Homologs in group_1859

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13500 FBDBKF_13500 77.5 Morganella morganii S1 catE VOC family protein
EHELCC_08595 EHELCC_08595 77.5 Morganella morganii S2 catE VOC family protein
NLDBIP_08920 NLDBIP_08920 77.5 Morganella morganii S4 catE VOC family protein
LHKJJB_05345 LHKJJB_05345 77.5 Morganella morganii S3 catE VOC family protein
HKOGLL_05570 HKOGLL_05570 77.5 Morganella morganii S5 catE VOC family protein
PMI_RS06565 PMI_RS06565 53.5 Proteus mirabilis HI4320 - VOC family protein

Distribution of the homologs in the orthogroup group_1859

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1859

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P52096 6.34e-53 166 59 0 129 4 yaeR Uncharacterized protein YaeR Escherichia coli (strain K12)
P45871 3.6e-44 143 54 0 126 4 ywkD Uncharacterized protein YwkD Bacillus subtilis (strain 168)
P54721 0.000589 41 27 1 108 1 catE Catechol-2,3-dioxygenase Bacillus subtilis (strain 168)
Q4L2Y9 0.001 40 29 4 127 3 fosB Metallothiol transferase FosB Staphylococcus haemolyticus (strain JCSC1435)
Q55317 0.001 40 29 4 127 3 fosB Metallothiol transferase FosB Staphylococcus haemolyticus

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03260
Feature type CDS
Gene -
Product VOC family protein
Location 696032 - 696421 (strand: 1)
Length 390 (nucleotides) / 129 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1859
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00903 Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0346 Secondary metabolites biosynthesis, transport and catabolism (Q) Q Catechol 2,3-dioxygenase or related enzyme, vicinal oxygen chelate (VOC) family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K08234 glyoxylase I family protein - -

Protein Sequence

MLKIEKIDHIAVIASDKAASLAFYCDVLGFTVISEHYREARNSWKIDLALNGEYLLELFTFPASPARLSQPEACGLRHLAFAVNDLAAWKAFLDAQAIHCDGIRTDEFTGKHFLFCFDPDNLPVELYER

Flanking regions ( +/- flanking 50bp)

AATCTGACGTCGGTAAACGCCCCGGAAACGGGGCGTTATAAAGGAATAGCATGCTGAAGATTGAGAAAATTGATCATATTGCAGTGATTGCATCAGACAAAGCGGCCAGCCTGGCGTTTTATTGTGATGTGCTTGGTTTTACGGTGATCAGTGAGCATTATCGTGAAGCGCGGAATTCGTGGAAAATCGATCTGGCGCTGAACGGAGAGTATTTACTTGAGCTGTTTACTTTCCCGGCAAGTCCGGCGCGTCTCAGTCAGCCGGAAGCCTGCGGTTTGCGCCATCTGGCCTTTGCTGTGAATGACCTTGCGGCGTGGAAAGCCTTTCTGGACGCACAGGCAATTCACTGTGACGGGATCCGGACGGATGAATTCACCGGAAAACATTTTTTATTCTGTTTTGATCCGGATAATCTTCCGGTGGAGTTGTATGAGCGCTGACAGTAAATGCGGGATAAAAAAAAGCCAGCGCGAAGGCTGGCTGAGAAACT