing protein 7 Rattus norvegicus
P70587 5.59e-16 81 28 0 228 1 Lrrc7 Leucine-rich repeat-containing protein 7 Rattus norvegicus
P70587 6.14e-16 81 29 0 221 1 Lrrc7 Leucine-rich repeat-containing protein 7 Rattus norvegicus
P70587 4.29e-15 79 28 0 198 1 Lrrc7 Leucine-rich repeat-containing protein 7 Rattus norvegicus
P70587 8.65e-13 72 28 2 230 1 Lrrc7 Leucine-rich repeat-containing protein 7 Rattus norvegicus
P70587 9.92e-10 62 29 0 163 1 Lrrc7 Leucine-rich repeat-containing protein 7 Rattus norvegicus
Q9CRC8 2.92e-21 97 30 2 246 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q9CRC8 7.93e-18 86 34 1 187 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q9CRC8 7.17e-12 68 28 9 261 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q9CRC8 9.37e-12 68 27 6 262 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q9CRC8 8.06e-11 65 24 6 266 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q9CRC8 1.08e-08 59 33 1 118 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q96NW7 9.33e-21 95 28 1 247 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q96NW7 8.67e-20 92 30 0 234 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q96NW7 1.57e-18 89 28 0 246 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q96NW7 8.23e-16 81 28 0 221 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q96NW7 1.03e-15 80 28 0 234 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q96NW7 1.69e-14 77 28 0 198 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q96NW7 3.76e-12 70 28 2 230 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q96NW7 8.6e-09 60 28 0 163 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q96NW7 0.000346 45 25 0 150 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q14160 4.09e-20 94 34 0 231 1 SCRIB Protein scribble homolog Homo sapiens
Q14160 1.93e-19 92 34 2 219 1 SCRIB Protein scribble homolog Homo sapiens
Q14160 1.49e-17 86 29 4 253 1 SCRIB Protein scribble homolog Homo sapiens
Q6K7R2 4.59e-20 93 30 2 258 2 IRL6 Plant intracellular Ras-group-related LRR protein 6 Oryza sativa subsp. japonica
Q6K7R2 1.75e-17 85 31 2 246 2 IRL6 Plant intracellular Ras-group-related LRR protein 6 Oryza sativa subsp. japonica
Q6K7R2 8.29e-15 77 27 1 231 2 IRL6 Plant intracellular Ras-group-related LRR protein 6 Oryza sativa subsp. japonica
Q6K7R2 7.31e-10 63 27 3 211 2 IRL6 Plant intracellular Ras-group-related LRR protein 6 Oryza sativa subsp. japonica
Q6K7R2 5.69e-08 57 26 6 288 2 IRL6 Plant intracellular Ras-group-related LRR protein 6 Oryza sativa subsp. japonica
Q80X72 6.63e-20 92 33 12 258 1 Lrrc15 Leucine-rich repeat-containing protein 15 Mus musculus
Q80U72 1.42e-19 92 34 2 219 1 Scrib Protein scribble homolog Mus musculus
Q80U72 3.94e-19 90 33 0 231 1 Scrib Protein scribble homolog Mus musculus
Q80U72 5.03e-19 90 30 4 253 1 Scrib Protein scribble homolog Mus musculus
Q80U72 6.14e-12 69 25 2 292 1 Scrib Protein scribble homolog Mus musculus
Q8S7M7 1.52e-19 91 28 1 233 2 IRL5 Plant intracellular Ras-group-related LRR protein 5 Oryza sativa subsp. japonica
Q8S7M7 1.23e-18 89 31 1 226 2 IRL5 Plant intracellular Ras-group-related LRR protein 5 Oryza sativa subsp. japonica
Q8S7M7 1.34e-14 77 27 2 226 2 IRL5 Plant intracellular Ras-group-related LRR protein 5 Oryza sativa subsp. japonica
Q8S7M7 7.1e-08 57 27 1 172 2 IRL5 Plant intracellular Ras-group-related LRR protein 5 Oryza sativa subsp. japonica
F1MCA7 2.39e-19 91 28 2 247 3 LRRC7 Leucine-rich repeat-containing protein 7 Bos taurus
F1MCA7 3.97e-17 85 28 1 257 3 LRRC7 Leucine-rich repeat-containing protein 7 Bos taurus
F1MCA7 5.24e-15 79 29 1 221 3 LRRC7 Leucine-rich repeat-containing protein 7 Bos taurus
F1MCA7 2.54e-14 76 28 1 228 3 LRRC7 Leucine-rich repeat-containing protein 7 Bos taurus
F1MCA7 1.14e-12 71 28 2 225 3 LRRC7 Leucine-rich repeat-containing protein 7 Bos taurus
F1MCA7 2.02e-08 58 28 0 163 3 LRRC7 Leucine-rich repeat-containing protein 7 Bos taurus
F1MCA7 0.000516 45 25 0 150 3 LRRC7 Leucine-rich repeat-containing protein 7 Bos taurus
Q9SVW8 3.04e-19 90 32 0 183 1 PIRL4 Plant intracellular Ras-group-related LRR protein 4 Arabidopsis thaliana
Q9SVW8 3.03e-18 87 28 5 258 1 PIRL4 Plant intracellular Ras-group-related LRR protein 4 Arabidopsis thaliana
Q9SVW8 2.32e-17 85 30 0 169 1 PIRL4 Plant intracellular Ras-group-related LRR protein 4 Arabidopsis thaliana
Q9SVW8 8.16e-17 83 29 1 210 1 PIRL4 Plant intracellular Ras-group-related LRR protein 4 Arabidopsis thaliana
G9LZD7 3.12e-19 91 34 10 250 2 XIAO Probable inactive leucine-rich repeat receptor kinase XIAO Oryza sativa subsp. japonica
G9LZD7 1.43e-13 74 30 11 261 2 XIAO Probable inactive leucine-rich repeat receptor kinase XIAO Oryza sativa subsp. japonica
G9LZD7 6.48e-11 66 29 8 216 2 XIAO Probable inactive leucine-rich repeat receptor kinase XIAO Oryza sativa subsp. japonica
G9LZD7 3.33e-10 64 28 11 247 2 XIAO Probable inactive leucine-rich repeat receptor kinase XIAO Oryza sativa subsp. japonica
G9LZD7 7.51e-10 63 28 12 265 2 XIAO Probable inactive leucine-rich repeat receptor kinase XIAO Oryza sativa subsp. japonica
Q3V1N1 3.14e-19 91 28 0 245 1 Mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Mus musculus
Q3V1N1 7.29e-07 53 26 0 158 1 Mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Mus musculus
Q3V1N1 7.87e-05 47 29 1 159 1 Mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Mus musculus
F1R6I3 4.93e-19 89 30 2 212 2 lrrc39 Leucine-rich repeat-containing protein 39 Danio rerio
F1R6I3 1.1e-17 85 37 1 133 2 lrrc39 Leucine-rich repeat-containing protein 39 Danio rerio
F1R6I3 1.25e-14 76 31 2 194 2 lrrc39 Leucine-rich repeat-containing protein 39 Danio rerio
F1R6I3 0.000724 44 30 0 96 2 lrrc39 Leucine-rich repeat-containing protein 39 Danio rerio
Q9RBS2 1.24e-18 89 29 5 273 4 popC Protein PopC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9RBS2 1.02e-17 86 29 6 270 4 popC Protein PopC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9RBS2 2.49e-12 70 28 3 185 4 popC Protein PopC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9LRV8 1.25e-18 89 30 4 238 2 PIRL2 Plant intracellular Ras-group-related LRR protein 2 Arabidopsis thaliana
Q9LRV8 7e-14 74 31 1 148 2 PIRL2 Plant intracellular Ras-group-related LRR protein 2 Arabidopsis thaliana
Q9LRV8 2.27e-12 70 27 2 205 2 PIRL2 Plant intracellular Ras-group-related LRR protein 2 Arabidopsis thaliana
Q9LRV8 3.49e-10 63 27 2 173 2 PIRL2 Plant intracellular Ras-group-related LRR protein 2 Arabidopsis thaliana
Q9LRV8 7.98e-06 50 28 2 126 2 PIRL2 Plant intracellular Ras-group-related LRR protein 2 Arabidopsis thaliana
Q9LRV8 7.09e-05 47 31 1 117 2 PIRL2 Plant intracellular Ras-group-related LRR protein 2 Arabidopsis thaliana
Q6Z8P4 1.42e-18 89 27 5 262 2 IRL4 Plant intracellular Ras-group-related LRR protein 4 Oryza sativa subsp. japonica
Q6Z8P4 1.88e-16 82 30 1 189 2 IRL4 Plant intracellular Ras-group-related LRR protein 4 Oryza sativa subsp. japonica
Q6Z8P4 2.79e-15 79 26 1 222 2 IRL4 Plant intracellular Ras-group-related LRR protein 4 Oryza sativa subsp. japonica
Q6Z8P4 5.09e-12 69 34 0 121 2 IRL4 Plant intracellular Ras-group-related LRR protein 4 Oryza sativa subsp. japonica
O75427 1.65e-18 89 36 2 170 1 LRCH4 Leucine-rich repeat and calponin homology domain-containing protein 4 Homo sapiens
O75427 1.01e-12 71 28 3 219 1 LRCH4 Leucine-rich repeat and calponin homology domain-containing protein 4 Homo sapiens
O75427 2.05e-09 61 30 4 172 1 LRCH4 Leucine-rich repeat and calponin homology domain-containing protein 4 Homo sapiens
A0A8P0N4K0 1.97e-18 89 31 4 218 1 SCRIB Protein scribble homolog Canis lupus familiaris
A0A8P0N4K0 3.35e-17 85 34 0 231 1 SCRIB Protein scribble homolog Canis lupus familiaris
A0A8P0N4K0 6.72e-15 78 33 2 219 1 SCRIB Protein scribble homolog Canis lupus familiaris
A0A8P0N4K0 2.62e-12 70 25 2 291 1 SCRIB Protein scribble homolog Canis lupus familiaris
Q9V780 2.12e-18 88 28 0 214 2 Lap1 Protein lap1 Drosophila melanogaster
Q9V780 1.13e-16 83 28 0 234 2 Lap1 Protein lap1 Drosophila melanogaster
Q9V780 1.39e-15 80 26 0 217 2 Lap1 Protein lap1 Drosophila melanogaster
Q9V780 1.58e-15 80 27 0 253 2 Lap1 Protein lap1 Drosophila melanogaster
Q9V780 6.44e-15 78 26 2 241 2 Lap1 Protein lap1 Drosophila melanogaster
Q9V780 4.25e-13 72 29 0 183 2 Lap1 Protein lap1 Drosophila melanogaster
Q9V780 1.51e-11 68 30 2 186 2 Lap1 Protein lap1 Drosophila melanogaster
Q9V780 4.93e-09 60 25 1 178 2 Lap1 Protein lap1 Drosophila melanogaster
F8WK50 2.85e-18 88 30 3 275 1 flii Protein flightless-1 homolog Danio rerio
F8WK50 4.35e-08 57 25 4 280 1 flii Protein flightless-1 homolog Danio rerio
A8JAM0 3.47e-18 88 26 0 167 1 DRC7 Dynein regulatory complex subunit 7 (Fragment) Chlamydomonas reinhardtii
A8JAM0 1.67e-17 86 28 2 211 1 DRC7 Dynein regulatory complex subunit 7 (Fragment) Chlamydomonas reinhardtii
A8JAM0 6.23e-15 78 29 1 179 1 DRC7 Dynein regulatory complex subunit 7 (Fragment) Chlamydomonas reinhardtii
A8JAM0 8.76e-14 75 29 1 156 1 DRC7 Dynein regulatory complex subunit 7 (Fragment) Chlamydomonas reinhardtii
A8JAM0 1.17e-13 74 26 0 169 1 DRC7 Dynein regulatory complex subunit 7 (Fragment) Chlamydomonas reinhardtii
P23466 4.32e-18 87 27 6 313 3 CYR1 Adenylate cyclase Lachancea kluyveri
P23466 5.36e-14 75 28 4 246 3 CYR1 Adenylate cyclase Lachancea kluyveri
P23466 1.07e-13 75 25 3 277 3 CYR1 Adenylate cyclase Lachancea kluyveri
P23466 9.16e-08 57 26 6 251 3 CYR1 Adenylate cyclase Lachancea kluyveri
P23466 4.95e-06 51 30 0 108 3 CYR1 Adenylate cyclase Lachancea kluyveri
Q8W4Q3 4.42e-18 87 31 3 235 2 PIRL3 Plant intracellular Ras-group-related LRR protein 3 Arabidopsis thaliana
Q8W4Q3 8.65e-09 59 28 2 177 2 PIRL3 Plant intracellular Ras-group-related LRR protein 3 Arabidopsis thaliana
Q8W4Q3 8.21e-08 56 31 2 129 2 PIRL3 Plant intracellular Ras-group-related LRR protein 3 Arabidopsis thaliana
Q8W4Q3 3.67e-07 54 27 2 206 2 PIRL3 Plant intracellular Ras-group-related LRR protein 3 Arabidopsis thaliana
Q921G6 6.6e-18 87 37 2 156 1 Lrch4 Leucine-rich repeat and calponin homology domain-containing protein 4 Mus musculus
Q921G6 1.55e-12 71 26 4 241 1 Lrch4 Leucine-rich repeat and calponin homology domain-containing protein 4 Mus musculus
Q921G6 5.65e-08 57 29 4 172 1 Lrch4 Leucine-rich repeat and calponin homology domain-containing protein 4 Mus musculus
Q7XK44 7.18e-18 86 30 3 240 2 IRL3 Plant intracellular Ras-group-related LRR protein 3 Oryza sativa subsp. japonica
Q7XK44 1.51e-10 64 29 1 154 2 IRL3 Plant intracellular Ras-group-related LRR protein 3 Oryza sativa subsp. japonica
Q7XK44 1.55e-09 61 35 1 128 2 IRL3 Plant intracellular Ras-group-related LRR protein 3 Oryza sativa subsp. japonica
Q7XK44 1.51e-07 55 29 0 109 2 IRL3 Plant intracellular Ras-group-related LRR protein 3 Oryza sativa subsp. japonica
Q8VYG9 8.38e-18 86 31 2 189 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
Q8VYG9 1.29e-13 74 31 1 145 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
Q8VYG9 5.19e-13 72 30 2 200 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
Q8VYG9 7.94e-11 65 27 2 193 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
Q8VYG9 4.76e-10 63 33 1 135 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
Q8VYG9 8.62e-08 56 28 2 160 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
Q8VYG9 4.45e-07 54 32 1 104 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
Q6DHL5 8.48e-18 84 34 2 165 2 lrrc57 Leucine-rich repeat-containing protein 57 Danio rerio
Q6DHL5 5.38e-17 81 30 2 172 2 lrrc57 Leucine-rich repeat-containing protein 57 Danio rerio
Q6DHL5 6.4e-15 75 36 1 126 2 lrrc57 Leucine-rich repeat-containing protein 57 Danio rerio
Q6DHL5 3.43e-12 68 26 5 237 2 lrrc57 Leucine-rich repeat-containing protein 57 Danio rerio
Q6DHL5 1.11e-07 55 37 2 95 2 lrrc57 Leucine-rich repeat-containing protein 57 Danio rerio
Q8TF66 9.37e-18 86 29 12 282 1 LRRC15 Leucine-rich repeat-containing protein 15 Homo sapiens
Q8TF66 1.07e-07 56 29 11 251 1 LRRC15 Leucine-rich repeat-containing protein 15 Homo sapiens
Q5G5E0 1.23e-17 86 30 1 233 2 PIRL5 Plant intracellular Ras-group-related LRR protein 5 Arabidopsis thaliana
Q5G5E0 2.01e-17 85 31 0 182 2 PIRL5 Plant intracellular Ras-group-related LRR protein 5 Arabidopsis thaliana
Q5G5E0 6.16e-15 78 27 4 273 2 PIRL5 Plant intracellular Ras-group-related LRR protein 5 Arabidopsis thaliana
Q5G5E0 9.11e-06 50 22 2 186 2 PIRL5 Plant intracellular Ras-group-related LRR protein 5 Arabidopsis thaliana
Q5G5E0 0.000473 45 34 1 76 2 PIRL5 Plant intracellular Ras-group-related LRR protein 5 Arabidopsis thaliana
Q6GLE8 1.37e-17 85 31 3 194 2 lrrc28 Leucine-rich repeat-containing protein 28 Xenopus tropicalis
Q6GLE8 6.62e-09 59 27 0 144 2 lrrc28 Leucine-rich repeat-containing protein 28 Xenopus tropicalis
Q9D9Q0 3.75e-17 83 29 2 228 2 Lrrc69 Leucine-rich repeat-containing protein 69 Mus musculus
Q9D9Q0 3.89e-14 75 27 3 229 2 Lrrc69 Leucine-rich repeat-containing protein 69 Mus musculus
Q9D9Q0 2.42e-12 69 29 1 174 2 Lrrc69 Leucine-rich repeat-containing protein 69 Mus musculus
Q9D9Q0 2.22e-06 52 33 1 135 2 Lrrc69 Leucine-rich repeat-containing protein 69 Mus musculus
Q9D9Q0 5.26e-06 50 25 1 164 2 Lrrc69 Leucine-rich repeat-containing protein 69 Mus musculus
Q9D9Q0 0.000433 45 23 3 167 2 Lrrc69 Leucine-rich repeat-containing protein 69 Mus musculus
A8XWW4 3.91e-17 84 26 2 267 3 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis briggsae
A8XWW4 4.02e-17 84 28 0 206 3 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis briggsae
A8XWW4 1.37e-16 83 29 0 228 3 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis briggsae
A8XWW4 2.13e-15 79 28 3 269 3 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis briggsae
A8XWW4 2.26e-12 70 27 2 268 3 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis briggsae
A8XWW4 2e-06 52 27 1 206 3 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis briggsae
Q8R5M3 4.34e-17 84 31 12 258 2 Lrrc15 Leucine-rich repeat-containing protein 15 Rattus norvegicus
Q3KQF4 4.39e-17 83 31 1 207 2 lrrc69 Leucine-rich repeat-containing protein 69 Xenopus laevis
Q3KQF4 9.95e-13 70 28 4 247 2 lrrc69 Leucine-rich repeat-containing protein 69 Xenopus laevis
Q3KQF4 5.93e-05 47 25 1 183 2 lrrc69 Leucine-rich repeat-containing protein 69 Xenopus laevis
Q24020 4.5e-17 84 29 3 275 2 fliI Protein flightless-1 Drosophila melanogaster
Q24020 9.95e-14 75 26 4 278 2 fliI Protein flightless-1 Drosophila melanogaster
Q24020 6.26e-13 72 27 5 243 2 fliI Protein flightless-1 Drosophila melanogaster
Q24020 7.08e-06 51 30 1 117 2 fliI Protein flightless-1 Drosophila melanogaster
Q24020 1.24e-05 50 32 1 109 2 fliI Protein flightless-1 Drosophila melanogaster
Q24020 0.000629 45 24 3 194 2 fliI Protein flightless-1 Drosophila melanogaster
Q8BGI7 4.95e-17 83 31 1 196 1 Lrrc39 Leucine-rich repeat-containing protein 39 Mus musculus
Q8BGI7 2.18e-14 75 27 1 189 1 Lrrc39 Leucine-rich repeat-containing protein 39 Mus musculus
Q8BGI7 4.39e-13 72 29 1 186 1 Lrrc39 Leucine-rich repeat-containing protein 39 Mus musculus
Q8BGI7 5.26e-12 68 25 2 225 1 Lrrc39 Leucine-rich repeat-containing protein 39 Mus musculus
Q8BGI7 0.000304 45 25 0 122 1 Lrrc39 Leucine-rich repeat-containing protein 39 Mus musculus
O82318 8.52e-17 84 28 12 325 1 SKM1 Leucine-rich repeat receptor-like serine/threonine-protein kinase SKM1 Arabidopsis thaliana
O82318 7.88e-12 69 26 10 248 1 SKM1 Leucine-rich repeat receptor-like serine/threonine-protein kinase SKM1 Arabidopsis thaliana
O82318 4.16e-11 67 33 9 186 1 SKM1 Leucine-rich repeat receptor-like serine/threonine-protein kinase SKM1 Arabidopsis thaliana
Q3TX51 8.88e-17 82 30 2 186 2 Lrrc28 Leucine-rich repeat-containing protein 28 Mus musculus
Q3TX51 9.04e-10 62 25 1 162 2 Lrrc28 Leucine-rich repeat-containing protein 28 Mus musculus
Q3TX51 1.54e-07 55 26 1 156 2 Lrrc28 Leucine-rich repeat-containing protein 28 Mus musculus
Q3TX51 1.09e-06 53 28 0 124 2 Lrrc28 Leucine-rich repeat-containing protein 28 Mus musculus
P34268 1.08e-16 84 28 5 255 2 fli-1 Protein flightless-1 homolog Caenorhabditis elegans
P34268 9.07e-10 63 25 5 255 2 fli-1 Protein flightless-1 homolog Caenorhabditis elegans
P34268 1.72e-09 62 26 3 177 2 fli-1 Protein flightless-1 homolog Caenorhabditis elegans
P34268 1.08e-06 53 25 5 221 2 fli-1 Protein flightless-1 homolog Caenorhabditis elegans
Q9LYN8 1.24e-16 83 33 11 269 1 EMS1 Leucine-rich repeat receptor protein kinase EMS1 Arabidopsis thaliana
Q9LYN8 1.03e-09 62 33 10 206 1 EMS1 Leucine-rich repeat receptor protein kinase EMS1 Arabidopsis thaliana
Q9LYN8 4.54e-09 60 29 11 279 1 EMS1 Leucine-rich repeat receptor protein kinase EMS1 Arabidopsis thaliana
Q9LYN8 4.12e-07 54 29 11 231 1 EMS1 Leucine-rich repeat receptor protein kinase EMS1 Arabidopsis thaliana
Q55CS7 1.3e-16 83 30 5 243 2 mpl1 MAP kinase phosphatase with leucine-rich repeats protein 1 Dictyostelium discoideum
Q9C7T7 1.46e-16 83 33 7 218 1 CEPR2 Receptor protein-tyrosine kinase CEPR2 Arabidopsis thaliana
Q9C7T7 1.17e-14 77 28 10 274 1 CEPR2 Receptor protein-tyrosine kinase CEPR2 Arabidopsis thaliana
Q9C7T7 1.06e-07 56 29 10 242 1 CEPR2 Receptor protein-tyrosine kinase CEPR2 Arabidopsis thaliana
Q9C7T7 4.94e-05 48 32 3 115 1 CEPR2 Receptor protein-tyrosine kinase CEPR2 Arabidopsis thaliana
P08678 2.03e-16 83 28 3 266 1 CYR1 Adenylate cyclase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P08678 3.95e-09 61 27 2 175 1 CYR1 Adenylate cyclase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P08678 6.7e-09 60 27 5 216 1 CYR1 Adenylate cyclase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P08678 9.99e-05 47 25 6 252 1 CYR1 Adenylate cyclase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P08678 0.000588 45 26 6 230 1 CYR1 Adenylate cyclase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9ERV7 2.06e-16 82 34 0 166 1 Pidd1 p53-induced death domain-containing protein 1 Mus musculus
Q9ERV7 5.17e-14 75 29 2 172 1 Pidd1 p53-induced death domain-containing protein 1 Mus musculus
Q9ERV7 3.87e-08 57 32 0 137 1 Pidd1 p53-induced death domain-containing protein 1 Mus musculus
Q9ERV7 5.03e-08 57 29 0 133 1 Pidd1 p53-induced death domain-containing protein 1 Mus musculus
Q9ERV7 8.42e-07 53 33 0 108 1 Pidd1 p53-induced death domain-containing protein 1 Mus musculus
Q55CS8 2.44e-16 82 30 3 233 3 mpl2 MAP kinase phosphatase with leucine-rich repeats protein 2 Dictyostelium discoideum
Q55CS8 1.04e-06 53 32 0 99 3 mpl2 MAP kinase phosphatase with leucine-rich repeats protein 2 Dictyostelium discoideum
Q5BKY1 3.65e-16 80 26 3 256 1 LRRC10 Leucine-rich repeat-containing protein 10 Homo sapiens
Q32NT4 4.28e-16 80 29 2 189 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus laevis
Q32NT4 1.18e-11 67 32 2 147 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus laevis
Q32NT4 6.01e-06 50 30 2 148 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus laevis
Q32NT4 8.37e-05 47 31 2 117 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus laevis
Q15404 4.36e-16 79 33 4 178 1 RSU1 Ras suppressor protein 1 Homo sapiens
Q15404 5.2e-15 76 33 1 164 1 RSU1 Ras suppressor protein 1 Homo sapiens
Q15404 4.51e-12 68 31 1 138 1 RSU1 Ras suppressor protein 1 Homo sapiens
Q15404 1.63e-10 63 27 3 175 1 RSU1 Ras suppressor protein 1 Homo sapiens
Q15404 3.91e-10 62 35 1 109 1 RSU1 Ras suppressor protein 1 Homo sapiens
Q15404 0.000416 44 30 1 110 1 RSU1 Ras suppressor protein 1 Homo sapiens
Q15404 0.000499 44 32 1 93 1 RSU1 Ras suppressor protein 1 Homo sapiens
Q8K3W2 5.98e-16 79 28 1 208 1 Lrrc10 Leucine-rich repeat-containing protein 10 Mus musculus
Q8K3W2 2.25e-12 69 28 1 184 1 Lrrc10 Leucine-rich repeat-containing protein 10 Mus musculus
Q8K3W2 1.27e-11 67 29 1 188 1 Lrrc10 Leucine-rich repeat-containing protein 10 Mus musculus
Q8K3W2 1.41e-09 61 31 0 148 1 Lrrc10 Leucine-rich repeat-containing protein 10 Mus musculus
P62046 6.18e-16 81 31 6 230 1 Lrch1 Leucine-rich repeat and calponin homology domain-containing protein 1 Mus musculus
P62046 3.74e-12 70 29 4 207 1 Lrch1 Leucine-rich repeat and calponin homology domain-containing protein 1 Mus musculus
P62046 1.37e-05 50 27 2 166 1 Lrch1 Leucine-rich repeat and calponin homology domain-containing protein 1 Mus musculus
V9M398 7.75e-16 81 29 5 268 1 RUN1 Disease resistance protein RUN1 Vitis rotundifolia
V9M398 1.29e-12 71 26 7 282 1 RUN1 Disease resistance protein RUN1 Vitis rotundifolia
V9M398 5.79e-11 66 25 10 309 1 RUN1 Disease resistance protein RUN1 Vitis rotundifolia
V9M398 2.28e-05 49 23 3 182 1 RUN1 Disease resistance protein RUN1 Vitis rotundifolia
Q5E9C0 1.12e-15 78 33 4 178 2 RSU1 Ras suppressor protein 1 Bos taurus
Q5E9C0 3.79e-15 77 33 1 164 2 RSU1 Ras suppressor protein 1 Bos taurus
Q5E9C0 7.16e-12 67 31 1 138 2 RSU1 Ras suppressor protein 1 Bos taurus
Q5E9C0 2.36e-10 63 27 3 175 2 RSU1 Ras suppressor protein 1 Bos taurus
Q5E9C0 1.47e-09 61 36 1 105 2 RSU1 Ras suppressor protein 1 Bos taurus
V9M2S5 1.13e-15 80 28 6 285 1 RPV1 Disease resistance protein RPV1 Vitis rotundifolia
V9M2S5 1.97e-14 77 26 8 292 1 RPV1 Disease resistance protein RPV1 Vitis rotundifolia
V9M2S5 6.94e-08 57 24 3 182 1 RPV1 Disease resistance protein RPV1 Vitis rotundifolia
Q9FIZ3 1.22e-15 80 32 9 219 1 GSO2 LRR receptor-like serine/threonine-protein kinase GSO2 Arabidopsis thaliana
Q9FIZ3 5.12e-12 69 27 10 281 1 GSO2 LRR receptor-like serine/threonine-protein kinase GSO2 Arabidopsis thaliana
Q9FIZ3 3.41e-10 64 25 10 280 1 GSO2 LRR receptor-like serine/threonine-protein kinase GSO2 Arabidopsis thaliana
Q9FIZ3 2.32e-05 49 28 7 190 1 GSO2 LRR receptor-like serine/threonine-protein kinase GSO2 Arabidopsis thaliana
Q9FIZ3 3.97e-05 48 27 10 261 1 GSO2 LRR receptor-like serine/threonine-protein kinase GSO2 Arabidopsis thaliana
Q9FFJ3 1.31e-15 80 29 2 237 2 PIRL1 Plant intracellular Ras-group-related LRR protein 1 Arabidopsis thaliana
Q9FFJ3 3.21e-13 73 30 1 176 2 PIRL1 Plant intracellular Ras-group-related LRR protein 1 Arabidopsis thaliana
Q9FFJ3 2.91e-11 67 29 2 193 2 PIRL1 Plant intracellular Ras-group-related LRR protein 1 Arabidopsis thaliana
Q9FFJ3 1.02e-05 50 32 1 104 2 PIRL1 Plant intracellular Ras-group-related LRR protein 1 Arabidopsis thaliana
P93194 1.32e-15 80 31 12 270 2 INRPK1 Receptor-like protein kinase Ipomoea nil
P93194 1.78e-08 58 25 10 324 2 INRPK1 Receptor-like protein kinase Ipomoea nil
P93194 5.33e-08 57 26 7 197 2 INRPK1 Receptor-like protein kinase Ipomoea nil
Q9LS80 1.5e-15 80 30 8 250 3 RLP37 Receptor-like protein 37 Arabidopsis thaliana
Q9LJW7 2.08e-15 79 31 12 288 2 RLP43 Receptor-like protein 43 Arabidopsis thaliana
Q9LJW7 4.7e-11 66 30 8 233 2 RLP43 Receptor-like protein 43 Arabidopsis thaliana
Q9LJW7 8.14e-05 47 37 3 96 2 RLP43 Receptor-like protein 43 Arabidopsis thaliana
Q0JA29 2.29e-15 79 31 12 264 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Oryza sativa subsp. japonica
Q0JA29 2.2e-11 67 28 10 276 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Oryza sativa subsp. japonica
Q0JA29 1.85e-10 65 29 11 264 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Oryza sativa subsp. japonica
Q0JA29 6.42e-06 51 30 8 188 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Oryza sativa subsp. japonica
Q0JA29 2.63e-05 49 38 3 99 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Oryza sativa subsp. japonica
D3ZXS4 2.37e-15 78 30 1 196 1 Lrrc39 Leucine-rich repeat-containing protein 39 Rattus norvegicus
D3ZXS4 1.27e-12 70 26 1 189 1 Lrrc39 Leucine-rich repeat-containing protein 39 Rattus norvegicus
D3ZXS4 1.15e-11 67 29 1 174 1 Lrrc39 Leucine-rich repeat-containing protein 39 Rattus norvegicus
D3ZXS4 4.22e-11 66 25 2 225 1 Lrrc39 Leucine-rich repeat-containing protein 39 Rattus norvegicus
D3ZXS4 1.56e-08 58 25 1 187 1 Lrrc39 Leucine-rich repeat-containing protein 39 Rattus norvegicus
D3ZXS4 0.000261 45 25 0 122 1 Lrrc39 Leucine-rich repeat-containing protein 39 Rattus norvegicus
Q8N9N7 2.45e-15 77 35 3 167 1 LRRC57 Leucine-rich repeat-containing protein 57 Homo sapiens
Q8N9N7 2.89e-12 68 29 5 214 1 LRRC57 Leucine-rich repeat-containing protein 57 Homo sapiens
Q8N9N7 9.12e-12 67 27 4 186 1 LRRC57 Leucine-rich repeat-containing protein 57 Homo sapiens
Q8N9N7 8.57e-11 64 27 3 173 1 LRRC57 Leucine-rich repeat-containing protein 57 Homo sapiens
Q8N9N7 3.97e-10 62 35 2 126 1 LRRC57 Leucine-rich repeat-containing protein 57 Homo sapiens
Q8N9N7 1.06e-05 49 37 2 87 1 LRRC57 Leucine-rich repeat-containing protein 57 Homo sapiens
Q9BXB1 2.46e-15 79 30 9 249 1 LGR4 Leucine-rich repeat-containing G-protein coupled receptor 4 Homo sapiens
Q9BXB1 0.000342 45 28 4 142 1 LGR4 Leucine-rich repeat-containing G-protein coupled receptor 4 Homo sapiens
Q6ZH85 3.03e-15 79 29 4 201 2 IRL2 Plant intracellular Ras-group-related LRR protein 2 Oryza sativa subsp. japonica
Q6ZH85 3.01e-14 75 31 1 148 2 IRL2 Plant intracellular Ras-group-related LRR protein 2 Oryza sativa subsp. japonica
Q6ZH85 1.99e-10 64 27 1 186 2 IRL2 Plant intracellular Ras-group-related LRR protein 2 Oryza sativa subsp. japonica
Q6ZH85 1.51e-08 58 30 1 120 2 IRL2 Plant intracellular Ras-group-related LRR protein 2 Oryza sativa subsp. japonica
Q6ZH85 0.000316 45 28 0 107 2 IRL2 Plant intracellular Ras-group-related LRR protein 2 Oryza sativa subsp. japonica
Q55FD8 3.22e-15 79 31 5 257 2 gefV Ras guanine nucleotide exchange factor V Dictyostelium discoideum
Q55FD8 4.09e-09 61 27 2 180 2 gefV Ras guanine nucleotide exchange factor V Dictyostelium discoideum
Q8RWE5 3.53e-15 78 29 3 221 2 PIRL8 Plant intracellular Ras-group-related LRR protein 8 Arabidopsis thaliana
Q8RWE5 1.44e-12 70 34 2 152 2 PIRL8 Plant intracellular Ras-group-related LRR protein 8 Arabidopsis thaliana
Q8RWE5 2.09e-08 58 32 2 136 2 PIRL8 Plant intracellular Ras-group-related LRR protein 8 Arabidopsis thaliana
Q8RWE5 1.45e-05 49 25 4 204 2 PIRL8 Plant intracellular Ras-group-related LRR protein 8 Arabidopsis thaliana
Q8RWE5 0.000131 46 32 1 88 2 PIRL8 Plant intracellular Ras-group-related LRR protein 8 Arabidopsis thaliana
Q6XHA6 3.73e-15 79 30 3 258 3 roco10 Probable inactive serine/threonine-protein kinase roco10 Dictyostelium discoideum
Q6XHA6 9.11e-11 66 32 1 172 3 roco10 Probable inactive serine/threonine-protein kinase roco10 Dictyostelium discoideum
Q6XHA6 1.3e-10 65 29 5 217 3 roco10 Probable inactive serine/threonine-protein kinase roco10 Dictyostelium discoideum
Q6XHA6 1.89e-07 55 26 5 246 3 roco10 Probable inactive serine/threonine-protein kinase roco10 Dictyostelium discoideum
A2ARI4 3.74e-15 79 30 9 249 1 Lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Mus musculus
A2ARI4 5.89e-13 72 28 12 298 1 Lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Mus musculus
A2ARI4 0.000165 46 25 7 251 1 Lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Mus musculus
A2ARI4 0.000868 44 28 4 142 1 Lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Mus musculus
Q6INV3 4.43e-15 76 29 3 196 2 lrrc57 Leucine-rich repeat-containing protein 57 Xenopus laevis
Q6INV3 1.63e-14 74 33 2 166 2 lrrc57 Leucine-rich repeat-containing protein 57 Xenopus laevis
Q6INV3 2.26e-14 74 28 4 192 2 lrrc57 Leucine-rich repeat-containing protein 57 Xenopus laevis
Q6INV3 2.55e-14 74 31 2 169 2 lrrc57 Leucine-rich repeat-containing protein 57 Xenopus laevis
Q6INV3 4.06e-11 65 32 1 125 2 lrrc57 Leucine-rich repeat-containing protein 57 Xenopus laevis
B9F655 4.81e-15 76 28 2 214 2 IRL7 Plant intracellular Ras-group-related LRR protein 7 Oryza sativa subsp. japonica
B9F655 6.84e-13 70 27 0 155 2 IRL7 Plant intracellular Ras-group-related LRR protein 7 Oryza sativa subsp. japonica
B9F655 3.23e-09 60 32 2 124 2 IRL7 Plant intracellular Ras-group-related LRR protein 7 Oryza sativa subsp. japonica
Q9Z2H4 5.47e-15 78 30 9 249 2 Lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Rattus norvegicus
Q9Z2H4 1.37e-13 74 28 12 298 2 Lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Rattus norvegicus
Q9Z2H4 0.000202 46 25 7 251 2 Lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Rattus norvegicus
Q9Z2H4 0.000514 45 28 4 142 2 Lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Rattus norvegicus
F1MT22 6.21e-15 78 27 12 297 3 LGR5 Leucine-rich repeat-containing G-protein coupled receptor 5 Bos taurus
F1MT22 2.57e-12 70 33 8 208 3 LGR5 Leucine-rich repeat-containing G-protein coupled receptor 5 Bos taurus
F1MT22 3.22e-10 64 28 10 254 3 LGR5 Leucine-rich repeat-containing G-protein coupled receptor 5 Bos taurus
F1MT22 2.16e-06 52 29 11 250 3 LGR5 Leucine-rich repeat-containing G-protein coupled receptor 5 Bos taurus
Q66JT1 6.61e-15 78 28 2 189 2 Lrrc8e Volume-regulated anion channel subunit LRRC8E Mus musculus
Q66JT1 4.39e-10 63 30 1 146 2 Lrrc8e Volume-regulated anion channel subunit LRRC8E Mus musculus
Q66JT1 4.37e-07 54 29 2 165 2 Lrrc8e Volume-regulated anion channel subunit LRRC8E Mus musculus
Q5FVI3 7.85e-15 75 34 3 167 2 Lrrc57 Leucine-rich repeat-containing protein 57 Rattus norvegicus
Q5FVI3 5.09e-13 70 29 5 214 2 Lrrc57 Leucine-rich repeat-containing protein 57 Rattus norvegicus
Q5FVI3 2e-10 63 26 3 173 2 Lrrc57 Leucine-rich repeat-containing protein 57 Rattus norvegicus
Q5FVI3 2.08e-10 63 26 4 186 2 Lrrc57 Leucine-rich repeat-containing protein 57 Rattus norvegicus
Q5FVI3 2.23e-10 63 36 2 126 2 Lrrc57 Leucine-rich repeat-containing protein 57 Rattus norvegicus
Q5FVI3 2.2e-05 48 37 2 87 2 Lrrc57 Leucine-rich repeat-containing protein 57 Rattus norvegicus
Q9D1G5 8.01e-15 75 34 3 167 1 Lrrc57 Leucine-rich repeat-containing protein 57 Mus musculus
Q9D1G5 2.09e-12 68 29 4 195 1 Lrrc57 Leucine-rich repeat-containing protein 57 Mus musculus
Q9D1G5 1.23e-10 63 26 4 186 1 Lrrc57 Leucine-rich repeat-containing protein 57 Mus musculus
Q9D1G5 1.89e-10 63 27 3 173 1 Lrrc57 Leucine-rich repeat-containing protein 57 Mus musculus
Q9D1G5 6.41e-10 61 35 2 120 1 Lrrc57 Leucine-rich repeat-containing protein 57 Mus musculus
Q9D1G5 1.91e-05 48 37 2 87 1 Lrrc57 Leucine-rich repeat-containing protein 57 Mus musculus
Q8VZG8 9.34e-15 77 30 10 285 1 MIK2 MDIS1-interacting receptor like kinase 2 Arabidopsis thaliana
Q8VZG8 1.6e-07 56 28 8 205 1 MIK2 MDIS1-interacting receptor like kinase 2 Arabidopsis thaliana
Q8VZG8 1.48e-06 53 27 8 216 1 MIK2 MDIS1-interacting receptor like kinase 2 Arabidopsis thaliana
Q8VZG8 0.000682 44 35 3 105 1 MIK2 MDIS1-interacting receptor like kinase 2 Arabidopsis thaliana
O75473 1.06e-14 77 28 11 289 1 LGR5 Leucine-rich repeat-containing G-protein coupled receptor 5 Homo sapiens
O75473 1.14e-11 68 33 8 208 1 LGR5 Leucine-rich repeat-containing G-protein coupled receptor 5 Homo sapiens
O75473 4.31e-06 51 26 13 299 1 LGR5 Leucine-rich repeat-containing G-protein coupled receptor 5 Homo sapiens
Q55E58 1.2e-14 77 30 4 245 3 pats1 Probable serine/threonine-protein kinase pats1 Dictyostelium discoideum
Q55E58 4.38e-14 76 29 5 267 3 pats1 Probable serine/threonine-protein kinase pats1 Dictyostelium discoideum
Q55E58 2.04e-12 71 29 5 278 3 pats1 Probable serine/threonine-protein kinase pats1 Dictyostelium discoideum
Q1ZXD6 1.54e-14 77 29 6 221 3 roco5 Probable serine/threonine-protein kinase roco5 Dictyostelium discoideum
Q1ZXD6 2.84e-10 64 28 3 225 3 roco5 Probable serine/threonine-protein kinase roco5 Dictyostelium discoideum
Q1ZXD6 1.94e-09 62 35 2 124 3 roco5 Probable serine/threonine-protein kinase roco5 Dictyostelium discoideum
Q13045 1.58e-14 77 31 3 275 1 FLII Protein flightless-1 homolog Homo sapiens
Q13045 9.51e-07 53 27 4 200 1 FLII Protein flightless-1 homolog Homo sapiens
Q13045 1.56e-06 53 23 5 276 1 FLII Protein flightless-1 homolog Homo sapiens
Q9JJ28 1.68e-14 77 30 3 275 1 Flii Protein flightless-1 homolog Mus musculus
Q9JJ28 2.31e-08 58 24 4 271 1 Flii Protein flightless-1 homolog Mus musculus
Q9JJ28 3.66e-06 52 33 2 118 1 Flii Protein flightless-1 homolog Mus musculus
A4IIK1 1.7e-14 77 25 1 239 2 mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Xenopus tropicalis
A4IIK1 3.09e-13 73 26 3 280 2 mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Xenopus tropicalis
A4IIK1 1.21e-12 71 25 3 234 2 mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Xenopus tropicalis
A4IIK1 4.02e-08 57 31 5 177 2 mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Xenopus tropicalis
A4IIK1 6.09e-08 57 29 2 180 2 mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Xenopus tropicalis
Q01513 1.86e-14 77 33 3 178 3 None Adenylate cyclase Podospora anserina
Q01513 1.07e-11 68 26 5 262 3 None Adenylate cyclase Podospora anserina
Q01513 1.53e-11 68 30 5 225 3 None Adenylate cyclase Podospora anserina
Q01513 1.84e-08 58 33 0 118 3 None Adenylate cyclase Podospora anserina
Q01513 6.86e-06 51 28 5 184 3 None Adenylate cyclase Podospora anserina
Q6NSJ5 1.87e-14 77 30 1 181 1 LRRC8E Volume-regulated anion channel subunit LRRC8E Homo sapiens
Q6NSJ5 1.41e-09 62 27 4 217 1 LRRC8E Volume-regulated anion channel subunit LRRC8E Homo sapiens
Q6NSJ5 4.22e-09 60 26 7 271 1 LRRC8E Volume-regulated anion channel subunit LRRC8E Homo sapiens
Q9SGP2 2.11e-14 77 30 10 249 1 HSL1 Receptor-like protein kinase HSL1 Arabidopsis thaliana
Q9SGP2 7.65e-13 72 28 10 258 1 HSL1 Receptor-like protein kinase HSL1 Arabidopsis thaliana
Q9SGP2 1.99e-11 67 28 9 233 1 HSL1 Receptor-like protein kinase HSL1 Arabidopsis thaliana
Q9SGP2 4.14e-10 63 31 10 253 1 HSL1 Receptor-like protein kinase HSL1 Arabidopsis thaliana
F1MLX5 2.42e-14 76 30 8 233 3 LGR4 Leucine-rich repeat-containing G-protein coupled receptor 4 Bos taurus
F1MLX5 1.3e-09 62 30 10 232 3 LGR4 Leucine-rich repeat-containing G-protein coupled receptor 4 Bos taurus
F1MLX5 0.00013 47 28 4 142 3 LGR4 Leucine-rich repeat-containing G-protein coupled receptor 4 Bos taurus
P0C895 2.46e-14 75 29 2 180 1 At2g30105 LRR repeats and ubiquitin-like domain-containing protein At2g30105 Arabidopsis thaliana
P0C895 6.79e-11 65 26 2 178 1 At2g30105 LRR repeats and ubiquitin-like domain-containing protein At2g30105 Arabidopsis thaliana
P0C895 4.98e-09 60 31 2 135 1 At2g30105 LRR repeats and ubiquitin-like domain-containing protein At2g30105 Arabidopsis thaliana
Q7XNY1 2.88e-14 75 31 3 184 2 IRL1 Plant intracellular Ras-group-related LRR protein 1 Oryza sativa subsp. japonica
Q7XNY1 1.31e-11 67 26 3 222 2 IRL1 Plant intracellular Ras-group-related LRR protein 1 Oryza sativa subsp. japonica
Q7XNY1 6.46e-08 56 28 2 162 2 IRL1 Plant intracellular Ras-group-related LRR protein 1 Oryza sativa subsp. japonica
Q96DD0 3.38e-14 75 30 1 196 1 LRRC39 Leucine-rich repeat-containing protein 39 Homo sapiens
Q96DD0 6.48e-14 74 31 2 189 1 LRRC39 Leucine-rich repeat-containing protein 39 Homo sapiens
Q96DD0 1.16e-12 70 25 2 217 1 LRRC39 Leucine-rich repeat-containing protein 39 Homo sapiens
Q96DD0 3.99e-12 68 30 3 186 1 LRRC39 Leucine-rich repeat-containing protein 39 Homo sapiens
Q96DD0 0.000458 44 27 1 129 1 LRRC39 Leucine-rich repeat-containing protein 39 Homo sapiens
Q9CQ07 3.56e-14 74 29 1 141 2 Lrrc18 Leucine-rich repeat-containing protein 18 Mus musculus
Q9CQ07 1.14e-07 55 27 1 139 2 Lrrc18 Leucine-rich repeat-containing protein 18 Mus musculus
Q9CQ07 5.37e-06 50 27 1 148 2 Lrrc18 Leucine-rich repeat-containing protein 18 Mus musculus
Q9CQ07 3.82e-05 47 30 1 116 2 Lrrc18 Leucine-rich repeat-containing protein 18 Mus musculus
Q9CQ07 4.34e-05 47 29 1 124 2 Lrrc18 Leucine-rich repeat-containing protein 18 Mus musculus
Q5U308 4.14e-14 75 30 2 193 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Rattus norvegicus
Q5U308 1.44e-12 71 25 6 292 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Rattus norvegicus
Q9FRS6 4.14e-14 75 30 12 275 1 PXL1 Leucine-rich repeat receptor-like protein kinase PXL1 Arabidopsis thaliana
Q9FRS6 1.97e-11 68 28 12 304 1 PXL1 Leucine-rich repeat receptor-like protein kinase PXL1 Arabidopsis thaliana
Q9FRS6 2.57e-08 58 26 11 297 1 PXL1 Leucine-rich repeat receptor-like protein kinase PXL1 Arabidopsis thaliana
Q9FRS6 0.000436 45 28 5 136 1 PXL1 Leucine-rich repeat receptor-like protein kinase PXL1 Arabidopsis thaliana
D4AC13 4.36e-14 75 28 11 290 3 Lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Rattus norvegicus
D4AC13 7.33e-13 72 33 8 205 3 Lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Rattus norvegicus
D4AC13 6.3e-08 57 27 13 299 3 Lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Rattus norvegicus
D4AC13 0.000253 46 30 13 251 3 Lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Rattus norvegicus
Q24K06 5.58e-14 73 27 1 208 2 LRRC10 Leucine-rich repeat-containing protein 10 Bos taurus
Q24K06 1.01e-13 73 27 1 207 2 LRRC10 Leucine-rich repeat-containing protein 10 Bos taurus
Q24K06 2.31e-09 60 29 0 148 2 LRRC10 Leucine-rich repeat-containing protein 10 Bos taurus
Q96II8 6.14e-14 75 27 6 247 1 LRCH3 DISP complex protein LRCH3 Homo sapiens
Q96II8 1.5e-09 62 29 3 172 1 LRCH3 DISP complex protein LRCH3 Homo sapiens
Q96II8 3.59e-07 55 27 2 178 1 LRCH3 DISP complex protein LRCH3 Homo sapiens
Q96II8 1.54e-05 50 29 2 157 1 LRCH3 DISP complex protein LRCH3 Homo sapiens
Q9FGL5 6.25e-14 75 30 9 242 1 CEPR1 Receptor protein-tyrosine kinase CEPR1 Arabidopsis thaliana
Q9FGL5 1.02e-13 74 31 10 242 1 CEPR1 Receptor protein-tyrosine kinase CEPR1 Arabidopsis thaliana
Q9FGL5 5.52e-09 60 26 8 231 1 CEPR1 Receptor protein-tyrosine kinase CEPR1 Arabidopsis thaliana
Q96CX6 6.31e-14 74 30 3 208 1 LRRC58 Leucine-rich repeat-containing protein 58 Homo sapiens
Q96CX6 1.17e-11 67 35 0 127 1 LRRC58 Leucine-rich repeat-containing protein 58 Homo sapiens
Q96CX6 4.95e-11 66 31 2 157 1 LRRC58 Leucine-rich repeat-containing protein 58 Homo sapiens
Q96CX6 2.04e-05 48 28 1 164 1 LRRC58 Leucine-rich repeat-containing protein 58 Homo sapiens
Q96CX6 0.000217 45 29 2 131 1 LRRC58 Leucine-rich repeat-containing protein 58 Homo sapiens
Q5DU41 6.44e-14 75 28 5 253 1 Lrrc8b Volume-regulated anion channel subunit LRRC8B Mus musculus
Q5DU41 5.03e-09 60 27 8 275 1 Lrrc8b Volume-regulated anion channel subunit LRRC8B Mus musculus
Q5DU41 2.13e-07 55 27 4 215 1 Lrrc8b Volume-regulated anion channel subunit LRRC8B Mus musculus
Q66HD6 6.49e-14 73 28 1 143 2 Lrrc18 Leucine-rich repeat-containing protein 18 Rattus norvegicus
Q66HD6 6.75e-08 55 27 2 147 2 Lrrc18 Leucine-rich repeat-containing protein 18 Rattus norvegicus
Q66HD6 2.93e-07 53 29 1 148 2 Lrrc18 Leucine-rich repeat-containing protein 18 Rattus norvegicus
Q66HD6 5.47e-06 50 30 1 124 2 Lrrc18 Leucine-rich repeat-containing protein 18 Rattus norvegicus
Q66HD6 9.35e-05 46 29 1 116 2 Lrrc18 Leucine-rich repeat-containing protein 18 Rattus norvegicus
Q9LZV7 7.88e-14 75 28 9 291 1 PXC2 Leucine-rich repeat receptor-like protein kinase PXC2 Arabidopsis thaliana
Q9LZV7 2.28e-09 61 28 11 273 1 PXC2 Leucine-rich repeat receptor-like protein kinase PXC2 Arabidopsis thaliana
Q9LZV7 3.19e-07 55 30 8 188 1 PXC2 Leucine-rich repeat receptor-like protein kinase PXC2 Arabidopsis thaliana
Q9LZV7 0.000334 45 31 4 120 1 PXC2 Leucine-rich repeat receptor-like protein kinase PXC2 Arabidopsis thaliana
Q3UGP9 1.16e-13 73 29 4 215 2 Lrrc58 Leucine-rich repeat-containing protein 58 Mus musculus
Q3UGP9 8.26e-11 65 34 0 127 2 Lrrc58 Leucine-rich repeat-containing protein 58 Mus musculus
Q3UGP9 1.21e-05 49 29 3 158 2 Lrrc58 Leucine-rich repeat-containing protein 58 Mus musculus
Q3UGP9 0.0002 46 30 1 131 2 Lrrc58 Leucine-rich repeat-containing protein 58 Mus musculus
Q9Z1P4 1.27e-13 74 27 11 290 1 Lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Mus musculus
Q9Z1P4 4.47e-12 69 32 8 205 1 Lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Mus musculus
Q9Z1P4 5.35e-07 54 26 13 299 1 Lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Mus musculus
Q8BGR2 1.29e-13 74 30 2 193 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Mus musculus
Q8BGR2 1.26e-12 71 25 6 292 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Mus musculus
Q01730 1.34e-13 72 31 4 178 1 Rsu1 Ras suppressor protein 1 Mus musculus
Q01730 3.1e-13 71 31 1 164 1 Rsu1 Ras suppressor protein 1 Mus musculus
Q01730 4.3e-10 62 30 1 138 1 Rsu1 Ras suppressor protein 1 Mus musculus
Q01730 1.03e-06 52 32 1 105 1 Rsu1 Ras suppressor protein 1 Mus musculus
Q5VUJ6 1.35e-13 74 30 2 188 1 LRCH2 Leucine-rich repeat and calponin homology domain-containing protein 2 Homo sapiens
Q5VUJ6 1.44e-12 71 29 7 235 1 LRCH2 Leucine-rich repeat and calponin homology domain-containing protein 2 Homo sapiens
Q5VUJ6 3.41e-12 70 26 2 197 1 LRCH2 Leucine-rich repeat and calponin homology domain-containing protein 2 Homo sapiens
Q5VUJ6 1.75e-05 49 25 3 190 1 LRCH2 Leucine-rich repeat and calponin homology domain-containing protein 2 Homo sapiens
F4K6B8 1.36e-13 74 30 9 249 1 RGI4 Leucine-rich repeat receptor-like serine/threonine-protein kinase RGI4 Arabidopsis thaliana
F4K6B8 4.23e-09 60 27 8 244 1 RGI4 Leucine-rich repeat receptor-like serine/threonine-protein kinase RGI4 Arabidopsis thaliana
Q3UMG5 1.42e-13 74 30 2 188 2 Lrch2 Leucine-rich repeat and calponin homology domain-containing protein 2 Mus musculus
Q3UMG5 2.12e-12 70 26 2 197 2 Lrch2 Leucine-rich repeat and calponin homology domain-containing protein 2 Mus musculus
Q3UMG5 2.87e-12 70 29 7 235 2 Lrch2 Leucine-rich repeat and calponin homology domain-containing protein 2 Mus musculus
Q3UMG5 2.67e-05 49 25 3 190 2 Lrch2 Leucine-rich repeat and calponin homology domain-containing protein 2 Mus musculus
Q42371 1.5e-13 74 29 10 247 1 ERECTA LRR receptor-like serine/threonine-protein kinase ERECTA Arabidopsis thaliana
Q42371 5.11e-11 66 27 8 275 1 ERECTA LRR receptor-like serine/threonine-protein kinase ERECTA Arabidopsis thaliana
Q42371 1.14e-08 59 28 9 234 1 ERECTA LRR receptor-like serine/threonine-protein kinase ERECTA Arabidopsis thaliana
Q42371 0.000175 46 33 3 112 1 ERECTA LRR receptor-like serine/threonine-protein kinase ERECTA Arabidopsis thaliana
A4IHG1 1.83e-13 73 28 3 189 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus tropicalis
A4IHG1 7.06e-10 62 32 2 146 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus tropicalis
A4IHG1 2.09e-06 52 31 2 148 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus tropicalis
A4IHG1 0.00053 44 30 2 117 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus tropicalis
Q6UXM1 2.13e-13 73 28 10 275 1 LRIG3 Leucine-rich repeats and immunoglobulin-like domains protein 3 Homo sapiens
Q6UXM1 2.54e-08 58 26 10 277 1 LRIG3 Leucine-rich repeats and immunoglobulin-like domains protein 3 Homo sapiens
Q6UXM1 2.03e-05 49 29 7 198 1 LRIG3 Leucine-rich repeats and immunoglobulin-like domains protein 3 Homo sapiens
Q9Y2L9 2.15e-13 73 30 3 195 1 LRCH1 Leucine-rich repeat and calponin homology domain-containing protein 1 Homo sapiens
Q9Y2L9 3e-12 70 29 5 221 1 LRCH1 Leucine-rich repeat and calponin homology domain-containing protein 1 Homo sapiens
Q9Y2L9 3.41e-05 48 26 2 166 1 LRCH1 Leucine-rich repeat and calponin homology domain-containing protein 1 Homo sapiens
Q80WG5 2.61e-13 73 27 4 217 1 Lrrc8a Volume-regulated anion channel subunit LRRC8A Mus musculus
Q9LP24 2.74e-13 73 29 9 233 1 At1g35710 Probable leucine-rich repeat receptor-like protein kinase At1g35710 Arabidopsis thaliana
Q9LP24 1.36e-10 65 27 8 266 1 At1g35710 Probable leucine-rich repeat receptor-like protein kinase At1g35710 Arabidopsis thaliana
Q9LP24 3.34e-10 64 31 9 229 1 At1g35710 Probable leucine-rich repeat receptor-like protein kinase At1g35710 Arabidopsis thaliana
Q9LP24 6.11e-10 63 26 9 281 1 At1g35710 Probable leucine-rich repeat receptor-like protein kinase At1g35710 Arabidopsis thaliana
Q9LP24 1.06e-07 56 28 9 211 1 At1g35710 Probable leucine-rich repeat receptor-like protein kinase At1g35710 Arabidopsis thaliana
P35858 2.84e-13 73 33 10 238 1 IGFALS Insulin-like growth factor-binding protein complex acid labile subunit Homo sapiens
P35858 4.44e-09 60 30 9 267 1 IGFALS Insulin-like growth factor-binding protein complex acid labile subunit Homo sapiens
O65440 2.92e-13 73 29 9 252 1 BAM3 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM3 Arabidopsis thaliana
O65440 8.79e-12 68 27 12 312 1 BAM3 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM3 Arabidopsis thaliana
Q9LS79 2.97e-13 73 30 9 236 3 RLP38 Receptor-like protein 38 Arabidopsis thaliana
Q9LS79 1.19e-12 71 28 6 250 3 RLP38 Receptor-like protein 38 Arabidopsis thaliana
Q4V8I7 3.36e-13 73 27 4 217 1 Lrrc8a Volume-regulated anion channel subunit LRRC8A Rattus norvegicus
Q09564 3.55e-13 73 28 2 169 3 phlp-2 Protein phosphatase PHLPP-like protein Caenorhabditis elegans
Q09564 5.55e-08 57 25 5 209 3 phlp-2 Protein phosphatase PHLPP-like protein Caenorhabditis elegans
Q09564 5.8e-08 57 25 6 268 3 phlp-2 Protein phosphatase PHLPP-like protein Caenorhabditis elegans
Q09564 1.8e-07 55 27 8 249 3 phlp-2 Protein phosphatase PHLPP-like protein Caenorhabditis elegans
Q6P1C6 3.61e-13 73 31 9 257 1 Lrig3 Leucine-rich repeats and immunoglobulin-like domains protein 3 Mus musculus
Q6P1C6 0.000496 45 28 9 208 1 Lrig3 Leucine-rich repeats and immunoglobulin-like domains protein 3 Mus musculus
Q9S9U3 3.9e-13 73 30 9 256 3 RLP53 Receptor-like protein 53 Arabidopsis thaliana
Q9S9U3 1.08e-10 65 27 13 276 3 RLP53 Receptor-like protein 53 Arabidopsis thaliana
Q9S9U3 3.34e-09 61 26 8 238 3 RLP53 Receptor-like protein 53 Arabidopsis thaliana
Q9S9U3 7.04e-09 60 28 11 267 3 RLP53 Receptor-like protein 53 Arabidopsis thaliana
O02833 3.96e-13 72 32 10 238 2 IGFALS Insulin-like growth factor-binding protein complex acid labile subunit Papio hamadryas
O02833 1.67e-09 62 30 9 267 2 IGFALS Insulin-like growth factor-binding protein complex acid labile subunit Papio hamadryas
Q7L1W4 4.23e-13 72 30 2 193 1 LRRC8D Volume-regulated anion channel subunit LRRC8D Homo sapiens
Q7L1W4 1.9e-12 70 25 6 292 1 LRRC8D Volume-regulated anion channel subunit LRRC8D Homo sapiens
O64566 4.6e-13 72 32 2 173 2 PIRL6 Plant intracellular Ras-group-related LRR protein 6 Arabidopsis thaliana
O64566 8.54e-12 68 27 3 221 2 PIRL6 Plant intracellular Ras-group-related LRR protein 6 Arabidopsis thaliana
O64566 3.56e-08 57 28 3 157 2 PIRL6 Plant intracellular Ras-group-related LRR protein 6 Arabidopsis thaliana
O64566 2.55e-06 52 25 4 224 2 PIRL6 Plant intracellular Ras-group-related LRR protein 6 Arabidopsis thaliana
P49606 4.81e-13 73 31 2 169 3 UAC1 Adenylate cyclase Ustilago maydis (strain 521 / FGSC 9021)
P49606 5.57e-13 72 27 5 278 3 UAC1 Adenylate cyclase Ustilago maydis (strain 521 / FGSC 9021)
P49606 2e-11 68 29 7 251 3 UAC1 Adenylate cyclase Ustilago maydis (strain 521 / FGSC 9021)
P49606 2.28e-10 65 25 5 276 3 UAC1 Adenylate cyclase Ustilago maydis (strain 521 / FGSC 9021)
P49606 1.22e-05 50 25 10 315 3 UAC1 Adenylate cyclase Ustilago maydis (strain 521 / FGSC 9021)
P49606 0.000778 44 25 2 149 3 UAC1 Adenylate cyclase Ustilago maydis (strain 521 / FGSC 9021)
Q86X40 4.86e-13 72 30 2 186 1 LRRC28 Leucine-rich repeat-containing protein 28 Homo sapiens
Q86X40 2.7e-05 48 26 1 156 1 LRRC28 Leucine-rich repeat-containing protein 28 Homo sapiens
Q86X40 0.00019 46 27 0 144 1 LRRC28 Leucine-rich repeat-containing protein 28 Homo sapiens
Q7L0X0 5.19e-13 72 32 9 255 1 TRIL TLR4 interactor with leucine rich repeats Homo sapiens
Q7L0X0 0.000503 45 34 6 155 1 TRIL TLR4 interactor with leucine rich repeats Homo sapiens
Q3ZC49 5.68e-13 71 31 4 201 2 LRRC39 Leucine-rich repeat-containing protein 39 Bos taurus
Q3ZC49 3.21e-11 66 25 2 217 2 LRRC39 Leucine-rich repeat-containing protein 39 Bos taurus
Q3ZC49 1.17e-09 61 23 1 219 2 LRRC39 Leucine-rich repeat-containing protein 39 Bos taurus
Q3ZC49 5.73e-05 47 25 2 192 2 LRRC39 Leucine-rich repeat-containing protein 39 Bos taurus
Q3ZC49 0.000147 46 27 0 122 2 LRRC39 Leucine-rich repeat-containing protein 39 Bos taurus
Q32KX5 5.87e-13 71 30 2 186 2 LRRC28 Leucine-rich repeat-containing protein 28 Bos taurus
Q32KX5 0.000764 44 26 1 154 2 LRRC28 Leucine-rich repeat-containing protein 28 Bos taurus
Q32KX5 0.001 43 27 0 124 2 LRRC28 Leucine-rich repeat-containing protein 28 Bos taurus
Q8BVU0 5.88e-13 72 25 6 261 1 Lrch3 DISP complex protein LRCH3 Mus musculus
Q8IWT6 6.29e-13 72 27 4 217 1 LRRC8A Volume-regulated anion channel subunit LRRC8A Homo sapiens
Q9DBB9 7.88e-13 72 31 8 210 1 Cpn2 Carboxypeptidase N subunit 2 Mus musculus
Q9DBB9 2.45e-10 64 30 9 231 1 Cpn2 Carboxypeptidase N subunit 2 Mus musculus
Q9DBB9 3.63e-06 51 29 7 183 1 Cpn2 Carboxypeptidase N subunit 2 Mus musculus
Q3KRC6 8.56e-13 72 26 2 189 1 Lrrc8e Volume-regulated anion channel subunit LRRC8E Rattus norvegicus
Q3KRC6 5.14e-07 54 29 2 165 1 Lrrc8e Volume-regulated anion channel subunit LRRC8E Rattus norvegicus
Q9ZUK3 9.7e-13 72 31 9 258 2 RLP19 Receptor-like protein 19 Arabidopsis thaliana
Q9ZUK3 2.45e-11 67 30 9 234 2 RLP19 Receptor-like protein 19 Arabidopsis thaliana
Q9ZUK3 1.6e-07 56 29 8 218 2 RLP19 Receptor-like protein 19 Arabidopsis thaliana
Q7KIN0 9.98e-13 72 31 8 251 1 Toll-7 Toll-like receptor 7 Drosophila melanogaster
Q7KIN0 4.2e-07 54 27 11 280 1 Toll-7 Toll-like receptor 7 Drosophila melanogaster
Q7KIN0 5.91e-07 54 31 10 213 1 Toll-7 Toll-like receptor 7 Drosophila melanogaster
Q9LVP0 1.05e-12 72 30 9 276 1 At5g63930 Probable leucine-rich repeat receptor-like protein kinase At5g63930 Arabidopsis thaliana
Q9LVP0 1.46e-09 62 25 11 314 1 At5g63930 Probable leucine-rich repeat receptor-like protein kinase At5g63930 Arabidopsis thaliana
Q9LVP0 5.9e-06 51 31 5 138 1 At5g63930 Probable leucine-rich repeat receptor-like protein kinase At5g63930 Arabidopsis thaliana
Q5Z9N5 1.29e-12 71 29 9 262 1 FON1 Leucine-rich repeat receptor-like kinase protein FLORAL ORGAN NUMBER1 Oryza sativa subsp. japonica
Q5Z9N5 1.1e-11 68 30 8 244 1 FON1 Leucine-rich repeat receptor-like kinase protein FLORAL ORGAN NUMBER1 Oryza sativa subsp. japonica
Q5Z9N5 5.51e-07 54 32 8 193 1 FON1 Leucine-rich repeat receptor-like kinase protein FLORAL ORGAN NUMBER1 Oryza sativa subsp. japonica
Q9M2Z1 1.41e-12 71 31 11 258 1 BAM2 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM2 Arabidopsis thaliana
Q9M2Z1 7.46e-12 69 28 11 274 1 BAM2 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM2 Arabidopsis thaliana
Q9M2Z1 2.14e-07 55 25 10 297 1 BAM2 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM2 Arabidopsis thaliana
A0A0R0HPY5 1.48e-12 71 29 10 250 2 CLV1A Leucine-rich repeat receptor-like kinase protein CLV1a Glycine max
A0A0R0HPY5 3.79e-08 58 26 8 249 2 CLV1A Leucine-rich repeat receptor-like kinase protein CLV1a Glycine max
A0A0R0HPY5 2.29e-07 55 24 10 278 2 CLV1A Leucine-rich repeat receptor-like kinase protein CLV1a Glycine max
P0DJM0 1.59e-12 71 33 13 276 1 inlA Internalin A Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0DJM0 2.09e-08 58 31 11 241 1 inlA Internalin A Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q723K6 1.59e-12 71 33 13 276 3 inlA Internalin A Listeria monocytogenes serotype 4b (strain F2365)
Q723K6 5.73e-08 57 31 11 241 3 inlA Internalin A Listeria monocytogenes serotype 4b (strain F2365)
G2K3G6 1.65e-12 71 33 13 276 3 inlA Internalin A Listeria monocytogenes serotype 1/2a (strain 10403S)
G2K3G6 2.49e-08 58 31 11 241 3 inlA Internalin A Listeria monocytogenes serotype 1/2a (strain 10403S)
C0LGQ5 1.74e-12 71 27 9 251 1 GSO1 LRR receptor-like serine/threonine-protein kinase GSO1 Arabidopsis thaliana
C0LGQ5 2.35e-11 67 27 9 237 1 GSO1 LRR receptor-like serine/threonine-protein kinase GSO1 Arabidopsis thaliana
C0LGQ5 8.34e-11 66 33 9 209 1 GSO1 LRR receptor-like serine/threonine-protein kinase GSO1 Arabidopsis thaliana
C0LGQ5 1.35e-08 59 30 10 250 1 GSO1 LRR receptor-like serine/threonine-protein kinase GSO1 Arabidopsis thaliana
C0LGQ5 2.33e-08 58 28 9 261 1 GSO1 LRR receptor-like serine/threonine-protein kinase GSO1 Arabidopsis thaliana
C0LGQ5 2.11e-06 52 29 6 167 1 GSO1 LRR receptor-like serine/threonine-protein kinase GSO1 Arabidopsis thaliana
Q7F8Q9 1.97e-12 71 29 11 280 2 MSL1 Leucine-rich repeat receptor protein kinase MSL1 Oryza sativa subsp. japonica
Q7F8Q9 6.05e-07 54 27 8 257 2 MSL1 Leucine-rich repeat receptor protein kinase MSL1 Oryza sativa subsp. japonica
Q7F8Q9 0.000167 47 25 10 300 2 MSL1 Leucine-rich repeat receptor protein kinase MSL1 Oryza sativa subsp. japonica
C0LGS2 2.02e-12 70 30 10 292 1 At4g36180 Probable LRR receptor-like serine/threonine-protein kinase At4g36180 Arabidopsis thaliana
C0LGS2 1.1e-09 62 26 9 302 1 At4g36180 Probable LRR receptor-like serine/threonine-protein kinase At4g36180 Arabidopsis thaliana
C0LGS2 6.15e-06 51 28 11 257 1 At4g36180 Probable LRR receptor-like serine/threonine-protein kinase At4g36180 Arabidopsis thaliana
Q9FL28 2.09e-12 70 29 10 275 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Arabidopsis thaliana
Q9FL28 5.8e-12 69 28 9 313 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Arabidopsis thaliana
Q9FL28 5.31e-11 66 26 10 301 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Arabidopsis thaliana
Q9FL28 2.5e-08 58 28 9 221 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Arabidopsis thaliana
Q9FL28 0.000101 47 28 16 272 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Arabidopsis thaliana
Q80ZI6 2.15e-12 70 38 0 105 1 Lrsam1 E3 ubiquitin-protein ligase LRSAM1 Mus musculus
Q80ZI6 2.58e-08 58 33 2 110 1 Lrsam1 E3 ubiquitin-protein ligase LRSAM1 Mus musculus
Q80ZI6 8.3e-07 53 29 1 128 1 Lrsam1 E3 ubiquitin-protein ligase LRSAM1 Mus musculus
Q80ZI6 0.0002 46 25 1 126 1 Lrsam1 E3 ubiquitin-protein ligase LRSAM1 Mus musculus
Q8N456 2.47e-12 68 27 1 143 1 LRRC18 Leucine-rich repeat-containing protein 18 Homo sapiens
Q8N456 5.48e-09 59 29 1 148 1 LRRC18 Leucine-rich repeat-containing protein 18 Homo sapiens
Q8N456 1.2e-06 52 25 1 139 1 LRRC18 Leucine-rich repeat-containing protein 18 Homo sapiens
Q8N456 4.56e-05 47 29 1 117 1 LRRC18 Leucine-rich repeat-containing protein 18 Homo sapiens
Q93YT3 2.61e-12 70 29 10 249 2 RLP50 Receptor-like protein 50 Arabidopsis thaliana
Q93YT3 2.35e-10 64 26 10 284 2 RLP50 Receptor-like protein 50 Arabidopsis thaliana
Q93YT3 7.44e-07 53 23 11 274 2 RLP50 Receptor-like protein 50 Arabidopsis thaliana
Q93YT3 2.84e-05 49 34 5 128 2 RLP50 Receptor-like protein 50 Arabidopsis thaliana
Q93YT3 0.000189 46 26 9 227 2 RLP50 Receptor-like protein 50 Arabidopsis thaliana
O60346 3.15e-12 70 28 9 259 1 PHLPP1 PH domain leucine-rich repeat-containing protein phosphatase 1 Homo sapiens
O60346 7.9e-10 63 22 6 268 1 PHLPP1 PH domain leucine-rich repeat-containing protein phosphatase 1 Homo sapiens
O60346 5.82e-07 54 26 10 247 1 PHLPP1 PH domain leucine-rich repeat-containing protein phosphatase 1 Homo sapiens
O60346 1.05e-06 53 24 2 170 1 PHLPP1 PH domain leucine-rich repeat-containing protein phosphatase 1 Homo sapiens
O60346 2.33e-05 49 25 5 205 1 PHLPP1 PH domain leucine-rich repeat-containing protein phosphatase 1 Homo sapiens
E9Q7T7 3.17e-12 70 32 7 184 1 Chadl Chondroadherin-like protein Mus musculus
E9Q7T7 3.68e-09 60 32 7 169 1 Chadl Chondroadherin-like protein Mus musculus
E9Q7T7 4.69e-08 57 36 6 154 1 Chadl Chondroadherin-like protein Mus musculus
E9Q7T7 9.02e-05 47 31 8 187 1 Chadl Chondroadherin-like protein Mus musculus
Q9LHP4 3.32e-12 70 29 10 263 1 RGI1 LRR receptor-like serine/threonine-protein kinase RGI1 Arabidopsis thaliana
Q9LHP4 1.98e-11 68 27 10 274 1 RGI1 LRR receptor-like serine/threonine-protein kinase RGI1 Arabidopsis thaliana
Q9LHP4 2.45e-06 52 24 7 219 1 RGI1 LRR receptor-like serine/threonine-protein kinase RGI1 Arabidopsis thaliana
Q6ZVD8 3.48e-12 70 28 4 247 1 PHLPP2 PH domain leucine-rich repeat-containing protein phosphatase 2 Homo sapiens
Q6ZVD8 2.97e-08 58 37 0 98 1 PHLPP2 PH domain leucine-rich repeat-containing protein phosphatase 2 Homo sapiens
Q6ZVD8 3.62e-08 58 29 7 248 1 PHLPP2 PH domain leucine-rich repeat-containing protein phosphatase 2 Homo sapiens
Q8CHE4 3.92e-12 70 28 9 257 1 Phlpp1 PH domain leucine-rich repeat-containing protein phosphatase 1 Mus musculus
Q8CHE4 4.25e-09 60 23 5 264 1 Phlpp1 PH domain leucine-rich repeat-containing protein phosphatase 1 Mus musculus
Q8CHE4 9.43e-07 53 25 2 153 1 Phlpp1 PH domain leucine-rich repeat-containing protein phosphatase 1 Mus musculus
Q8CHE4 3.34e-06 52 25 5 205 1 Phlpp1 PH domain leucine-rich repeat-containing protein phosphatase 1 Mus musculus
Q8CHE4 1.93e-05 49 26 3 158 1 Phlpp1 PH domain leucine-rich repeat-containing protein phosphatase 1 Mus musculus
Q8CHE4 0.000283 46 30 0 97 1 Phlpp1 PH domain leucine-rich repeat-containing protein phosphatase 1 Mus musculus
C0LGX3 4.06e-12 70 30 11 249 1 HSL2 LRR receptor-like serine/threonine-protein kinase HSL2 Arabidopsis thaliana
C0LGX3 9.48e-08 56 34 5 130 1 HSL2 LRR receptor-like serine/threonine-protein kinase HSL2 Arabidopsis thaliana
C0LGX3 6.45e-06 51 26 11 278 1 HSL2 LRR receptor-like serine/threonine-protein kinase HSL2 Arabidopsis thaliana
C0LGX3 7.86e-06 50 27 10 196 1 HSL2 LRR receptor-like serine/threonine-protein kinase HSL2 Arabidopsis thaliana
F4J8G2 4.11e-12 70 32 9 225 3 RLP33 Receptor-like protein 33 Arabidopsis thaliana
F4J8G2 2.54e-06 52 30 10 213 3 RLP33 Receptor-like protein 33 Arabidopsis thaliana
Q9SVM3 4.63e-12 69 26 9 260 2 RLP49 Receptor-like protein 49 Arabidopsis thaliana
Q9SVM3 6.82e-06 50 26 9 268 2 RLP49 Receptor-like protein 49 Arabidopsis thaliana
Q9SVM3 8.01e-06 50 25 12 284 2 RLP49 Receptor-like protein 49 Arabidopsis thaliana
Q9SVM3 0.000179 46 36 3 96 2 RLP49 Receptor-like protein 49 Arabidopsis thaliana
Q9SVM3 0.000277 45 25 6 207 2 RLP49 Receptor-like protein 49 Arabidopsis thaliana
Q9SVM3 0.000662 44 27 9 229 2 RLP49 Receptor-like protein 49 Arabidopsis thaliana
Q9LRT1 5.23e-12 69 29 10 282 1 At3g28040 Probably inactive leucine-rich repeat receptor-like protein kinase At3g28040 Arabidopsis thaliana
Q9LRT1 5.43e-12 69 30 8 236 1 At3g28040 Probably inactive leucine-rich repeat receptor-like protein kinase At3g28040 Arabidopsis thaliana
E7FE13 5.94e-12 69 29 9 251 2 lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Danio rerio
E7FE13 6.87e-09 60 29 8 206 2 lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Danio rerio
Q00874 6.63e-12 68 30 9 223 2 DRT100 DNA damage-repair/toleration protein DRT100 Arabidopsis thaliana
Q00874 3.32e-10 63 28 8 235 2 DRT100 DNA damage-repair/toleration protein DRT100 Arabidopsis thaliana
O75094 6.77e-12 69 35 7 156 1 SLIT3 Slit homolog 3 protein Homo sapiens
O75094 1.32e-09 62 33 6 142 1 SLIT3 Slit homolog 3 protein Homo sapiens
O75094 0.00052 45 29 3 98 1 SLIT3 Slit homolog 3 protein Homo sapiens
O75094 0.000539 45 28 8 157 1 SLIT3 Slit homolog 3 protein Homo sapiens
Q9BYS8 6.79e-12 68 27 3 208 1 LRRC2 Leucine-rich repeat-containing protein 2 Homo sapiens
Q9BYS8 3.78e-11 66 27 1 174 1 LRRC2 Leucine-rich repeat-containing protein 2 Homo sapiens
Q9BYS8 1.16e-09 62 25 1 216 1 LRRC2 Leucine-rich repeat-containing protein 2 Homo sapiens
Q9BYS8 4e-09 60 29 2 150 1 LRRC2 Leucine-rich repeat-containing protein 2 Homo sapiens
Q9BYS8 5.38e-07 53 23 2 189 1 LRRC2 Leucine-rich repeat-containing protein 2 Homo sapiens
Q9BYS8 3.79e-06 51 27 4 179 1 LRRC2 Leucine-rich repeat-containing protein 2 Homo sapiens
Q9C9H7 6.89e-12 69 31 9 256 2 RLP12 Receptor-like protein 12 Arabidopsis thaliana
Q9C9H7 2.13e-09 61 34 6 170 2 RLP12 Receptor-like protein 12 Arabidopsis thaliana
Q9C9H7 2.03e-05 49 25 12 255 2 RLP12 Receptor-like protein 12 Arabidopsis thaliana
Q9C9H7 0.000265 46 27 9 270 2 RLP12 Receptor-like protein 12 Arabidopsis thaliana
Q9WTR8 7.33e-12 69 28 9 259 1 Phlpp1 PH domain leucine-rich repeat protein phosphatase 1 Rattus norvegicus
Q9WTR8 4.02e-10 64 23 6 268 1 Phlpp1 PH domain leucine-rich repeat protein phosphatase 1 Rattus norvegicus
Q9WTR8 8.86e-07 53 24 2 170 1 Phlpp1 PH domain leucine-rich repeat protein phosphatase 1 Rattus norvegicus
Q9WTR8 3.15e-05 48 25 5 205 1 Phlpp1 PH domain leucine-rich repeat protein phosphatase 1 Rattus norvegicus
Q9WTR8 0.000147 47 30 0 97 1 Phlpp1 PH domain leucine-rich repeat protein phosphatase 1 Rattus norvegicus
Q6R6I6 8.15e-12 68 28 10 270 2 Rxfp1 Relaxin receptor 1 Rattus norvegicus
Q8RZV7 8.31e-12 69 31 7 205 1 MSP1 Leucine-rich repeat receptor protein kinase MSP1 Oryza sativa subsp. japonica
Q8RZV7 5.23e-09 60 31 7 190 1 MSP1 Leucine-rich repeat receptor protein kinase MSP1 Oryza sativa subsp. japonica
Q8RZV7 2.44e-05 49 29 10 233 1 MSP1 Leucine-rich repeat receptor protein kinase MSP1 Oryza sativa subsp. japonica
Q8RZV7 0.00034 45 26 11 311 1 MSP1 Leucine-rich repeat receptor protein kinase MSP1 Oryza sativa subsp. japonica
Q8RZV7 0.000346 45 28 9 219 1 MSP1 Leucine-rich repeat receptor protein kinase MSP1 Oryza sativa subsp. japonica
Q6ZCZ2 8.52e-12 68 29 12 285 2 BRL3 Brassinosteroid LRR receptor kinase BRL3 Oryza sativa subsp. japonica
Q6ZCZ2 1.1e-08 59 34 13 241 2 BRL3 Brassinosteroid LRR receptor kinase BRL3 Oryza sativa subsp. japonica
Q9HBX8 9.15e-12 68 31 8 206 1 LGR6 Leucine-rich repeat-containing G-protein coupled receptor 6 Homo sapiens
Q9HBX8 2.61e-11 67 28 9 246 1 LGR6 Leucine-rich repeat-containing G-protein coupled receptor 6 Homo sapiens
Q9HBX8 5.79e-08 57 27 10 258 1 LGR6 Leucine-rich repeat-containing G-protein coupled receptor 6 Homo sapiens
Q9HBX8 3.78e-06 52 40 5 99 1 LGR6 Leucine-rich repeat-containing G-protein coupled receptor 6 Homo sapiens
Q9HBX8 3.27e-05 48 24 13 318 1 LGR6 Leucine-rich repeat-containing G-protein coupled receptor 6 Homo sapiens
Q3UVD5 9.32e-12 68 29 10 232 2 Lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Mus musculus
Q3UVD5 4.5e-10 63 29 9 246 2 Lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Mus musculus
Q3UVD5 5.81e-10 63 29 10 258 2 Lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Mus musculus
Q940E8 1.06e-11 68 32 12 259 1 FEA2 Leucine-rich repeat receptor-like protein FASCIATED EAR2 Zea mays
Q940E8 0.000417 45 38 2 77 1 FEA2 Leucine-rich repeat receptor-like protein FASCIATED EAR2 Zea mays
Q3UV48 1.19e-11 67 28 3 217 2 Lrrc30 Leucine-rich repeat-containing protein 30 Mus musculus
Q3UV48 9.53e-10 62 29 1 158 2 Lrrc30 Leucine-rich repeat-containing protein 30 Mus musculus
Q3UV48 3.65e-08 57 25 0 187 2 Lrrc30 Leucine-rich repeat-containing protein 30 Mus musculus
Q3UV48 1.04e-07 55 25 0 158 2 Lrrc30 Leucine-rich repeat-containing protein 30 Mus musculus
Q3UV48 1.2e-07 55 25 2 193 2 Lrrc30 Leucine-rich repeat-containing protein 30 Mus musculus
Q5G5D8 1.22e-11 67 31 2 173 2 PIRL7 Plant intracellular Ras-group-related LRR protein 7 Arabidopsis thaliana
Q5G5D8 2.57e-11 67 28 5 230 2 PIRL7 Plant intracellular Ras-group-related LRR protein 7 Arabidopsis thaliana
Q5G5D8 6.72e-09 59 29 3 167 2 PIRL7 Plant intracellular Ras-group-related LRR protein 7 Arabidopsis thaliana
Q5G5D8 0.000108 47 25 4 203 2 PIRL7 Plant intracellular Ras-group-related LRR protein 7 Arabidopsis thaliana
Q7XDQ7 1.28e-11 67 29 2 180 2 IRL8 Plant intracellular Ras-group-related LRR protein 8 Oryza sativa subsp. japonica
Q7XDQ7 3.3e-11 66 24 2 178 2 IRL8 Plant intracellular Ras-group-related LRR protein 8 Oryza sativa subsp. japonica
Q7XDQ7 1.08e-07 56 29 2 141 2 IRL8 Plant intracellular Ras-group-related LRR protein 8 Oryza sativa subsp. japonica
Q7XDQ7 1.94e-05 49 27 0 116 2 IRL8 Plant intracellular Ras-group-related LRR protein 8 Oryza sativa subsp. japonica
Q9SYQ8 1.29e-11 68 30 10 238 1 CLV1 Receptor protein kinase CLAVATA1 Arabidopsis thaliana
Q9SYQ8 3.97e-07 54 28 10 243 1 CLV1 Receptor protein kinase CLAVATA1 Arabidopsis thaliana
Q9SYQ8 1.01e-06 53 26 8 221 1 CLV1 Receptor protein kinase CLAVATA1 Arabidopsis thaliana
Q9SYQ8 1.19e-05 50 30 4 126 1 CLV1 Receptor protein kinase CLAVATA1 Arabidopsis thaliana
Q9SYQ8 7.25e-05 47 27 9 233 1 CLV1 Receptor protein kinase CLAVATA1 Arabidopsis thaliana
Q6R6I7 1.34e-11 68 28 10 270 2 Rxfp1 Relaxin receptor 1 Mus musculus
O43300 1.46e-11 68 34 8 198 1 LRRTM2 Leucine-rich repeat transmembrane neuronal protein 2 Homo sapiens
Q54Y32 1.5e-11 68 31 4 183 3 mpl3 MAP kinase phosphatase with leucine-rich repeats protein 3 Dictyostelium discoideum
Q54Y32 2.19e-05 49 33 2 108 3 mpl3 MAP kinase phosphatase with leucine-rich repeats protein 3 Dictyostelium discoideum
Q54Y32 0.000441 45 27 2 137 3 mpl3 MAP kinase phosphatase with leucine-rich repeats protein 3 Dictyostelium discoideum
Q54Y32 0.000664 44 28 2 124 3 mpl3 MAP kinase phosphatase with leucine-rich repeats protein 3 Dictyostelium discoideum
Q01631 1.58e-11 68 24 7 297 1 cr-1 Adenylate cyclase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q01631 3.02e-09 61 24 3 270 1 cr-1 Adenylate cyclase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q01631 3.34e-08 58 28 4 204 1 cr-1 Adenylate cyclase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q01631 2.1e-07 55 31 0 119 1 cr-1 Adenylate cyclase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P22792 1.62e-11 67 34 9 214 1 CPN2 Carboxypeptidase N subunit 2 Homo sapiens
P22792 8.03e-05 47 30 9 237 1 CPN2 Carboxypeptidase N subunit 2 Homo sapiens
Q6UWE0 1.67e-11 68 36 0 104 1 LRSAM1 E3 ubiquitin-protein ligase LRSAM1 Homo sapiens
Q6UWE0 4.01e-08 57 31 0 88 1 LRSAM1 E3 ubiquitin-protein ligase LRSAM1 Homo sapiens
Q6UWE0 7.99e-07 53 27 1 123 1 LRSAM1 E3 ubiquitin-protein ligase LRSAM1 Homo sapiens
Q6UWE0 2.98e-05 48 23 1 126 1 LRSAM1 E3 ubiquitin-protein ligase LRSAM1 Homo sapiens
Q6UWE0 0.000464 45 29 0 85 1 LRSAM1 E3 ubiquitin-protein ligase LRSAM1 Homo sapiens
Q8BXA7 1.92e-11 68 29 7 250 1 Phlpp2 PH domain leucine-rich repeat-containing protein phosphatase 2 Mus musculus
Q8BXA7 1.06e-09 62 29 6 248 1 Phlpp2 PH domain leucine-rich repeat-containing protein phosphatase 2 Mus musculus
Q8BXA7 3.59e-07 55 35 0 98 1 Phlpp2 PH domain leucine-rich repeat-containing protein phosphatase 2 Mus musculus
Q8BXA7 1.24e-05 50 24 5 224 1 Phlpp2 PH domain leucine-rich repeat-containing protein phosphatase 2 Mus musculus
A6NM36 2.04e-11 66 28 0 185 4 LRRC30 Leucine-rich repeat-containing protein 30 Homo sapiens
A6NM36 2.44e-11 66 28 2 222 4 LRRC30 Leucine-rich repeat-containing protein 30 Homo sapiens
A6NM36 5.84e-11 65 29 2 165 4 LRRC30 Leucine-rich repeat-containing protein 30 Homo sapiens
A6NM36 3.81e-08 57 25 0 187 4 LRRC30 Leucine-rich repeat-containing protein 30 Homo sapiens
B0BLW3 2.16e-11 67 33 9 205 1 lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Xenopus tropicalis
B0BLW3 3.65e-11 67 27 10 272 1 lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Xenopus tropicalis
B0BLW3 7.76e-10 63 27 12 301 1 lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Xenopus tropicalis
B0BLW3 4.28e-06 51 28 5 153 1 lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Xenopus tropicalis
P0DL10 2.29e-11 67 29 11 284 2 TD1 Leucine-rich repeat receptor-like kinase protein THICK TASSEL DWARF1 Zea mays
P0DL10 5.56e-09 60 27 10 276 2 TD1 Leucine-rich repeat receptor-like kinase protein THICK TASSEL DWARF1 Zea mays
P0DL10 0.0001 47 25 10 275 2 TD1 Leucine-rich repeat receptor-like kinase protein THICK TASSEL DWARF1 Zea mays
A5PK13 2.3e-11 67 26 5 242 2 LRRC8C Volume-regulated anion channel subunit LRRC8C Bos taurus
A5PK13 3.38e-10 64 28 3 184 2 LRRC8C Volume-regulated anion channel subunit LRRC8C Bos taurus
Q9M0G7 2.34e-11 67 29 9 206 1 MIK1 MDIS1-interacting receptor like kinase 1 Arabidopsis thaliana
Q9M0G7 1.69e-09 62 29 9 257 1 MIK1 MDIS1-interacting receptor like kinase 1 Arabidopsis thaliana
Q9M0G7 2.79e-09 61 26 10 268 1 MIK1 MDIS1-interacting receptor like kinase 1 Arabidopsis thaliana
Q9M0G7 4.25e-06 51 22 9 301 1 MIK1 MDIS1-interacting receptor like kinase 1 Arabidopsis thaliana
Q9LFG1 2.36e-11 67 32 10 234 1 At3g53590 Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At3g53590 Arabidopsis thaliana
Q5S006 2.43e-11 67 29 8 225 1 Lrrk2 Leucine-rich repeat serine/threonine-protein kinase 2 Mus musculus
Q5S006 4.83e-10 63 29 7 199 1 Lrrk2 Leucine-rich repeat serine/threonine-protein kinase 2 Mus musculus
Q8TDW0 2.46e-11 67 26 5 242 1 LRRC8C Volume-regulated anion channel subunit LRRC8C Homo sapiens
Q8TDW0 3.47e-10 64 28 3 184 1 LRRC8C Volume-regulated anion channel subunit LRRC8C Homo sapiens
F7D3V9 2.63e-11 67 31 11 268 2 lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Xenopus tropicalis
F7D3V9 4.53e-09 60 29 8 221 2 lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Xenopus tropicalis
F7D3V9 2.21e-07 55 31 8 209 2 lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Xenopus tropicalis
P47735 2.88e-11 67 30 8 230 1 RLK5 Receptor-like protein kinase 5 Arabidopsis thaliana
P47735 2.3e-09 61 28 8 245 1 RLK5 Receptor-like protein kinase 5 Arabidopsis thaliana
P47735 1.3e-06 53 29 11 224 1 RLK5 Receptor-like protein kinase 5 Arabidopsis thaliana
P47735 0.000753 44 27 7 170 1 RLK5 Receptor-like protein kinase 5 Arabidopsis thaliana
Q9FN37 3.07e-11 67 27 11 281 1 PSKR2 Phytosulfokine receptor 2 Arabidopsis thaliana
Q9FN37 7.61e-07 53 25 9 227 1 PSKR2 Phytosulfokine receptor 2 Arabidopsis thaliana
Q9FN37 0.000344 45 24 9 258 1 PSKR2 Phytosulfokine receptor 2 Arabidopsis thaliana
O94898 3.17e-11 67 29 9 278 1 LRIG2 Leucine-rich repeats and immunoglobulin-like domains protein 2 Homo sapiens
O94898 2.23e-10 64 27 8 276 1 LRIG2 Leucine-rich repeats and immunoglobulin-like domains protein 2 Homo sapiens
G7JIK2 3.2e-11 67 29 10 244 1 SUNN Leucine-rich repeat receptor-like kinase protein SUNN Medicago truncatula
G7JIK2 1.13e-09 62 27 8 247 1 SUNN Leucine-rich repeat receptor-like kinase protein SUNN Medicago truncatula
G7JIK2 1.93e-05 49 26 11 268 1 SUNN Leucine-rich repeat receptor-like kinase protein SUNN Medicago truncatula
G7JIK2 6e-05 48 25 9 234 1 SUNN Leucine-rich repeat receptor-like kinase protein SUNN Medicago truncatula
C0LGW6 3.43e-11 67 28 10 236 1 ERL1 LRR receptor-like serine/threonine-protein kinase ERL1 Arabidopsis thaliana
C0LGW6 9.43e-09 59 26 9 275 1 ERL1 LRR receptor-like serine/threonine-protein kinase ERL1 Arabidopsis thaliana
C0LGW6 2.23e-08 58 26 10 254 1 ERL1 LRR receptor-like serine/threonine-protein kinase ERL1 Arabidopsis thaliana
Q9XSD9 4.21e-11 66 32 9 230 2 DCN Decorin Sus scrofa
Q9XSD9 3.15e-06 51 25 7 213 2 DCN Decorin Sus scrofa
Q9SRL7 4.29e-11 67 30 10 226 3 RLP35 Receptor-like protein 35 Arabidopsis thaliana
Q9SRL7 2.28e-05 49 38 3 93 3 RLP35 Receptor-like protein 35 Arabidopsis thaliana
O46542 4.37e-11 66 31 10 232 2 DCN Decorin Equus caballus
O46542 1.21e-05 49 24 7 213 2 DCN Decorin Equus caballus
Q6JN46 4.37e-11 67 27 9 232 1 EIX2 Receptor-like protein EIX2 Solanum lycopersicum
Q6JN46 2.09e-07 55 27 5 208 1 EIX2 Receptor-like protein EIX2 Solanum lycopersicum
Q6JN46 4.74e-06 51 27 13 303 1 EIX2 Receptor-like protein EIX2 Solanum lycopersicum
Q6JN46 1.16e-05 50 31 12 231 1 EIX2 Receptor-like protein EIX2 Solanum lycopersicum
Q6JN46 0.000198 46 25 7 196 1 EIX2 Receptor-like protein EIX2 Solanum lycopersicum
Q54XZ5 4.51e-11 67 25 6 271 3 DDB_G0278509 Probable serine/threonine-protein kinase DDB_G0278509 Dictyostelium discoideum
Q54XZ5 0.000601 45 26 3 144 3 DDB_G0278509 Probable serine/threonine-protein kinase DDB_G0278509 Dictyostelium discoideum
Q8RX63 5.27e-11 66 29 10 255 2 RLP31 Receptor-like protein 31 Arabidopsis thaliana
Q8RX63 1.25e-10 65 28 9 235 2 RLP31 Receptor-like protein 31 Arabidopsis thaliana
Q922Q8 5.54e-11 65 43 1 100 1 Lrrc59 Leucine-rich repeat-containing protein 59 Mus musculus
Q922Q8 0.000127 46 33 2 118 1 Lrrc59 Leucine-rich repeat-containing protein 59 Mus musculus
Q922Q8 0.000164 46 32 0 96 1 Lrrc59 Leucine-rich repeat-containing protein 59 Mus musculus
Q922Q8 0.000653 44 30 1 99 1 Lrrc59 Leucine-rich repeat-containing protein 59 Mus musculus
F4I2N7 5.6e-11 66 29 6 236 1 RLK7 Receptor-like protein kinase 7 Arabidopsis thaliana
F4I2N7 1.82e-10 65 29 9 274 1 RLK7 Receptor-like protein kinase 7 Arabidopsis thaliana
Q9VUN0 6.41e-11 66 30 10 254 1 Toll-6 Toll-like receptor 6 Drosophila melanogaster
Q9VUN0 1.19e-09 62 28 10 292 1 Toll-6 Toll-like receptor 6 Drosophila melanogaster
Q9VUN0 5.53e-07 54 31 8 182 1 Toll-6 Toll-like receptor 6 Drosophila melanogaster
Q5RJR8 6.5e-11 65 43 1 100 1 Lrrc59 Leucine-rich repeat-containing protein 59 Rattus norvegicus
Q5RJR8 0.000134 46 33 2 118 1 Lrrc59 Leucine-rich repeat-containing protein 59 Rattus norvegicus
Q5RJR8 0.000189 45 32 0 96 1 Lrrc59 Leucine-rich repeat-containing protein 59 Rattus norvegicus
Q5RJR8 0.000728 44 30 1 99 1 Lrrc59 Leucine-rich repeat-containing protein 59 Rattus norvegicus
Q9FL51 6.53e-11 66 28 9 247 3 At5g06940 Probably inactive leucine-rich repeat receptor-like protein kinase At5g06940 Arabidopsis thaliana
Q9FL51 5.07e-06 51 25 11 255 3 At5g06940 Probably inactive leucine-rich repeat receptor-like protein kinase At5g06940 Arabidopsis thaliana
Q9FL51 0.000484 45 28 4 137 3 At5g06940 Probably inactive leucine-rich repeat receptor-like protein kinase At5g06940 Arabidopsis thaliana
Q8GRU6 7.25e-11 66 30 11 248 1 HAR1 Leucine-rich repeat receptor-like kinase protein HAR1 Lotus japonicus
Q8GRU6 1.16e-08 59 25 7 226 1 HAR1 Leucine-rich repeat receptor-like kinase protein HAR1 Lotus japonicus
A0N0X6 8.09e-11 65 32 9 224 3 LRRN1 Leucine-rich repeat neuronal protein 1 Bos taurus
D4A7P2 8.47e-11 65 33 8 198 1 Lrrtm2 Leucine-rich repeat transmembrane neuronal protein 2 Rattus norvegicus
Q9VPF0 8.85e-11 66 29 10 258 1 atk Protein artichoke Drosophila melanogaster
Q9VPF0 1.56e-06 53 27 14 293 1 atk Protein artichoke Drosophila melanogaster
Q9VPF0 2.39e-06 52 29 10 265 1 atk Protein artichoke Drosophila melanogaster
O49545 9.16e-11 65 29 8 217 1 BAM1 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM1 Arabidopsis thaliana
Q96AG4 9.4e-11 64 43 1 100 1 LRRC59 Leucine-rich repeat-containing protein 59 Homo sapiens
Q96AG4 5.61e-05 47 33 0 96 1 LRRC59 Leucine-rich repeat-containing protein 59 Homo sapiens
Q96AG4 0.000282 45 31 1 110 1 LRRC59 Leucine-rich repeat-containing protein 59 Homo sapiens
Q96AG4 0.000289 45 31 1 99 1 LRRC59 Leucine-rich repeat-containing protein 59 Homo sapiens
Q96AG4 0.000857 43 33 0 78 1 LRRC59 Leucine-rich repeat-containing protein 59 Homo sapiens
Q658G7 9.45e-11 65 27 11 280 1 SIK1 LRR receptor-like serine/threonine-protein kinase SIK1 Oryza sativa subsp. japonica
Q658G7 2.49e-10 64 28 6 193 1 SIK1 LRR receptor-like serine/threonine-protein kinase SIK1 Oryza sativa subsp. japonica
Q658G7 2.94e-08 58 27 7 242 1 SIK1 LRR receptor-like serine/threonine-protein kinase SIK1 Oryza sativa subsp. japonica
Q8VDB8 9.84e-11 65 26 2 194 2 Lrrc2 Leucine-rich repeat-containing protein 2 Mus musculus
Q8VDB8 1.56e-09 61 32 1 126 2 Lrrc2 Leucine-rich repeat-containing protein 2 Mus musculus
Q8VDB8 3.42e-08 57 25 3 185 2 Lrrc2 Leucine-rich repeat-containing protein 2 Mus musculus
Q8VDB8 3.85e-08 57 26 2 176 2 Lrrc2 Leucine-rich repeat-containing protein 2 Mus musculus
Q8VDB8 1.74e-05 49 28 3 143 2 Lrrc2 Leucine-rich repeat-containing protein 2 Mus musculus
Q1PEN0 1.01e-10 65 30 10 258 2 RLP36 Receptor-like protein 36 Arabidopsis thaliana
Q1PEN0 2.02e-07 55 30 8 211 2 RLP36 Receptor-like protein 36 Arabidopsis thaliana
Q1PEN0 2.96e-07 55 27 11 289 2 RLP36 Receptor-like protein 36 Arabidopsis thaliana
Q8BGA3 1.05e-10 65 33 8 198 2 Lrrtm2 Leucine-rich repeat transmembrane neuronal protein 2 Mus musculus
O49318 1.05e-10 65 27 10 255 2 At2g33170 Probable leucine-rich repeat receptor-like protein kinase At2g33170 Arabidopsis thaliana
O49318 2.45e-10 64 28 8 243 2 At2g33170 Probable leucine-rich repeat receptor-like protein kinase At2g33170 Arabidopsis thaliana
O49318 2.71e-10 64 27 10 252 2 At2g33170 Probable leucine-rich repeat receptor-like protein kinase At2g33170 Arabidopsis thaliana
O49318 2.78e-05 49 29 8 201 2 At2g33170 Probable leucine-rich repeat receptor-like protein kinase At2g33170 Arabidopsis thaliana
P70389 1.2e-10 65 30 8 243 1 Igfals Insulin-like growth factor-binding protein complex acid labile subunit Mus musculus
P70389 9.01e-07 53 29 7 187 1 Igfals Insulin-like growth factor-binding protein complex acid labile subunit Mus musculus
Q68F79 1.2e-10 65 33 1 143 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus tropicalis
Q9SN46 1.33e-10 65 27 9 229 2 LRX5 Leucine-rich repeat extensin-like protein 5 Arabidopsis thaliana
C0LGV1 1.51e-10 65 30 10 266 1 RGI2 LRR receptor-like serine/threonine-protein kinase RGI2 Arabidopsis thaliana
C0LGV1 3.97e-08 58 26 8 242 1 RGI2 LRR receptor-like serine/threonine-protein kinase RGI2 Arabidopsis thaliana
C0LGV1 0.000352 45 25 8 214 1 RGI2 LRR receptor-like serine/threonine-protein kinase RGI2 Arabidopsis thaliana
Q6UXK5 1.54e-10 65 31 10 230 1 LRRN1 Leucine-rich repeat neuronal protein 1 Homo sapiens
Q2QZF2 1.54e-10 65 26 2 173 2 PIK5-NP Disease resistance protein PIK5-NP Oryza sativa subsp. japonica
Q2QZF2 1.88e-10 65 28 2 148 2 PIK5-NP Disease resistance protein PIK5-NP Oryza sativa subsp. japonica
Q2QZF2 2.2e-10 64 29 1 134 2 PIK5-NP Disease resistance protein PIK5-NP Oryza sativa subsp. japonica
Q2QZF2 9.73e-09 59 28 2 129 2 PIK5-NP Disease resistance protein PIK5-NP Oryza sativa subsp. japonica
Q2QZF2 9.44e-06 50 25 10 264 2 PIK5-NP Disease resistance protein PIK5-NP Oryza sativa subsp. japonica
Q2QZF2 0.000345 45 21 10 269 2 PIK5-NP Disease resistance protein PIK5-NP Oryza sativa subsp. japonica
I1Z695 1.55e-10 65 27 9 281 1 ER2 LRR receptor-like serine/threonine-protein kinase ER2 Oryza sativa subsp. japonica
I1Z695 1.19e-08 59 29 9 234 1 ER2 LRR receptor-like serine/threonine-protein kinase ER2 Oryza sativa subsp. japonica
I1Z695 7.9e-08 57 25 8 272 1 ER2 LRR receptor-like serine/threonine-protein kinase ER2 Oryza sativa subsp. japonica
I1Z695 6.27e-06 51 31 3 121 1 ER2 LRR receptor-like serine/threonine-protein kinase ER2 Oryza sativa subsp. japonica
Q9LJS2 1.62e-10 65 27 11 271 3 RLP41 Receptor-like protein 41 Arabidopsis thaliana
Q9LJS2 0.000189 46 25 8 284 3 RLP41 Receptor-like protein 41 Arabidopsis thaliana
C0LGE4 1.62e-10 65 26 8 250 1 At1g12460 Probable LRR receptor-like serine/threonine-protein kinase At1g12460 Arabidopsis thaliana
C0LGE4 2.71e-06 52 27 7 203 1 At1g12460 Probable LRR receptor-like serine/threonine-protein kinase At1g12460 Arabidopsis thaliana
C0LGE4 9.68e-06 50 25 9 233 1 At1g12460 Probable LRR receptor-like serine/threonine-protein kinase At1g12460 Arabidopsis thaliana
C0LGE4 5.94e-05 48 31 5 128 1 At1g12460 Probable LRR receptor-like serine/threonine-protein kinase At1g12460 Arabidopsis thaliana
Q9TTE2 1.68e-10 64 31 9 230 2 DCN Decorin Ovis aries
Q9TTE2 2.17e-06 52 25 7 213 2 DCN Decorin Ovis aries
P21793 1.71e-10 64 31 9 230 1 DCN Decorin Bos taurus
P21793 2.15e-06 52 25 7 213 1 DCN Decorin Bos taurus
Q9WVB4 1.87e-10 65 35 7 156 2 Slit3 Slit homolog 3 protein Mus musculus
Q9WVB4 6.02e-08 57 30 6 150 2 Slit3 Slit homolog 3 protein Mus musculus
P0DO09 1.96e-10 65 27 0 131 3 PIKS-1 Disease resistance protein Piks-1 Oryza sativa subsp. japonica
P0DO09 1.27e-08 59 26 0 134 3 PIKS-1 Disease resistance protein Piks-1 Oryza sativa subsp. japonica
P0DO09 2.13e-08 58 22 7 281 3 PIKS-1 Disease resistance protein Piks-1 Oryza sativa subsp. japonica
P0DO09 2.8e-07 55 29 0 108 3 PIKS-1 Disease resistance protein Piks-1 Oryza sativa subsp. japonica
P0DO09 4.2e-07 54 24 1 160 3 PIKS-1 Disease resistance protein Piks-1 Oryza sativa subsp. japonica
Q7FZR1 1.96e-10 64 27 11 285 2 RLP52 Receptor-like protein 52 Arabidopsis thaliana
Q7FZR1 2.64e-08 58 29 12 286 2 RLP52 Receptor-like protein 52 Arabidopsis thaliana
Q7FZR1 4.62e-08 57 27 12 272 2 RLP52 Receptor-like protein 52 Arabidopsis thaliana
Q7FZR1 1.15e-07 56 28 9 247 2 RLP52 Receptor-like protein 52 Arabidopsis thaliana
O88280 2.01e-10 65 35 7 156 2 Slit3 Slit homolog 3 protein Rattus norvegicus
O88280 1.98e-07 55 30 6 150 2 Slit3 Slit homolog 3 protein Rattus norvegicus
F2VYU4 2.05e-10 65 27 0 131 1 PIK-1 Disease resistance protein Pik-1 Oryza sativa subsp. japonica
F2VYU4 1.38e-08 59 26 0 134 1 PIK-1 Disease resistance protein Pik-1 Oryza sativa subsp. japonica
F2VYU4 4.24e-08 57 22 6 256 1 PIK-1 Disease resistance protein Pik-1 Oryza sativa subsp. japonica
F2VYU4 3.01e-07 55 29 0 108 1 PIK-1 Disease resistance protein Pik-1 Oryza sativa subsp. japonica
F2VYU4 4.35e-07 54 24 1 160 1 PIK-1 Disease resistance protein Pik-1 Oryza sativa subsp. japonica
B5UBC1 2.16e-10 64 27 0 131 1 PIKM1-TS Disease resistance protein Pikm1-TS Oryza sativa subsp. japonica
B5UBC1 1.44e-08 59 26 0 134 1 PIKM1-TS Disease resistance protein Pikm1-TS Oryza sativa subsp. japonica
B5UBC1 2.55e-08 58 22 7 281 1 PIKM1-TS Disease resistance protein Pikm1-TS Oryza sativa subsp. japonica
B5UBC1 3.06e-07 55 29 0 108 1 PIKM1-TS Disease resistance protein Pikm1-TS Oryza sativa subsp. japonica
B5UBC1 4.9e-07 54 24 1 160 1 PIKM1-TS Disease resistance protein Pikm1-TS Oryza sativa subsp. japonica
Q32Q07 2.39e-10 64 31 9 224 2 Lrrn1 Leucine-rich repeat neuronal protein 1 Rattus norvegicus
Q9FII5 2.55e-10 64 32 7 211 1 TDR Leucine-rich repeat receptor-like protein kinase TDR Arabidopsis thaliana
Q9FII5 2.64e-10 64 25 9 268 1 TDR Leucine-rich repeat receptor-like protein kinase TDR Arabidopsis thaliana
Q9FII5 1.33e-06 53 25 8 232 1 TDR Leucine-rich repeat receptor-like protein kinase TDR Arabidopsis thaliana
Q8R502 2.71e-10 64 25 5 242 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Mus musculus
Q8R502 2.06e-09 61 28 1 146 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Mus musculus
Q28256 2.73e-10 64 39 7 152 2 GP1BA Platelet glycoprotein Ib alpha chain Canis lupus familiaris
O70210 2.86e-10 63 30 7 208 2 Chad Chondroadherin Rattus norvegicus
O70210 1.36e-05 49 27 6 183 2 Chad Chondroadherin Rattus norvegicus
O55226 2.89e-10 63 30 7 208 2 Chad Chondroadherin Mus musculus
O55226 1.61e-07 55 37 6 149 2 Chad Chondroadherin Mus musculus
Q498T9 3.03e-10 64 25 5 242 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Rattus norvegicus
Q498T9 2.56e-09 61 28 1 146 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Rattus norvegicus
Q69JN6 3.07e-10 64 27 12 287 2 BRL1 Brassinosteroid LRR receptor kinase BRL1 Oryza sativa subsp. japonica
Q69JN6 5.94e-06 51 28 12 242 2 BRL1 Brassinosteroid LRR receptor kinase BRL1 Oryza sativa subsp. japonica
Q9XIB6 3.25e-10 64 28 8 231 1 PEX2 Pollen-specific leucine-rich repeat extensin-like protein 2 Arabidopsis thaliana
Q61809 3.47e-10 63 31 9 224 2 Lrrn1 Leucine-rich repeat neuronal protein 1 Mus musculus
Q6XAT2 3.61e-10 64 25 8 275 1 ERL2 LRR receptor-like serine/threonine-protein kinase ERL2 Arabidopsis thaliana
Q6XAT2 3.92e-10 63 28 8 247 1 ERL2 LRR receptor-like serine/threonine-protein kinase ERL2 Arabidopsis thaliana
Q9MA83 3.65e-10 63 26 8 283 2 RLP30 Receptor-like protein 30 Arabidopsis thaliana
Q8L899 3.78e-10 64 29 9 225 1 None Systemin receptor SR160 Solanum peruvianum
Q8L899 6.67e-08 57 30 11 255 1 None Systemin receptor SR160 Solanum peruvianum
Q8L899 1.77e-06 52 27 9 222 1 None Systemin receptor SR160 Solanum peruvianum
Q8L899 0.000199 46 26 12 280 1 None Systemin receptor SR160 Solanum peruvianum
O43155 3.8e-10 63 29 10 253 1 FLRT2 Leucine-rich repeat transmembrane protein FLRT2 Homo sapiens
Q5R6B1 4.02e-10 63 29 7 198 2 LRRTM1 Leucine-rich repeat transmembrane neuronal protein 1 Pongo abelii
Q52KR2 4.15e-10 63 28 9 278 1 Lrig2 Leucine-rich repeats and immunoglobulin-like domains protein 2 Mus musculus
Q52KR2 1.6e-05 50 29 7 186 1 Lrig2 Leucine-rich repeats and immunoglobulin-like domains protein 2 Mus musculus
Q8GUQ5 4.18e-10 63 30 14 255 1 CURL3 Brassinosteroid LRR receptor kinase Solanum lycopersicum
Q8GUQ5 1.43e-08 59 30 11 255 1 CURL3 Brassinosteroid LRR receptor kinase Solanum lycopersicum
Q8GUQ5 8.74e-08 57 26 11 278 1 CURL3 Brassinosteroid LRR receptor kinase Solanum lycopersicum
Q8GUQ5 6.41e-07 54 27 9 224 1 CURL3 Brassinosteroid LRR receptor kinase Solanum lycopersicum
Q8GUQ5 0.000182 46 26 12 280 1 CURL3 Brassinosteroid LRR receptor kinase Solanum lycopersicum
Q6NU09 4.53e-10 63 33 0 128 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus laevis
Q6NU09 1.94e-09 62 27 6 262 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus laevis
Q6NU09 2.45e-09 61 25 2 208 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus laevis
Q6NU09 4.22e-08 57 24 2 193 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus laevis
Q6NU09 4.8e-07 54 30 1 170 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus laevis
P35859 4.6e-10 63 29 9 261 1 Igfals Insulin-like growth factor-binding protein complex acid labile subunit Rattus norvegicus
Q9SCT4 4.62e-10 63 28 10 258 1 IMK2 Probably inactive leucine-rich repeat receptor-like protein kinase IMK2 Arabidopsis thaliana
Q9FZ59 4.88e-10 63 29 10 244 1 PEPR2 Leucine-rich repeat receptor-like protein kinase PEPR2 Arabidopsis thaliana
Q9FZ59 1.3e-09 62 26 10 312 1 PEPR2 Leucine-rich repeat receptor-like protein kinase PEPR2 Arabidopsis thaliana
Q9FZ59 9.15e-08 57 25 9 258 1 PEPR2 Leucine-rich repeat receptor-like protein kinase PEPR2 Arabidopsis thaliana
Q9FZ59 5.17e-07 54 27 11 255 1 PEPR2 Leucine-rich repeat receptor-like protein kinase PEPR2 Arabidopsis thaliana
Q54TM7 5.41e-10 63 32 1 139 2 drkD Probable serine/threonine-protein kinase drkD Dictyostelium discoideum
Q54TM7 1.36e-07 56 33 2 128 2 drkD Probable serine/threonine-protein kinase drkD Dictyostelium discoideum
Q54TM7 1.85e-07 55 28 1 155 2 drkD Probable serine/threonine-protein kinase drkD Dictyostelium discoideum
Q54TM7 6.78e-07 54 34 0 105 2 drkD Probable serine/threonine-protein kinase drkD Dictyostelium discoideum
Q54TM7 0.000165 47 28 1 125 2 drkD Probable serine/threonine-protein kinase drkD Dictyostelium discoideum
C0LGD7 5.43e-10 63 31 10 234 1 At1g06840 Probable LRR receptor-like serine/threonine-protein kinase At1g06840 Arabidopsis thaliana
C0LGD7 9.23e-08 56 27 7 218 1 At1g06840 Probable LRR receptor-like serine/threonine-protein kinase At1g06840 Arabidopsis thaliana
P0DM44 5.7e-10 63 27 13 281 2 lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Danio rerio
P0DM44 1.05e-05 50 26 12 279 2 lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Danio rerio
P0DM44 5.19e-05 48 29 6 179 2 lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Danio rerio
Q6JN47 5.84e-10 63 29 8 203 2 EIX1 Receptor-like protein EIX1 Solanum lycopersicum
Q6JN47 6.3e-09 60 30 6 194 2 EIX1 Receptor-like protein EIX1 Solanum lycopersicum
Q6JN47 1.42e-07 56 25 7 230 2 EIX1 Receptor-like protein EIX1 Solanum lycopersicum
Q6JN47 7.24e-06 50 25 8 282 2 EIX1 Receptor-like protein EIX1 Solanum lycopersicum
Q6JN47 0.000164 46 25 12 302 2 EIX1 Receptor-like protein EIX1 Solanum lycopersicum
Q8BLU0 6.63e-10 63 30 10 246 1 Flrt2 Leucine-rich repeat transmembrane protein FLRT2 Mus musculus
Q6PEZ8 7.02e-10 62 30 15 291 1 PODNL1 Podocan-like protein 1 Homo sapiens
Q6PEZ8 1.28e-08 59 30 12 236 1 PODNL1 Podocan-like protein 1 Homo sapiens
Q6PEZ8 1.29e-06 53 30 14 279 1 PODNL1 Podocan-like protein 1 Homo sapiens
Q5XM32 7.03e-10 63 27 9 238 2 RXFP2 Relaxin receptor 2 Canis lupus familiaris
O08770 7.33e-10 63 31 11 276 3 Gp5 Platelet glycoprotein V Rattus norvegicus
O08770 1.94e-07 55 30 7 191 3 Gp5 Platelet glycoprotein V Rattus norvegicus
Q28888 7.91e-10 62 31 9 230 2 DCN Decorin Oryctolagus cuniculus
Q28888 9e-06 50 23 7 213 2 DCN Decorin Oryctolagus cuniculus
E5DHB5 8.94e-10 62 32 8 208 2 lgr5-a Leucine-rich repeat-containing G-protein coupled receptor 5A Xenopus laevis
E5DHB5 1.46e-09 62 31 11 268 2 lgr5-a Leucine-rich repeat-containing G-protein coupled receptor 5A Xenopus laevis
E5DHB5 4.87e-09 60 28 8 221 2 lgr5-a Leucine-rich repeat-containing G-protein coupled receptor 5A Xenopus laevis
Q6ZNQ3 9.79e-10 62 28 2 212 2 LRRC69 Leucine-rich repeat-containing protein 69 Homo sapiens
Q6ZNQ3 2.05e-07 55 34 0 99 2 LRRC69 Leucine-rich repeat-containing protein 69 Homo sapiens
Q6ZNQ3 2.94e-05 48 28 2 177 2 LRRC69 Leucine-rich repeat-containing protein 69 Homo sapiens
Q5E9X4 1.17e-09 61 41 1 100 2 LRRC59 Leucine-rich repeat-containing protein 59 Bos taurus
Q5E9X4 1.68e-06 52 39 1 93 2 LRRC59 Leucine-rich repeat-containing protein 59 Bos taurus
Q5E9X4 6.82e-05 47 31 1 99 2 LRRC59 Leucine-rich repeat-containing protein 59 Bos taurus
Q5E9X4 7.96e-05 47 32 0 96 2 LRRC59 Leucine-rich repeat-containing protein 59 Bos taurus
Q5E9X4 0.000434 44 34 0 78 2 LRRC59 Leucine-rich repeat-containing protein 59 Bos taurus
D3ZTV3 1.21e-09 62 29 10 244 1 Flrt2 Leucine-rich repeat transmembrane protein FLRT2 Rattus norvegicus
Q6XHA7 1.23e-09 62 28 3 231 3 roco9 Probable serine/threonine-protein kinase roco9 Dictyostelium discoideum
Q6XHA7 2.66e-09 61 28 6 280 3 roco9 Probable serine/threonine-protein kinase roco9 Dictyostelium discoideum
Q6XHA7 3.24e-09 61 25 2 224 3 roco9 Probable serine/threonine-protein kinase roco9 Dictyostelium discoideum
Q6XHA7 4.38e-09 61 26 4 257 3 roco9 Probable serine/threonine-protein kinase roco9 Dictyostelium discoideum
Q9SHI2 1.3e-09 62 27 11 286 1 At1g17230 Leucine-rich repeat receptor-like serine/threonine-protein kinase At1g17230 Arabidopsis thaliana
Q9SHI2 1.32e-09 62 27 12 298 1 At1g17230 Leucine-rich repeat receptor-like serine/threonine-protein kinase At1g17230 Arabidopsis thaliana
Q9SHI2 2.3e-07 55 31 7 210 1 At1g17230 Leucine-rich repeat receptor-like serine/threonine-protein kinase At1g17230 Arabidopsis thaliana
P14605 1.53e-09 62 26 6 266 1 cyr1 Adenylate cyclase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P14605 6.13e-07 54 29 4 187 1 cyr1 Adenylate cyclase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P14605 0.000894 44 41 2 95 1 cyr1 Adenylate cyclase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6P9F7 1.63e-09 62 30 1 141 1 LRRC8B Volume-regulated anion channel subunit LRRC8B Homo sapiens
Q6P9F7 2.47e-08 58 26 8 275 1 LRRC8B Volume-regulated anion channel subunit LRRC8B Homo sapiens
Q6P9F7 8.09e-08 57 27 4 215 1 LRRC8B Volume-regulated anion channel subunit LRRC8B Homo sapiens
O22938 1.83e-09 62 29 8 232 2 PXC3 Leucine-rich repeat receptor-like tyrosine-protein kinase PXC3 Arabidopsis thaliana
O22938 6.79e-09 60 25 12 329 2 PXC3 Leucine-rich repeat receptor-like tyrosine-protein kinase PXC3 Arabidopsis thaliana
Q01129 2.16e-09 61 31 10 232 1 Dcn Decorin Rattus norvegicus
Q01129 2.49e-05 48 25 9 261 1 Dcn Decorin Rattus norvegicus
Q01129 0.00013 46 25 7 193 1 Dcn Decorin Rattus norvegicus
Q9M6A7 2.31e-09 61 29 10 251 2 CLV1B Leucine-rich repeat receptor-like kinase protein CLV1B Glycine max
Q9M6A7 1.18e-06 53 25 9 257 2 CLV1B Leucine-rich repeat receptor-like kinase protein CLV1B Glycine max
Q9ZPS9 2.45e-09 61 27 12 268 1 BRL2 Serine/threonine-protein kinase BRI1-like 2 Arabidopsis thaliana
Q9ZPS9 4.77e-07 54 30 10 252 1 BRL2 Serine/threonine-protein kinase BRI1-like 2 Arabidopsis thaliana
Q9ZPS9 0.000141 47 27 12 255 1 BRL2 Serine/threonine-protein kinase BRI1-like 2 Arabidopsis thaliana
C0LGT6 2.75e-09 61 27 11 281 1 EFR LRR receptor-like serine/threonine-protein kinase EFR Arabidopsis thaliana
C0LGT6 1.07e-07 56 27 8 203 1 EFR LRR receptor-like serine/threonine-protein kinase EFR Arabidopsis thaliana
C0LGT6 3.58e-05 48 27 7 203 1 EFR LRR receptor-like serine/threonine-protein kinase EFR Arabidopsis thaliana
Q9SRL2 3.16e-09 61 28 8 229 2 RLP34 Receptor-like protein 34 Arabidopsis thaliana
Q9SRL2 6.43e-08 57 27 7 231 2 RLP34 Receptor-like protein 34 Arabidopsis thaliana
Q9SRL2 6.04e-05 48 26 11 242 2 RLP34 Receptor-like protein 34 Arabidopsis thaliana
Q9C9H6 3.26e-09 61 27 10 245 3 RLP11 Receptor-like protein 11 Arabidopsis thaliana
Q9C9H6 0.0002 46 24 10 250 3 RLP11 Receptor-like protein 11 Arabidopsis thaliana
Q9C9H6 0.00022 46 27 7 233 3 RLP11 Receptor-like protein 11 Arabidopsis thaliana
Q9LY03 3.38e-09 61 29 10 262 1 IRK Probable LRR receptor-like serine/threonine-protein kinase IRK Arabidopsis thaliana
Q9LY03 8.46e-09 60 26 10 272 1 IRK Probable LRR receptor-like serine/threonine-protein kinase IRK Arabidopsis thaliana
Q9LY03 3.33e-08 58 28 12 290 1 IRK Probable LRR receptor-like serine/threonine-protein kinase IRK Arabidopsis thaliana
Q9LY03 1.11e-06 53 29 8 174 1 IRK Probable LRR receptor-like serine/threonine-protein kinase IRK Arabidopsis thaliana
C0LGH2 3.62e-09 61 28 10 257 2 At1g56130 Probable LRR receptor-like serine/threonine-protein kinase At1g56130 Arabidopsis thaliana
Q27972 3.64e-09 60 30 7 208 1 CHAD Chondroadherin Bos taurus
Q27972 3.04e-07 54 36 6 149 1 CHAD Chondroadherin Bos taurus
Q27972 8.55e-06 50 29 7 187 1 CHAD Chondroadherin Bos taurus
C0LGR3 3.79e-09 61 29 9 230 1 RGI3 LRR receptor-like serine/threonine-protein kinase RGI3 Arabidopsis thaliana
C0LGR3 5.12e-09 60 26 8 244 1 RGI3 LRR receptor-like serine/threonine-protein kinase RGI3 Arabidopsis thaliana
C0LGR3 9.12e-07 53 28 10 231 1 RGI3 LRR receptor-like serine/threonine-protein kinase RGI3 Arabidopsis thaliana
C0LGR3 0.000895 44 39 3 86 1 RGI3 LRR receptor-like serine/threonine-protein kinase RGI3 Arabidopsis thaliana
Q5R1V9 4e-09 60 30 9 230 2 DCN Decorin Pan troglodytes
Q5R1V9 5.68e-07 53 25 7 213 2 DCN Decorin Pan troglodytes
P07585 4e-09 60 30 9 230 1 DCN Decorin Homo sapiens
P07585 5.68e-07 53 25 7 213 1 DCN Decorin Homo sapiens
Q91ZZ5 4.01e-09 60 30 10 241 2 Rxfp2 Relaxin receptor 2 Mus musculus
F4J7T6 4.34e-09 60 26 9 271 3 RLP39 Receptor-like protein 39 Arabidopsis thaliana
F4J7T6 0.000856 44 25 11 250 3 RLP39 Receptor-like protein 39 Arabidopsis thaliana
Q9LUI1 4.56e-09 60 25 9 236 2 LRX6 Leucine-rich repeat extensin-like protein 6 Arabidopsis thaliana
Q9FK66 4.98e-09 60 30 7 195 1 RLP55 Receptor-like protein 55 Arabidopsis thaliana
C0LGJ1 5.04e-09 60 30 8 223 1 At1g74360 Probable LRR receptor-like serine/threonine-protein kinase At1g74360 Arabidopsis thaliana
C0LGJ1 5.94e-08 57 27 9 270 1 At1g74360 Probable LRR receptor-like serine/threonine-protein kinase At1g74360 Arabidopsis thaliana
A0A1P8ATR9 5.05e-09 60 28 11 296 3 RLP9B Receptor-like protein 9b Arabidopsis thaliana
A0A1P8ATR9 2.26e-06 52 27 11 265 3 RLP9B Receptor-like protein 9b Arabidopsis thaliana
Q9SVN2 5.17e-09 60 27 10 242 3 RLP47 Receptor-like protein 47 Arabidopsis thaliana
Q9SVN2 5.29e-06 51 27 9 264 3 RLP47 Receptor-like protein 47 Arabidopsis thaliana
Q9SVN2 3.25e-05 48 24 12 262 3 RLP47 Receptor-like protein 47 Arabidopsis thaliana
Q9SVN2 0.00021 46 33 4 125 3 RLP47 Receptor-like protein 47 Arabidopsis thaliana
Q8N1G4 5.49e-09 60 32 3 149 1 LRRC47 Leucine-rich repeat-containing protein 47 Homo sapiens
A6NIK2 6.36e-09 59 27 1 202 1 LRRC10B Leucine-rich repeat-containing protein 10B Homo sapiens
A6NIK2 7.55e-08 56 26 1 192 1 LRRC10B Leucine-rich repeat-containing protein 10B Homo sapiens
Q6P3Y9 7.14e-09 60 29 9 249 1 Podnl1 Podocan-like protein 1 Mus musculus
Q6P3Y9 1.47e-07 55 28 9 238 1 Podnl1 Podocan-like protein 1 Mus musculus
Q6DF55 7.38e-09 60 31 10 212 2 vasn Vasorin Xenopus tropicalis
Q6DF55 1.7e-08 58 28 11 269 2 vasn Vasorin Xenopus tropicalis
O15335 7.63e-09 59 29 7 210 1 CHAD Chondroadherin Homo sapiens
O15335 2.03e-07 55 36 7 152 1 CHAD Chondroadherin Homo sapiens
O15335 6.22e-07 53 29 7 187 1 CHAD Chondroadherin Homo sapiens
Q9SHI4 7.79e-09 60 31 13 251 2 RLP3 Receptor-like protein 3 Arabidopsis thaliana
Q9SHI4 1.24e-05 50 27 7 221 2 RLP3 Receptor-like protein 3 Arabidopsis thaliana
Q9SHI4 0.000263 46 31 6 158 2 RLP3 Receptor-like protein 3 Arabidopsis thaliana
Q9T0K5 9.19e-09 59 27 9 234 1 LRX3 Leucine-rich repeat extensin-like protein 3 Arabidopsis thaliana
C0LGF5 1.01e-08 59 25 10 306 1 RGI5 LRR receptor-like serine/threonine-protein kinase RGI5 Arabidopsis thaliana
C0LGF5 1.16e-07 56 25 10 281 1 RGI5 LRR receptor-like serine/threonine-protein kinase RGI5 Arabidopsis thaliana
C0LGF5 7.59e-07 53 29 7 195 1 RGI5 LRR receptor-like serine/threonine-protein kinase RGI5 Arabidopsis thaliana
C0LGF5 0.000182 46 25 9 239 1 RGI5 LRR receptor-like serine/threonine-protein kinase RGI5 Arabidopsis thaliana
P28654 1.06e-08 58 31 10 232 1 Dcn Decorin Mus musculus
P28654 0.000131 46 24 7 214 1 Dcn Decorin Mus musculus
P28654 0.00018 46 25 8 227 1 Dcn Decorin Mus musculus
O08742 1.12e-08 59 31 12 255 1 Gp5 Platelet glycoprotein V Mus musculus
O08742 1.15e-07 56 32 7 180 1 Gp5 Platelet glycoprotein V Mus musculus
Q7G768 1.19e-08 59 27 11 262 2 BRL2 Brassinosteroid LRR receptor kinase BRL2 Oryza sativa subsp. japonica
Q7G768 2.75e-05 49 27 10 257 2 BRL2 Brassinosteroid LRR receptor kinase BRL2 Oryza sativa subsp. japonica
Q7G768 2.83e-05 49 26 10 275 2 BRL2 Brassinosteroid LRR receptor kinase BRL2 Oryza sativa subsp. japonica
Q7G768 0.000193 46 27 10 242 2 BRL2 Brassinosteroid LRR receptor kinase BRL2 Oryza sativa subsp. japonica
Q7G768 0.000281 46 25 14 311 2 BRL2 Brassinosteroid LRR receptor kinase BRL2 Oryza sativa subsp. japonica
O49325 1.23e-08 59 28 12 261 2 RLP28 Receptor like protein 28 Arabidopsis thaliana
O49325 2.32e-06 52 29 8 187 2 RLP28 Receptor like protein 28 Arabidopsis thaliana
O49325 0.000153 47 25 10 244 2 RLP28 Receptor like protein 28 Arabidopsis thaliana
C0LGH3 1.23e-08 59 28 12 282 2 At1g56140 Probable LRR receptor-like serine/threonine-protein kinase At1g56140 Arabidopsis thaliana
Q9FK63 1.49e-08 58 29 3 159 1 CAMRLK Calmodulin-binding receptor kinase CaMRLK Arabidopsis thaliana
Q9SD62 1.49e-08 59 27 11 251 3 At3g47110 Putative receptor-like protein kinase At3g47110 Arabidopsis thaliana
Q9SD62 0.000413 45 23 7 236 3 At3g47110 Putative receptor-like protein kinase At3g47110 Arabidopsis thaliana
Q9LHF1 1.57e-08 58 27 9 234 1 LRX4 Leucine-rich repeat extensin-like protein 4 Arabidopsis thaliana
Q9LJ64 1.71e-08 58 28 11 202 1 PEX1 Pollen-specific leucine-rich repeat extensin-like protein 1 Arabidopsis thaliana
Q9ZUI0 1.85e-08 58 29 10 196 3 At2g24130 Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At2g24130 Arabidopsis thaliana
Q9ZUI0 1.58e-05 50 27 13 290 3 At2g24130 Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At2g24130 Arabidopsis thaliana
Q7Z2Q7 1.98e-08 58 33 9 208 1 LRRC70 Leucine-rich repeat-containing protein 70 Homo sapiens
Q7Z2Q7 2.33e-07 55 28 10 240 1 LRRC70 Leucine-rich repeat-containing protein 70 Homo sapiens
Q9LJF3 2.06e-08 58 29 14 281 1 BRL3 Receptor-like protein kinase BRI1-like 3 Arabidopsis thaliana
Q9LJF3 6.82e-05 48 28 14 266 1 BRL3 Receptor-like protein kinase BRI1-like 3 Arabidopsis thaliana
Q8IUZ0 2.07e-08 58 36 5 136 1 LRRC49 Leucine-rich repeat-containing protein 49 Homo sapiens
Q54M77 2.16e-08 58 35 3 128 3 roco8 Probable serine/threonine-protein kinase roco8 Dictyostelium discoideum
Q54M77 4.66e-08 57 30 4 190 3 roco8 Probable serine/threonine-protein kinase roco8 Dictyostelium discoideum
Q54M77 0.000116 47 31 3 131 3 roco8 Probable serine/threonine-protein kinase roco8 Dictyostelium discoideum
Q91YK0 2.55e-08 58 37 5 127 1 Lrrc49 Leucine-rich repeat-containing protein 49 Mus musculus
Q4UWF4 2.6e-08 58 30 1 123 1 xopAC Uridine 5'-monophosphate transferase Xanthomonas campestris pv. campestris (strain 8004)
Q9V477 2.74e-08 58 32 12 253 1 Tollo Toll-like receptor Tollo Drosophila melanogaster
Q9V477 5.85e-07 54 26 8 256 1 Tollo Toll-like receptor Tollo Drosophila melanogaster
Q505F5 2.79e-08 58 30 5 184 1 Lrrc47 Leucine-rich repeat-containing protein 47 Mus musculus
Q505F5 3.05e-06 52 30 4 156 1 Lrrc47 Leucine-rich repeat-containing protein 47 Mus musculus
Q29393 2.82e-08 57 28 9 212 2 DCN Decorin Canis lupus familiaris
Q29393 1.96e-05 49 24 7 213 2 DCN Decorin Canis lupus familiaris
Q9C6A6 3.72e-08 58 25 8 249 3 RLP13 Receptor-like protein 13 Arabidopsis thaliana
Q9H156 3.9e-08 57 36 4 126 1 SLITRK2 SLIT and NTRK-like protein 2 Homo sapiens
C0LGK9 4.09e-08 57 27 9 252 1 At2g24230 Probable LRR receptor-like serine/threonine-protein kinase At2g24230 Arabidopsis thaliana
C0LGK9 7.04e-08 57 32 5 162 1 At2g24230 Probable LRR receptor-like serine/threonine-protein kinase At2g24230 Arabidopsis thaliana
C0LGK9 9.65e-07 53 37 3 98 1 At2g24230 Probable LRR receptor-like serine/threonine-protein kinase At2g24230 Arabidopsis thaliana
Q69SP5 4.3e-08 57 28 8 224 1 ER1 LRR receptor-like serine/threonine-protein kinase ER1 Oryza sativa subsp. japonica
Q69SP5 3.37e-06 52 26 6 193 1 ER1 LRR receptor-like serine/threonine-protein kinase ER1 Oryza sativa subsp. japonica
Q9H5Y7 4.42e-08 57 33 4 130 1 SLITRK6 SLIT and NTRK-like protein 6 Homo sapiens
Q9H5Y7 0.000228 46 29 4 141 1 SLITRK6 SLIT and NTRK-like protein 6 Homo sapiens
Q8LPB4 4.54e-08 57 27 8 255 1 PSKR Phytosulfokine receptor 1 Daucus carota
Q8LPB4 2.08e-06 52 28 11 252 1 PSKR Phytosulfokine receptor 1 Daucus carota
Q810C0 4.55e-08 57 36 4 126 1 Slitrk2 SLIT and NTRK-like protein 2 Mus musculus
Q6RKD8 4.57e-08 57 30 11 245 1 Flrt1 Leucine-rich repeat transmembrane protein FLRT1 Mus musculus
Q6RKD8 1.03e-06 53 27 5 178 1 Flrt1 Leucine-rich repeat transmembrane protein FLRT1 Mus musculus
Q54WS5 4.59e-08 57 26 8 263 3 roco6 Probable serine/threonine-protein kinase roco6 Dictyostelium discoideum
P0DO06 4.62e-08 57 26 11 258 3 9DC2 Receptor-like protein 9DC2 Solanum pimpinellifolium
P0DO06 2.85e-06 52 27 11 248 3 9DC2 Receptor-like protein 9DC2 Solanum pimpinellifolium
P0DO06 0.000102 47 27 11 245 3 9DC2 Receptor-like protein 9DC2 Solanum pimpinellifolium
P0DO05 4.62e-08 57 26 11 258 3 9DC1 Receptor-like protein 9DC1 Solanum pimpinellifolium
P0DO05 2.85e-06 52 27 11 248 3 9DC1 Receptor-like protein 9DC1 Solanum pimpinellifolium
P0DO05 0.000102 47 27 11 245 3 9DC1 Receptor-like protein 9DC1 Solanum pimpinellifolium
Q9SKK5 4.69e-08 57 26 9 271 3 RLP20 Receptor-like protein 20 Arabidopsis thaliana
Q6NUI6 5.3e-08 57 29 8 206 1 CHADL Chondroadherin-like protein Homo sapiens
Q6NUI6 8.34e-07 53 29 7 199 1 CHADL Chondroadherin-like protein Homo sapiens
Q6NUI6 7.47e-06 50 38 5 112 1 CHADL Chondroadherin-like protein Homo sapiens
Q6NUI6 0.000647 44 25 6 185 1 CHADL Chondroadherin-like protein Homo sapiens
C0LGP4 5.33e-08 57 32 9 203 2 At3g47570 Probable LRR receptor-like serine/threonine-protein kinase At3g47570 Arabidopsis thaliana
C0LGP4 2.74e-07 55 29 9 229 2 At3g47570 Probable LRR receptor-like serine/threonine-protein kinase At3g47570 Arabidopsis thaliana
C0LGP4 0.001 44 37 4 100 2 At3g47570 Probable LRR receptor-like serine/threonine-protein kinase At3g47570 Arabidopsis thaliana
F4JGB6 5.44e-08 57 30 12 253 3 RLP46 Receptor-like protein 46 Arabidopsis thaliana
Q9NZU1 5.48e-08 57 30 11 245 1 FLRT1 Leucine-rich repeat transmembrane protein FLRT1 Homo sapiens
Q9NZU1 9.8e-07 53 28 5 178 1 FLRT1 Leucine-rich repeat transmembrane protein FLRT1 Homo sapiens
Q5MR23 5.48e-08 57 26 11 258 3 9DC3 Receptor-like protein 9DC3 Solanum pimpinellifolium
Q5MR23 8.5e-06 50 27 11 248 3 9DC3 Receptor-like protein 9DC3 Solanum pimpinellifolium
Q5MR23 3.89e-05 48 26 10 281 3 9DC3 Receptor-like protein 9DC3 Solanum pimpinellifolium
Q9C6A8 5.63e-08 57 27 13 260 3 RLP15 Receptor-like protein 15 Arabidopsis thaliana
F4IUU1 5.79e-08 57 28 9 259 2 RLP27 Receptor like protein 27 Arabidopsis thaliana
F4IUU1 5.9e-06 51 28 8 216 2 RLP27 Receptor like protein 27 Arabidopsis thaliana
F4IUU1 0.000282 45 24 14 325 2 RLP27 Receptor like protein 27 Arabidopsis thaliana
Q86VH4 6.36e-08 57 27 7 211 1 LRRTM4 Leucine-rich repeat transmembrane neuronal protein 4 Homo sapiens
P0CE12 6.42e-08 57 31 11 247 1 sspH2 E3 ubiquitin-protein ligase SspH2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0CE12 3.27e-07 55 31 7 210 1 sspH2 E3 ubiquitin-protein ligase SspH2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZPH9 6.42e-08 57 31 11 247 1 sspH2 E3 ubiquitin-protein ligase SspH2 Salmonella typhimurium (strain 14028s / SGSC 2262)
D0ZPH9 3.27e-07 55 31 7 210 1 sspH2 E3 ubiquitin-protein ligase SspH2 Salmonella typhimurium (strain 14028s / SGSC 2262)
Q9DE66 7.23e-08 56 27 12 267 2 KERA Keratocan Coturnix japonica
O42235 7.43e-08 56 27 12 267 1 KERA Keratocan Gallus gallus
B4F7C5 7.49e-08 57 28 7 205 1 Lrrtm4 Leucine-rich repeat transmembrane neuronal protein 4 Rattus norvegicus
A2BHJ4 7.53e-08 57 36 1 125 2 cnot6l CCR4-NOT transcription complex subunit 6-like Danio rerio
Q8C110 7.68e-08 57 33 3 124 1 Slitrk6 SLIT and NTRK-like protein 6 Mus musculus
O02678 7.82e-08 56 26 7 222 2 BGN Biglycan Canis lupus familiaris
O02678 0.00018 46 27 9 250 2 BGN Biglycan Canis lupus familiaris
Q9SSL9 8.03e-08 57 26 10 250 1 PEPR1 Leucine-rich repeat receptor-like protein kinase PEPR1 Arabidopsis thaliana
Q9SSL9 8.33e-08 57 27 9 247 1 PEPR1 Leucine-rich repeat receptor-like protein kinase PEPR1 Arabidopsis thaliana
Q9SSL9 3.25e-07 55 27 8 243 1 PEPR1 Leucine-rich repeat receptor-like protein kinase PEPR1 Arabidopsis thaliana
Q80XG9 8.35e-08 56 27 7 211 1 Lrrtm4 Leucine-rich repeat transmembrane neuronal protein 4 Mus musculus
Q6NWG1 8.39e-08 56 34 2 110 2 lrrc59 Leucine-rich repeat-containing protein 59 Danio rerio
Q6NWG1 6.62e-05 47 34 1 99 2 lrrc59 Leucine-rich repeat-containing protein 59 Danio rerio
Q6NWG1 8.46e-05 47 32 1 95 2 lrrc59 Leucine-rich repeat-containing protein 59 Danio rerio
Q6NWG1 9.26e-05 47 36 2 103 2 lrrc59 Leucine-rich repeat-containing protein 59 Danio rerio
Q6NWG1 0.000619 44 28 1 110 2 lrrc59 Leucine-rich repeat-containing protein 59 Danio rerio
Q4PSE6 9.52e-08 56 26 9 233 2 LRX7 Leucine-rich repeat extensin-like protein 7 Arabidopsis thaliana
Q9LJS0 9.86e-08 56 27 7 222 1 RLP42 Receptor-like protein 42 Arabidopsis thaliana
Q75BI3 9.98e-08 56 36 0 80 3 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75BI3 4.24e-05 48 33 0 103 3 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q54T82 1.03e-07 56 27 5 191 4 DDB_G0281931 Putative leucine-rich repeat-containing protein DDB_G0281931 Dictyostelium discoideum
Q54T82 0.00017 46 26 8 214 4 DDB_G0281931 Putative leucine-rich repeat-containing protein DDB_G0281931 Dictyostelium discoideum
Q810B7 1.03e-07 56 39 3 107 2 Slitrk5 SLIT and NTRK-like protein 5 Mus musculus
F4KHA2 1.07e-07 56 29 9 239 3 RLP54 Receptor-like protein 54 Arabidopsis thaliana
O48851 1.07e-07 56 32 10 217 2 RLP22 Receptor like protein 22 Arabidopsis thaliana
O48851 3.19e-07 55 25 8 247 2 RLP22 Receptor like protein 22 Arabidopsis thaliana
O48851 2.3e-05 49 28 8 253 2 RLP22 Receptor like protein 22 Arabidopsis thaliana
Q5S007 1.08e-07 56 28 9 220 1 LRRK2 Leucine-rich repeat serine/threonine-protein kinase 2 Homo sapiens
Q5S007 3.58e-06 52 27 8 206 1 LRRK2 Leucine-rich repeat serine/threonine-protein kinase 2 Homo sapiens
C0LGQ9 1.1e-07 56 27 9 239 1 GHR1 LRR receptor-like serine/threonine-protein kinase GHR1 Arabidopsis thaliana
C0LGQ9 1.41e-07 56 36 4 125 1 GHR1 LRR receptor-like serine/threonine-protein kinase GHR1 Arabidopsis thaliana
C0LGQ9 9.22e-07 53 27 9 215 1 GHR1 LRR receptor-like serine/threonine-protein kinase GHR1 Arabidopsis thaliana
Q8C031 1.15e-07 56 30 11 237 1 Lrrc4c Leucine-rich repeat-containing protein 4C Mus musculus
P02750 1.21e-07 55 38 4 118 1 LRG1 Leucine-rich alpha-2-glycoprotein Homo sapiens
P02750 6.48e-06 50 30 7 195 1 LRG1 Leucine-rich alpha-2-glycoprotein Homo sapiens
C0LGU1 1.22e-07 56 24 6 243 1 At5g37450 Probable LRR receptor-like serine/threonine-protein kinase At5g37450 Arabidopsis thaliana
D0ZVG2 1.24e-07 56 32 7 182 1 sspH1 E3 ubiquitin-protein ligase SspH1 Salmonella typhimurium (strain 14028s / SGSC 2262)
D0ZVG2 1.02e-05 50 30 8 202 1 sspH1 E3 ubiquitin-protein ligase SspH1 Salmonella typhimurium (strain 14028s / SGSC 2262)
D0ZVG2 0.000194 46 30 7 171 1 sspH1 E3 ubiquitin-protein ligase SspH1 Salmonella typhimurium (strain 14028s / SGSC 2262)
Q9HCJ2 1.25e-07 56 30 11 237 1 LRRC4C Leucine-rich repeat-containing protein 4C Homo sapiens
O46379 1.29e-07 54 29 9 203 2 LUM Lumican (Fragment) Oryctolagus cuniculus
O46379 2.31e-06 50 34 6 121 2 LUM Lumican (Fragment) Oryctolagus cuniculus
O94991 1.31e-07 56 39 3 107 1 SLITRK5 SLIT and NTRK-like protein 5 Homo sapiens
Q9CZT5 1.36e-07 56 31 8 225 2 Vasn Vasorin Mus musculus
F4J9A8 1.42e-07 56 25 11 284 2 RLP45 Receptor-like protein 45 Arabidopsis thaliana
F4J9A8 9.28e-07 53 27 17 301 2 RLP45 Receptor-like protein 45 Arabidopsis thaliana
O94294 1.44e-07 56 27 2 158 1 sog2 Leucine-rich repeat-containing protein sog2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94294 1.6e-05 50 27 0 112 1 sog2 Leucine-rich repeat-containing protein sog2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94294 0.00077 44 38 0 75 1 sog2 Leucine-rich repeat-containing protein sog2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q08817 1.65e-07 55 32 2 114 1 SOG2 Leucine-rich repeat-containing protein SOG2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08817 0.000207 46 37 0 81 1 SOG2 Leucine-rich repeat-containing protein SOG2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9M9X0 1.66e-07 55 28 10 260 2 RLP32 Receptor-like protein 32 Arabidopsis thaliana
Q9M9X0 1.95e-06 52 31 3 130 2 RLP32 Receptor-like protein 32 Arabidopsis thaliana
Q9M9X0 2.38e-05 49 25 10 226 2 RLP32 Receptor-like protein 32 Arabidopsis thaliana
P0C192 1.86e-07 55 30 10 232 1 Lrrc4b Leucine-rich repeat-containing protein 4B Mus musculus
Q93373 1.94e-07 55 24 7 253 2 let-4 Leucine-rich repeat-containing protein let-4 Caenorhabditis elegans
Q93373 1.26e-05 50 29 8 223 2 let-4 Leucine-rich repeat-containing protein let-4 Caenorhabditis elegans
P0CC10 1.94e-07 55 30 10 232 1 Lrrc4b Leucine-rich repeat-containing protein 4B Rattus norvegicus
Q8TCA0 1.94e-07 53 30 3 120 1 LRRC20 Leucine-rich repeat-containing protein 20 Homo sapiens
Q723X5 1.96e-07 55 28 12 268 3 inlI Internalin I Listeria monocytogenes serotype 4b (strain F2365)
P51887 2.02e-07 55 33 4 139 2 FMOD Fibromodulin Gallus gallus
Q96NI6 2.32e-07 55 38 4 113 1 LRFN5 Leucine-rich repeat and fibronectin type-III domain-containing protein 5 Homo sapiens
Q7AP87 2.34e-07 55 32 6 149 1 inlH Internalin H Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q7AP87 4.06e-07 54 32 7 165 1 inlH Internalin H Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q7AP87 6.18e-06 50 32 4 109 1 inlH Internalin H Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8BXA0 2.43e-07 55 38 4 113 1 Lrfn5 Leucine-rich repeat and fibronectin type-III domain-containing protein 5 Mus musculus
D4A1J9 2.47e-07 55 38 4 113 1 Lrfn5 Leucine-rich repeat and fibronectin type-III domain-containing protein 5 Rattus norvegicus
Q9ULM6 2.48e-07 55 36 0 97 1 CNOT6 CCR4-NOT transcription complex subunit 6 Homo sapiens
Q9ULM6 0.00011 47 35 0 68 1 CNOT6 CCR4-NOT transcription complex subunit 6 Homo sapiens
Q9ULM6 0.000247 45 29 0 94 1 CNOT6 CCR4-NOT transcription complex subunit 6 Homo sapiens
F4HTV4 2.67e-07 55 27 13 285 3 RLP14 Receptor-like protein 14 Arabidopsis thaliana
F4HTV4 0.000158 47 26 12 334 3 RLP14 Receptor-like protein 14 Arabidopsis thaliana
F4HTV4 0.000285 45 28 8 220 3 RLP14 Receptor-like protein 14 Arabidopsis thaliana
Q8SU52 2.81e-07 55 33 0 93 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Encephalitozoon cuniculi (strain GB-M1)
Q8SU52 2.62e-06 52 38 0 80 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Encephalitozoon cuniculi (strain GB-M1)
Q8SU52 0.000474 45 33 0 78 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Encephalitozoon cuniculi (strain GB-M1)
Q8VEG6 3.03e-07 55 37 1 113 1 Cnot6l CCR4-NOT transcription complex subunit 6-like Mus musculus
Q8VEG6 5.08e-05 48 35 1 113 1 Cnot6l CCR4-NOT transcription complex subunit 6-like Mus musculus
Q9SHI3 3.56e-07 55 30 7 192 2 RLP2 Receptor-like protein 2 Arabidopsis thaliana
Q9SHI3 7.49e-05 47 31 9 193 2 RLP2 Receptor-like protein 2 Arabidopsis thaliana
Q9SHI3 9.36e-05 47 25 13 326 2 RLP2 Receptor-like protein 2 Arabidopsis thaliana
Q9FK10 3.68e-07 54 42 3 94 1 At5g53320 Probable inactive receptor kinase At5g53320 Arabidopsis thaliana
Q9ZUK7 3.72e-07 55 28 8 234 2 RLP18 Receptor-like protein 18 Arabidopsis thaliana
Q86UN3 4.06e-07 54 32 7 202 1 RTN4RL2 Reticulon-4 receptor-like 2 Homo sapiens
Q86UN3 1.64e-05 49 33 6 154 1 RTN4RL2 Reticulon-4 receptor-like 2 Homo sapiens
O49329 4.34e-07 54 28 11 271 3 RLP24 Receptor like protein 24 Arabidopsis thaliana
O49329 3.97e-06 51 30 8 200 3 RLP24 Receptor like protein 24 Arabidopsis thaliana
O49329 0.000339 45 27 8 220 3 RLP24 Receptor like protein 24 Arabidopsis thaliana
O93233 4.41e-07 53 30 6 185 1 None Phospholipase A2 inhibitor Gloydius brevicaudus siniticus
O93233 7.66e-06 50 27 8 239 1 None Phospholipase A2 inhibitor Gloydius brevicaudus siniticus
Q0WR59 4.86e-07 54 26 11 275 1 At5g10020 Probable inactive receptor kinase At5g10020 Arabidopsis thaliana
Q2R2D5 5.17e-07 54 30 10 250 1 XA21 Receptor kinase-like protein Xa21 Oryza sativa subsp. japonica
Q2R2D5 1.14e-05 50 28 11 278 1 XA21 Receptor kinase-like protein Xa21 Oryza sativa subsp. japonica
Q5RI43 5.18e-07 53 29 16 294 1 kera Keratocan Danio rerio
Q810C1 6.03e-07 54 30 6 173 2 Slitrk1 SLIT and NTRK-like protein 1 Mus musculus
Q8BMT4 6.41e-07 53 27 11 262 1 Nrros Transforming growth factor beta activator LRRC33 Mus musculus
Q8BMT4 0.000308 45 28 13 267 1 Nrros Transforming growth factor beta activator LRRC33 Mus musculus
Q942F3 6.63e-07 54 27 12 296 1 BRI1 Brassinosteroid LRR receptor kinase BRI1 Oryza sativa subsp. japonica
Q942F3 3.49e-06 52 25 11 286 1 BRI1 Brassinosteroid LRR receptor kinase BRI1 Oryza sativa subsp. japonica
Q942F3 2.81e-05 49 27 9 216 1 BRI1 Brassinosteroid LRR receptor kinase BRI1 Oryza sativa subsp. japonica
Q80WD1 7.53e-07 53 32 7 202 1 Rtn4rl2 Reticulon-4 receptor-like 2 Rattus norvegicus
Q80WD1 7.98e-06 50 33 6 154 1 Rtn4rl2 Reticulon-4 receptor-like 2 Rattus norvegicus
C4V7I7 7.54e-07 53 34 0 93 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Vairimorpha ceranae (strain BRL01)
C4V7I7 0.000667 44 32 0 82 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Vairimorpha ceranae (strain BRL01)
Q96PX8 7.69e-07 53 30 6 173 1 SLITRK1 SLIT and NTRK-like protein 1 Homo sapiens
Q96PX8 2.55e-05 49 31 6 161 1 SLITRK1 SLIT and NTRK-like protein 1 Homo sapiens
O48809 7.82e-07 53 25 9 228 1 LRX2 Leucine-rich repeat extensin-like protein 2 Arabidopsis thaliana
D3YY91 7.83e-07 53 31 3 154 1 Lrr1 Leucine-rich repeat protein 1 Mus musculus
D3YY91 2.12e-06 52 31 2 141 1 Lrr1 Leucine-rich repeat protein 1 Mus musculus
D3YY91 2.86e-06 52 33 3 124 1 Lrr1 Leucine-rich repeat protein 1 Mus musculus
D3YY91 1.6e-05 49 31 3 130 1 Lrr1 Leucine-rich repeat protein 1 Mus musculus
D3YY91 2.52e-05 48 31 2 113 1 Lrr1 Leucine-rich repeat protein 1 Mus musculus
Q9BGP6 7.9e-07 53 29 9 207 2 LRRTM3 Leucine-rich repeat transmembrane neuronal protein 3 Macaca fascicularis
Q86VH5 7.9e-07 53 29 9 207 1 LRRTM3 Leucine-rich repeat transmembrane neuronal protein 3 Homo sapiens
C0LGN2 8.08e-07 53 27 11 228 1 LRR-RLK Probable leucine-rich repeat receptor-like serine/threonine-protein kinase At3g14840 Arabidopsis thaliana
C0LGN2 3.64e-05 48 35 2 98 1 LRR-RLK Probable leucine-rich repeat receptor-like serine/threonine-protein kinase At3g14840 Arabidopsis thaliana
Q5RAC4 8.34e-07 53 30 6 173 2 SLITRK1 SLIT and NTRK-like protein 1 Pongo abelii
Q5RAC4 2.67e-05 49 31 6 161 2 SLITRK1 SLIT and NTRK-like protein 1 Pongo abelii
Q28CU0 8.44e-07 53 31 8 201 2 lrrc23 Leucine-rich repeat-containing protein 23 Xenopus tropicalis
Q96L50 8.86e-07 53 33 2 119 1 LRR1 Leucine-rich repeat protein 1 Homo sapiens
Q96L50 1.22e-06 52 28 3 161 1 LRR1 Leucine-rich repeat protein 1 Homo sapiens
Q96L50 4.59e-05 48 29 3 169 1 LRR1 Leucine-rich repeat protein 1 Homo sapiens
Q96L50 0.000246 45 30 3 140 1 LRR1 Leucine-rich repeat protein 1 Homo sapiens
Q960C5 8.94e-07 53 28 6 207 2 Lrch Leucine-rich repeat and calponin homology domain-containing protein Drosophila melanogaster
Q960C5 1.42e-06 53 28 4 203 2 Lrch Leucine-rich repeat and calponin homology domain-containing protein Drosophila melanogaster
Q960C5 0.000191 46 38 0 72 2 Lrch Leucine-rich repeat and calponin homology domain-containing protein Drosophila melanogaster
Q6NX28 9.01e-07 53 39 0 82 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus tropicalis
Q6NX28 5.99e-06 50 33 1 100 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus tropicalis
Q6NX28 2.05e-05 48 31 1 99 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus tropicalis
Q6NX28 3.38e-05 48 35 0 79 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus tropicalis
Q9LJM4 9.03e-07 53 26 12 262 1 IKU2 Receptor-like protein kinase HAIKU2 Arabidopsis thaliana
Q9LJM4 4.8e-06 51 26 10 281 1 IKU2 Receptor-like protein kinase HAIKU2 Arabidopsis thaliana
Q9LJM4 0.000449 45 29 10 261 1 IKU2 Receptor-like protein kinase HAIKU2 Arabidopsis thaliana
P13605 9.05e-07 53 30 4 139 1 FMOD Fibromodulin Bos taurus
Q6R5N8 9.62e-07 53 32 8 214 1 Tlr13 Toll-like receptor 13 Mus musculus
Q6R5N8 4.63e-06 51 29 8 231 1 Tlr13 Toll-like receptor 13 Mus musculus
Q06828 9.74e-07 53 30 4 139 1 FMOD Fibromodulin Homo sapiens
Q7XA40 1.01e-06 53 26 6 218 2 RGA3 Putative disease resistance protein RGA3 Solanum bulbocastanum
Q9ZU46 1.11e-06 53 29 8 198 1 ZAR1 Receptor protein kinase-like protein ZAR1 Arabidopsis thaliana
Q5BJ41 1.16e-06 53 38 0 78 1 cnot6 CCR4-NOT transcription complex subunit 6 Xenopus laevis
Q5BJ41 1.08e-05 50 38 0 83 1 cnot6 CCR4-NOT transcription complex subunit 6 Xenopus laevis
Q5BJ41 0.000165 46 36 0 82 1 cnot6 CCR4-NOT transcription complex subunit 6 Xenopus laevis
Q5BJ41 0.000242 46 38 0 70 1 cnot6 CCR4-NOT transcription complex subunit 6 Xenopus laevis
Q5BJ41 0.000875 44 32 0 78 1 cnot6 CCR4-NOT transcription complex subunit 6 Xenopus laevis
P47853 1.19e-06 52 25 6 203 1 Bgn Biglycan Rattus norvegicus
Q6AXU9 1.24e-06 53 38 0 78 2 Cnot6 CCR4-NOT transcription complex subunit 6 Rattus norvegicus
Q6AXU9 1.2e-05 50 38 0 83 2 Cnot6 CCR4-NOT transcription complex subunit 6 Rattus norvegicus
Q6AXU9 0.000181 46 36 0 82 2 Cnot6 CCR4-NOT transcription complex subunit 6 Rattus norvegicus
Q6AXU9 0.000275 45 38 0 70 2 Cnot6 CCR4-NOT transcription complex subunit 6 Rattus norvegicus
Q6AXU9 0.001 44 32 0 78 2 Cnot6 CCR4-NOT transcription complex subunit 6 Rattus norvegicus
Q8K3P5 1.24e-06 53 38 0 78 1 Cnot6 CCR4-NOT transcription complex subunit 6 Mus musculus
Q8K3P5 1.2e-05 50 38 0 83 1 Cnot6 CCR4-NOT transcription complex subunit 6 Mus musculus
Q8K3P5 0.000181 46 36 0 82 1 Cnot6 CCR4-NOT transcription complex subunit 6 Mus musculus
Q8K3P5 0.000275 45 38 0 70 1 Cnot6 CCR4-NOT transcription complex subunit 6 Mus musculus
Q8K3P5 0.001 44 32 0 78 1 Cnot6 CCR4-NOT transcription complex subunit 6 Mus musculus
Q9SJH6 1.24e-06 53 28 7 195 2 RLP29 Receptor like protein 29 Arabidopsis thaliana
Q9SJH6 0.000199 46 36 4 105 2 RLP29 Receptor like protein 29 Arabidopsis thaliana
Q8GT95 1.25e-06 52 29 8 199 2 FOR1 Polygalacturonase inhibitor 1 Oryza sativa subsp. japonica
Q8GT95 0.000408 45 34 3 111 2 FOR1 Polygalacturonase inhibitor 1 Oryza sativa subsp. japonica
Q05C16 1.27e-06 53 34 0 104 1 LRRC63 Leucine-rich repeat-containing protein 63 Homo sapiens
Q05C16 1.01e-05 50 28 1 125 1 LRRC63 Leucine-rich repeat-containing protein 63 Homo sapiens
Q05C16 3.31e-05 48 30 1 125 1 LRRC63 Leucine-rich repeat-containing protein 63 Homo sapiens
D3ZAL8 1.38e-06 53 29 9 207 3 Lrrtm3 Leucine-rich repeat transmembrane neuronal protein 3 Rattus norvegicus
Q8BZ81 1.38e-06 53 29 9 207 2 Lrrtm3 Leucine-rich repeat transmembrane neuronal protein 3 Mus musculus
Q9LT96 1.39e-06 53 25 9 249 1 At5g49770 Probable leucine-rich repeat receptor-like protein kinase At5g49770 Arabidopsis thaliana
P51884 1.4e-06 52 29 11 235 1 LUM Lumican Homo sapiens
P40197 1.42e-06 52 29 10 238 1 GP5 Platelet glycoprotein V Homo sapiens
P40197 1.4e-05 50 28 7 205 1 GP5 Platelet glycoprotein V Homo sapiens
P28653 1.44e-06 52 25 6 203 1 Bgn Biglycan Mus musculus
P21810 1.48e-06 52 25 6 203 1 BGN Biglycan Homo sapiens
Q7M6Z0 1.57e-06 52 32 7 202 1 Rtn4rl2 Reticulon-4 receptor-like 2 Mus musculus
Q7M6Z0 8.98e-06 50 33 6 154 1 Rtn4rl2 Reticulon-4 receptor-like 2 Mus musculus
P12024 1.61e-06 53 26 12 278 1 chp Chaoptin Drosophila melanogaster
P12024 2.4e-05 49 24 9 259 1 chp Chaoptin Drosophila melanogaster
P12024 5.41e-05 48 27 11 261 1 chp Chaoptin Drosophila melanogaster
P12024 0.000729 44 29 11 255 1 chp Chaoptin Drosophila melanogaster
O46403 1.62e-06 52 25 6 203 2 BGN Biglycan Equus caballus
O46403 0.000881 43 26 9 250 2 BGN Biglycan Equus caballus
Q9C7S5 1.62e-06 53 29 7 188 1 PSY1R Tyrosine-sulfated glycopeptide receptor 1 Arabidopsis thaliana
Q9C7S5 1.76e-05 49 26 11 288 1 PSY1R Tyrosine-sulfated glycopeptide receptor 1 Arabidopsis thaliana
Q9C7S5 0.000344 45 25 16 294 1 PSY1R Tyrosine-sulfated glycopeptide receptor 1 Arabidopsis thaliana
O46390 1.65e-06 52 25 6 203 2 BGN Biglycan Ovis aries
O46390 0.000586 44 26 9 250 2 BGN Biglycan Ovis aries
P21809 1.75e-06 52 25 6 203 1 BGN Biglycan Bos taurus
P21809 0.00055 44 26 9 250 1 BGN Biglycan Bos taurus
P50608 1.77e-06 52 30 4 139 2 Fmod Fibromodulin Mus musculus
Q8IW52 1.85e-06 52 29 6 157 1 SLITRK4 SLIT and NTRK-like protein 4 Homo sapiens
Q9C637 1.86e-06 52 25 5 225 3 RLP6 Receptor-like protein 6 Arabidopsis thaliana
Q9C637 4.53e-05 48 26 12 295 3 RLP6 Receptor-like protein 6 Arabidopsis thaliana
B7XK66 1.96e-06 52 34 0 93 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Enterocytozoon bieneusi (strain H348)
B7XK66 7.62e-05 47 35 0 81 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Enterocytozoon bieneusi (strain H348)
Q4V8G0 2.01e-06 52 30 0 110 2 Lrrc63 Leucine-rich repeat-containing protein 63 Rattus norvegicus
Q4V8G0 5.93e-06 51 29 1 131 2 Lrrc63 Leucine-rich repeat-containing protein 63 Rattus norvegicus
Q4V8G0 0.000207 46 25 2 131 2 Lrrc63 Leucine-rich repeat-containing protein 63 Rattus norvegicus
Q9XIL9 2.08e-06 52 25 11 215 2 PEX3 Pollen-specific leucine-rich repeat extensin-like protein 3 Arabidopsis thaliana
O49879 2.12e-06 52 26 10 253 2 HCR9-0 Receptor-like protein Cf-9 homolog Solanum lycopersicum
O49879 5.31e-06 51 26 12 263 2 HCR9-0 Receptor-like protein Cf-9 homolog Solanum lycopersicum
O48849 2.17e-06 52 25 9 268 1 RLP23 Receptor like protein 23 Arabidopsis thaliana
O48849 0.000137 47 26 4 163 1 RLP23 Receptor like protein 23 Arabidopsis thaliana
P50609 2.22e-06 52 30 4 139 2 Fmod Fibromodulin Rattus norvegicus
P43298 2.34e-06 52 27 8 217 1 TMK1 Receptor protein kinase TMK1 Arabidopsis thaliana
Q6EMK4 2.35e-06 52 31 8 225 1 VASN Vasorin Homo sapiens
Q9NR97 2.43e-06 52 29 9 236 1 TLR8 Toll-like receptor 8 Homo sapiens
Q9VJ07 2.5e-06 52 27 5 197 4 Phlpp Protein phosphatase PHLPP-like protein Drosophila melanogaster
Q40235 2.56e-06 52 27 11 248 1 CF-9 Receptor-like protein Cf-9 Solanum pimpinellifolium
Q40235 0.000318 45 26 9 250 1 CF-9 Receptor-like protein Cf-9 Solanum pimpinellifolium
P24014 2.64e-06 52 26 11 279 1 sli Protein slit Drosophila melanogaster
P24014 0.000108 47 30 6 152 1 sli Protein slit Drosophila melanogaster
Q5B778 3.02e-06 52 42 0 78 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5B778 3.89e-05 48 37 0 78 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5B778 0.000468 45 28 3 139 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5B778 0.00059 45 26 2 152 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O35103 3.02e-06 51 30 9 210 2 Omd Osteomodulin Mus musculus
A4IIW9 3.05e-06 52 43 4 88 2 lingo1 Leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 1 Xenopus tropicalis
Q8AVS8 3.06e-06 51 34 1 100 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus laevis
Q8AVS8 1.2e-05 49 39 1 86 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus laevis
Q8AVS8 2.97e-05 48 35 0 79 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus laevis
Q8AVS8 6.72e-05 47 32 1 99 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus laevis
P51885 3.12e-06 51 36 6 121 1 Lum Lumican Mus musculus
P51885 1.54e-05 49 28 11 235 1 Lum Lumican Mus musculus
Q8K0S5 3.14e-06 51 34 8 153 1 Rtn4rl1 Reticulon-4 receptor-like 1 Mus musculus

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04365
Feature type CDS
Gene -
Product leucine-rich repeat domain-containing protein
Location 922968 - 923843 (strand: 1)
Length 876 (nucleotides) / 291 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2509
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00560 Leucine Rich Repeat
PF12799 Leucine Rich repeats (2 copies)
PF13855 Leucine rich repeat

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4886 Transcription (K) K Leucine-rich repeat (LRR) protein

Protein Sequence

MLHQNITSDTELNLDNGGHLSIDAFITPPYALRALSAYNNQLSEFPAGVCLNHHLRVLNLSCNQITQIRAQIAQLTRCEMLDLGHNHIVEVAPEIGALNELRFLYLSENGFSALPADFSGLHKLTYFNATDNKLTALPEWFLQMPELIEIRLYNNQIKELSAAVSGLKKAREIHLMNNSVTSIPDDIAALSALEILDLNNNKVSYITPLIGALNNLTTLNLRFNKLTELPADLSGLSSLTHLDLRANQLSTLPDSLADLPNLRKLDLRWNAFSKEPPVAEKLRQSGCIVLL

Flanking regions ( +/- flanking 50bp)

ACTAATCTGTAAAACTAATCCGTACCTGTTGACGCCGGAGATCTTCCCTGATGTTGCACCAAAATATTACGTCTGATACTGAACTGAACCTTGATAATGGCGGGCATCTGTCAATAGATGCCTTTATCACACCACCTTATGCCTTGCGGGCGCTCAGTGCGTATAATAATCAACTCAGTGAATTTCCGGCAGGGGTGTGTCTGAATCATCATCTGCGGGTGCTGAACCTTTCCTGTAATCAGATAACACAGATACGGGCACAGATTGCGCAGCTTACCCGCTGTGAAATGCTGGATTTGGGGCATAACCATATCGTGGAGGTTGCACCTGAAATTGGTGCGCTGAATGAATTGCGGTTTTTGTATCTTAGTGAGAATGGTTTTTCTGCATTACCGGCGGATTTTTCCGGGCTGCATAAACTGACTTATTTTAATGCGACTGACAACAAACTGACGGCGCTGCCGGAGTGGTTCTTACAGATGCCAGAACTGATTGAAATCCGGCTATATAACAATCAAATAAAAGAATTATCAGCGGCGGTCAGCGGGCTGAAAAAGGCGCGTGAAATTCACCTGATGAATAATTCGGTGACATCAATACCGGATGATATCGCAGCGCTGTCTGCGCTGGAAATACTCGATCTGAACAATAATAAAGTCAGTTACATTACGCCGTTAATCGGTGCACTGAATAATCTGACGACACTCAATCTGCGCTTCAATAAATTAACAGAATTACCGGCCGATCTCAGCGGGTTATCATCACTGACTCACCTGGATTTACGGGCTAATCAACTGAGTACACTGCCGGACAGCCTGGCGGATTTACCAAACCTGCGAAAACTGGATTTACGCTGGAATGCATTTTCAAAGGAGCCTCCGGTCGCTGAGAAACTGCGGCAGTCGGGGTGTATTGTATTGCTGTAAATGTGCGGTGGCAGCGGAGCAGTAAAAACAGAAAAGGGACCGCGATGGTC