Homologs in group_1031

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05815 FBDBKF_05815 81.8 Morganella morganii S1 sufD Fe-S cluster assembly protein SufD
EHELCC_11775 EHELCC_11775 81.8 Morganella morganii S2 sufD Fe-S cluster assembly protein SufD
NLDBIP_12115 NLDBIP_12115 81.8 Morganella morganii S4 sufD Fe-S cluster assembly protein SufD
LHKJJB_11975 LHKJJB_11975 81.8 Morganella morganii S3 sufD Fe-S cluster assembly protein SufD
HKOGLL_10590 HKOGLL_10590 81.8 Morganella morganii S5 sufD Fe-S cluster assembly protein SufD
PMI_RS06835 PMI_RS06835 57.7 Proteus mirabilis HI4320 sufD Fe-S cluster assembly protein SufD

Distribution of the homologs in the orthogroup group_1031

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1031

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77689 3.74e-144 421 50 5 420 1 sufD Iron-sulfur cluster assembly protein SufD Escherichia coli (strain K12)
Q55792 2.23e-39 150 27 7 385 3 slr0076 Iron-sulfur cluster assembly SufBD family protein slr0076 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9LQK7 2.82e-35 139 28 4 304 1 ABCI7 Protein ABCI7, chloroplastic Arabidopsis thaliana
Q49W57 1.78e-18 90 29 0 177 3 SSP1857 Iron-sulfur cluster assembly SufBD family protein SSP1857 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6GIH0 4.5e-18 89 27 2 230 3 SAR0880 Iron-sulfur cluster assembly SufBD family protein SAR0880 Staphylococcus aureus (strain MRSA252)
Q49682 5.99e-18 88 28 2 184 3 ML0594 Iron-sulfur cluster assembly SufBD family protein ML0594 Mycobacterium leprae (strain TN)
Q2YWN2 6.73e-18 89 26 2 230 3 SAB0778 Iron-sulfur cluster assembly SufBD family protein SAB0778 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5HHG8 7.58e-18 89 26 2 230 3 SACOL0918 Iron-sulfur cluster assembly SufBD family protein SACOL0918 Staphylococcus aureus (strain COL)
Q2FZY3 7.58e-18 89 26 2 230 3 SAOUHSC_00851 Iron-sulfur cluster assembly SufBD family protein SAOUHSC_00851 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q99VF9 7.58e-18 89 26 2 230 3 SAV0846 Iron-sulfur cluster assembly SufBD family protein SAV0846 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FIF6 7.58e-18 89 26 2 230 3 SAUSA300_0822 Iron-sulfur cluster assembly SufBD family protein SAUSA300_0822 Staphylococcus aureus (strain USA300)
Q7A1E0 7.58e-18 89 26 2 230 3 MW0799 Iron-sulfur cluster assembly SufBD family protein MW0799 Staphylococcus aureus (strain MW2)
Q6GB09 7.58e-18 89 26 2 230 3 SAS0788 Iron-sulfur cluster assembly SufBD family protein SAS0788 Staphylococcus aureus (strain MSSA476)
Q7A6L4 7.58e-18 89 26 2 230 1 SA0778 Iron-sulfur cluster assembly SufBD family protein SA0778 Staphylococcus aureus (strain N315)
Q8CTA3 1.08e-17 88 28 0 177 3 SE_0610 Iron-sulfur cluster assembly SufBD family protein SE_0610 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQP8 1.76e-17 87 28 0 177 3 SERP0500 Iron-sulfur cluster assembly SufBD family protein SERP0500 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L4T1 1.96e-17 87 28 0 177 3 SH2035 Iron-sulfur cluster assembly SufBD family protein SH2035 Staphylococcus haemolyticus (strain JCSC1435)
Q9TLX2 4.49e-17 86 26 1 223 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 Cyanidium caldarium
P59973 4.46e-16 83 27 2 184 3 BQ2027_MB1497 Iron-sulfur cluster assembly SufBD family protein Mb1497 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFP4 4.46e-16 83 27 2 184 3 MT1509 Iron-sulfur cluster assembly SufBD family protein MT1509 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WFP5 4.5e-16 83 27 2 184 1 Rv1462 Iron-sulfur cluster assembly SufBD family protein Rv1462 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O32162 7.19e-16 82 29 0 177 3 sufB Iron-sulfur cluster assembly protein SufB Bacillus subtilis (strain 168)
O32165 4.41e-15 80 28 0 164 3 sufD Iron-sulfur cluster assembly protein SufD Bacillus subtilis (strain 168)
P35912 5.76e-15 77 29 2 182 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 (Fragment) Galdieria sulphuraria
P48260 1.32e-14 79 29 2 186 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 Cyanophora paradoxa
Q8IIW9 1.78e-14 79 25 3 246 1 SufD Iron-sulfur cluster assembly protein SufD Plasmodium falciparum (isolate 3D7)
Q55790 2.17e-14 78 27 4 211 3 slr0074 Iron-sulfur cluster assembly SufBD family protein slr0074 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O50093 5.5e-14 77 40 1 100 3 PH1385 Iron-sulfur cluster assembly SufBD family protein PH1385 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q1XDP7 6.61e-14 77 27 0 164 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 Neopyropia yezoensis
Q9ZS97 2.08e-13 75 25 1 183 2 ABCI8 Iron-sulfur cluster assembly SufBD family protein ABCI8, chloroplastic Arabidopsis thaliana
Q49689 6.85e-13 74 23 6 289 3 ML0593 Iron-sulfur cluster assembly SufBD family protein ML0593 Mycobacterium leprae (strain TN)
P51240 7.8e-13 73 24 1 177 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 Porphyra purpurea
P77522 3.72e-12 71 28 0 160 1 sufB Iron-sulfur cluster assembly protein SufB Escherichia coli (strain K12)
Q83KW2 3.75e-12 71 28 0 160 3 sufB Iron-sulfur cluster assembly protein SufB Shigella flexneri
Q02857 8.1e-12 69 27 1 179 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 (Fragment) Antithamnion sp.
O78473 1.06e-11 70 27 1 173 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 Guillardia theta
P67126 2.75e-11 69 24 1 186 3 BQ2027_MB1496 Iron-sulfur cluster assembly SufBD family protein Mb1496 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFP7 2.75e-11 69 24 1 186 1 Rv1461 Iron-sulfur cluster assembly SufBD family protein Rv1461 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFP6 2.75e-11 69 24 1 186 3 MT1508 Iron-sulfur cluster assembly SufBD family protein MT1508 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P49530 2.9e-11 68 26 1 173 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 Trieres chinensis
Q25799 4.98e-11 68 24 0 154 1 SufB Iron-sulfur cluster assembly protein SufB Plasmodium falciparum (isolate 3D7)
A0A509AQJ1 1.44e-09 64 23 3 250 1 SufD Iron-sulfur cluster assembly protein SufD Plasmodium berghei (strain Anka)
O30305 1.22e-06 53 32 5 129 3 AF_2365 Iron-sulfur cluster assembly SufBD family protein AF_2365 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O27218 3.67e-06 52 26 3 145 3 MTH_1150 Iron-sulfur cluster assembly SufBD family protein MTH_1150 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q60349 4.6e-06 52 26 8 206 3 MJ0034 Iron-sulfur cluster assembly SufBD family protein MJ0034 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O58613 5.54e-06 51 25 8 233 3 PH0883 Iron-sulfur cluster assembly SufBD family protein PH0883 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q50519 7.05e-06 51 36 0 66 3 None Iron-sulfur cluster assembly SufBD family protein MTH1150 homolog Methanothermobacter thermautotrophicus (strain Winter)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03510
Feature type CDS
Gene sufD
Product Fe-S cluster assembly protein SufD
Location 750794 - 752110 (strand: 1)
Length 1317 (nucleotides) / 438 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1031
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01458 SUF system FeS cluster assembly, SufBD

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0719 Posttranslational modification, protein turnover, chaperones (O) O Fe-S cluster assembly scaffold protein SufB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K09015 Fe-S cluster assembly protein SufD - -

Protein Sequence

MAGLLTNSERALKRSQVSERNAAAMAQIDALIAQRQRPLSDNALHHWQLAQKTGFPAFRQEDWHYTSLDNLLAAEYQQLTGAIDALPADVMTTLNAYRVVLVDGVFAPQWSDTDFGAYELSIADDKRAFPAAVNGEIFLYLTESLAQSPLVIRVKPGVQADKPLYIVNISAAHNDGLNMCHSRYHLEIGANAAASVIEHFISSGSASAHFTGARLSANIGENSDFRHLKLGFENAQAYHFAHNDLVIDANARVESTSFLLGGKLTRHHTSTQLNGEGVMLSMNSLVLPKNGEVADTRTYLEHNKGYCESRQRHKVIVMDNSKAVFNGMIKVAPHALKTDGQMTNNNLLLGKKAEVDTKPQLEIYADDVKCSHGATIGRIDEEQLFYLRARGISEKEAKQMIILAFAAELTDSISDSVLNDVVMTRIRGALDQGDKERA

Flanking regions ( +/- flanking 50bp)

TATCAAATCCGGTGATTTCTCACTGGCTAAAAAACTGGAGGAGCAGGGATATGGCTGGCTTATTGACCAACAGTGAACGCGCGCTGAAACGCAGTCAGGTCAGTGAGCGCAATGCGGCGGCGATGGCACAGATTGACGCGCTGATTGCACAACGCCAACGCCCGCTCTCTGACAATGCCCTGCATCACTGGCAACTGGCACAAAAAACCGGCTTTCCGGCGTTTCGCCAGGAAGACTGGCACTATACATCACTGGATAATCTGCTTGCGGCAGAGTATCAGCAACTGACGGGTGCGATTGATGCGCTGCCTGCGGACGTGATGACGACACTCAATGCTTACCGCGTGGTGCTGGTGGATGGTGTGTTTGCGCCACAGTGGAGTGATACGGATTTTGGTGCTTATGAACTGAGCATTGCCGATGATAAACGTGCGTTTCCGGCGGCGGTGAACGGAGAAATTTTCCTGTATCTGACGGAAAGCCTTGCGCAAAGCCCGCTGGTTATTCGTGTGAAACCGGGTGTGCAGGCGGATAAACCTTTATATATCGTGAATATTTCAGCGGCACATAATGACGGGCTGAATATGTGTCACAGCCGTTATCATCTTGAGATCGGGGCAAATGCAGCCGCCTCGGTGATTGAACATTTTATCAGTTCCGGCTCAGCATCCGCACATTTTACCGGCGCACGGCTGAGTGCCAACATTGGTGAAAACAGTGATTTCCGCCACCTGAAACTGGGTTTTGAAAATGCACAGGCTTATCATTTCGCTCACAATGATTTAGTGATTGATGCCAATGCCCGGGTGGAAAGCACCAGCTTCCTGCTTGGCGGCAAACTGACCCGGCACCACACCAGCACACAACTCAACGGCGAGGGTGTGATGCTTTCCATGAACAGTCTGGTACTGCCGAAGAATGGTGAAGTGGCAGACACGCGGACGTATCTGGAACATAACAAAGGTTATTGTGAAAGCCGTCAGCGGCATAAAGTTATCGTAATGGATAACAGCAAAGCGGTATTCAACGGCATGATTAAAGTGGCGCCGCACGCCCTGAAAACAGACGGGCAGATGACTAATAACAATCTGTTACTGGGCAAAAAAGCGGAAGTGGATACCAAACCACAGCTGGAAATCTATGCAGATGATGTGAAGTGCAGTCATGGCGCGACCATCGGGCGGATTGATGAAGAGCAGCTTTTCTATCTGCGCGCGCGCGGGATCTCAGAAAAAGAGGCAAAGCAGATGATTATCCTCGCGTTTGCCGCAGAACTGACGGACAGCATCAGTGACAGCGTACTTAATGATGTGGTCATGACACGCATTCGCGGAGCGCTTGACCAGGGTGATAAGGAGCGGGCATGAGTTATCCGGTACAGCAGTTGCGGGCAGATTTTCCGGTTTTGTCCGCTATT