Homologs in group_569

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01490 FBDBKF_01490 83.9 Morganella morganii S1 grpE nucleotide exchange factor GrpE
EHELCC_00055 EHELCC_00055 83.9 Morganella morganii S2 grpE nucleotide exchange factor GrpE
NLDBIP_03405 NLDBIP_03405 83.9 Morganella morganii S4 grpE nucleotide exchange factor GrpE
LHKJJB_04920 LHKJJB_04920 83.9 Morganella morganii S3 grpE nucleotide exchange factor GrpE
HKOGLL_02125 HKOGLL_02125 83.9 Morganella morganii S5 grpE nucleotide exchange factor GrpE
PMI_RS09375 PMI_RS09375 63.5 Proteus mirabilis HI4320 grpE nucleotide exchange factor GrpE

Distribution of the homologs in the orthogroup group_569

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_569

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F059 3.73e-79 237 61 3 203 3 grpE Protein GrpE Proteus mirabilis (strain HI4320)
B1JG65 4.46e-74 224 61 2 192 3 grpE Protein GrpE Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66DA8 4.46e-74 224 61 2 192 3 grpE Protein GrpE Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TNU6 4.46e-74 224 61 2 192 3 grpE Protein GrpE Yersinia pestis (strain Pestoides F)
A9R2E4 4.46e-74 224 61 2 192 3 grpE Protein GrpE Yersinia pestis bv. Antiqua (strain Angola)
B2K8E3 4.46e-74 224 61 2 192 3 grpE Protein GrpE Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FKS2 4.46e-74 224 61 2 192 3 grpE Protein GrpE Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q1CFL2 8.59e-74 223 61 2 192 3 grpE Protein GrpE Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CH40 8.59e-74 223 61 2 192 3 grpE Protein GrpE Yersinia pestis
Q1CAG9 8.59e-74 223 61 2 192 3 grpE Protein GrpE Yersinia pestis bv. Antiqua (strain Antiqua)
Q7N1U7 1.23e-73 223 59 1 193 3 grpE Protein GrpE Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6D9J8 8.47e-72 218 56 0 192 3 grpE Protein GrpE Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q2NS02 8.66e-72 218 57 0 192 3 grpE Protein GrpE Sodalis glossinidius (strain morsitans)
B2VEC6 1.04e-70 216 59 3 196 3 grpE Protein GrpE Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q6D8X9 1.42e-70 215 56 0 192 3 grpE Protein GrpE Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GI40 5.89e-70 213 57 1 192 3 grpE Protein GrpE Serratia proteamaculans (strain 568)
A1JKI6 1.66e-66 205 58 2 197 3 grpE Protein GrpE Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q1LSM6 6.01e-65 201 56 1 176 3 grpE Protein GrpE Baumannia cicadellinicola subsp. Homalodisca coagulata
B5Z231 9.95e-64 198 52 2 197 3 grpE Protein GrpE Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q3YYM5 1.07e-63 198 52 2 197 3 grpE Protein GrpE Shigella sonnei (strain Ss046)
Q7C0D0 1.07e-63 198 52 2 197 3 grpE Protein GrpE Shigella flexneri
Q32CX5 1.07e-63 198 52 2 197 3 grpE Protein GrpE Shigella dysenteriae serotype 1 (strain Sd197)
Q31XD2 1.07e-63 198 52 2 197 3 grpE Protein GrpE Shigella boydii serotype 4 (strain Sb227)
B2TYN5 1.07e-63 198 52 2 197 3 grpE Protein GrpE Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I635 1.07e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli (strain SE11)
B7N6J9 1.07e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IVM0 1.07e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FEY9 1.07e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEM6 1.07e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A3C0 1.07e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli O9:H4 (strain HS)
B7M983 1.07e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli O8 (strain IAI1)
B7NSB2 1.07e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q7ABI1 1.07e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli O157:H7
B7LDK2 1.07e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli (strain 55989 / EAEC)
B7UH62 1.07e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZQ54 1.11e-63 197 52 2 197 3 grpE Protein GrpE Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1R8B1 1.13e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli (strain UTI89 / UPEC)
B7MYA6 1.13e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli O81 (strain ED1a)
B7MIV1 1.13e-63 198 52 2 197 3 grpE Protein GrpE Escherichia coli O45:K1 (strain S88 / ExPEC)
Q0T181 1.49e-63 197 52 2 197 3 grpE Protein GrpE Shigella flexneri serotype 5b (strain 8401)
P09372 1.85e-63 197 51 2 197 1 grpE Protein GrpE Escherichia coli (strain K12)
B1XBT4 1.85e-63 197 51 2 197 3 grpE Protein GrpE Escherichia coli (strain K12 / DH10B)
C4ZYN1 1.85e-63 197 51 2 197 1 grpE Protein GrpE Escherichia coli (strain K12 / MC4100 / BW2952)
B1LPC1 2.78e-63 197 51 2 197 3 grpE Protein GrpE Escherichia coli (strain SMS-3-5 / SECEC)
A7MHW7 9.53e-63 195 53 2 197 3 grpE Protein GrpE Cronobacter sakazakii (strain ATCC BAA-894)
A4WDH8 3.61e-62 194 53 2 197 3 grpE Protein GrpE Enterobacter sp. (strain 638)
A6TCM1 5.59e-62 193 53 2 197 3 grpE Protein GrpE Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XVJ9 6.1e-62 193 53 2 197 3 grpE Protein GrpE Klebsiella pneumoniae (strain 342)
Q7CPZ4 1.76e-59 187 51 2 197 3 grpE Protein GrpE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XEY8 1.76e-59 187 51 2 197 3 grpE Protein GrpE Salmonella typhi
B4TS61 1.76e-59 187 51 2 197 3 grpE Protein GrpE Salmonella schwarzengrund (strain CVM19633)
B5BE99 1.76e-59 187 51 2 197 3 grpE Protein GrpE Salmonella paratyphi A (strain AKU_12601)
Q5PFG9 1.76e-59 187 51 2 197 3 grpE Protein GrpE Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T2B9 1.76e-59 187 51 2 197 3 grpE Protein GrpE Salmonella newport (strain SL254)
B4TE57 1.76e-59 187 51 2 197 3 grpE Protein GrpE Salmonella heidelberg (strain SL476)
B5QUG9 1.76e-59 187 51 2 197 3 grpE Protein GrpE Salmonella enteritidis PT4 (strain P125109)
B5RD90 1.94e-59 187 51 2 197 3 grpE Protein GrpE Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q7VRQ6 3.03e-57 181 48 1 178 3 grpE Protein GrpE Blochmanniella floridana
Q492C7 3.82e-55 176 54 0 152 3 grpE Protein GrpE Blochmanniella pennsylvanica (strain BPEN)
A6VMQ9 6e-55 176 49 3 199 3 grpE Protein GrpE Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
P43732 1.16e-54 175 55 2 166 3 grpE Protein GrpE Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0KMI7 1.68e-54 174 51 2 188 3 grpE Protein GrpE Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q7MN92 1.22e-53 172 49 5 202 3 grpE Protein GrpE Vibrio vulnificus (strain YJ016)
Q3IKR2 3.73e-53 171 51 3 185 3 grpE Protein GrpE Pseudoalteromonas translucida (strain TAC 125)
Q9CNU1 1.72e-52 169 54 1 161 3 grpE Protein GrpE Pasteurella multocida (strain Pm70)
A4SQ26 2.07e-52 169 50 2 188 3 grpE Protein GrpE Aeromonas salmonicida (strain A449)
A0KZB0 2.09e-52 169 51 1 164 3 grpE Protein GrpE Shewanella sp. (strain ANA-3)
B8CS27 2.73e-52 169 44 2 199 3 grpE Protein GrpE Shewanella piezotolerans (strain WP3 / JCM 13877)
B0UT70 3.01e-52 169 47 2 194 3 grpE Protein GrpE Histophilus somni (strain 2336)
Q0I2Y4 3.01e-52 169 47 2 194 3 grpE Protein GrpE Histophilus somni (strain 129Pt)
B3H0M9 3.33e-52 169 54 2 170 3 grpE Protein GrpE Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0BTB9 4.47e-52 168 53 2 170 3 grpE Protein GrpE Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q0HSW5 5.8e-52 168 51 1 164 3 grpE Protein GrpE Shewanella sp. (strain MR-7)
A3MZ85 6.13e-52 168 53 2 170 3 grpE Protein GrpE Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q6LUA8 7.89e-52 168 49 3 199 3 grpE Protein GrpE Photobacterium profundum (strain SS9)
C3LTA4 1.03e-51 167 53 2 168 3 grpE Protein GrpE Vibrio cholerae serotype O1 (strain M66-2)
O30862 1.03e-51 167 53 2 168 3 grpE Protein GrpE Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F369 1.03e-51 167 53 2 168 3 grpE Protein GrpE Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A9KTL2 1.67e-51 167 52 1 164 3 grpE Protein GrpE Shewanella baltica (strain OS195)
A6WL03 1.67e-51 167 52 1 164 3 grpE Protein GrpE Shewanella baltica (strain OS185)
A3D2B1 1.67e-51 167 52 1 164 3 grpE Protein GrpE Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAU9 1.67e-51 167 52 1 164 3 grpE Protein GrpE Shewanella baltica (strain OS223)
B8F790 3.09e-51 166 54 1 161 3 grpE Protein GrpE Glaesserella parasuis serovar 5 (strain SH0165)
B0TQ37 3.12e-51 166 45 3 199 3 grpE Protein GrpE Shewanella halifaxensis (strain HAW-EB4)
Q47XI4 4.98e-51 166 49 2 167 3 grpE Protein GrpE Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A3QGP0 1.1e-50 165 57 0 137 3 grpE Protein GrpE Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q8EGS0 2.13e-50 164 50 1 164 3 grpE Protein GrpE Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HGL4 2.17e-50 164 50 1 164 3 grpE Protein GrpE Shewanella sp. (strain MR-4)
A1RLV4 2.2e-50 164 50 1 164 3 grpE Protein GrpE Shewanella sp. (strain W3-18-1)
A4Y4W9 2.2e-50 164 50 1 164 3 grpE Protein GrpE Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1S8D5 2.72e-50 164 47 2 195 3 grpE Protein GrpE Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q7VMB7 3.22e-50 164 53 2 161 3 grpE Protein GrpE Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B6EKA3 3.7e-50 163 48 5 198 3 grpE Protein GrpE Aliivibrio salmonicida (strain LFI1238)
Q12L25 3.89e-50 164 47 3 195 3 grpE Protein GrpE Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A8H6X2 7.4e-50 163 50 1 164 3 grpE Protein GrpE Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A8FYL1 1.45e-49 162 50 1 164 3 grpE Protein GrpE Shewanella sediminis (strain HAW-EB3)
Q9L7Z3 1.48e-49 162 45 4 204 3 grpE Protein GrpE Vibrio proteolyticus
Q5E3A5 1.75e-49 162 50 2 170 3 grpE Protein GrpE Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87RX5 2.18e-49 161 52 1 159 3 grpE Protein GrpE Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q21H35 2.99e-49 161 45 3 197 3 grpE Protein GrpE Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q4KIH2 3.34e-49 160 49 2 175 3 grpE Protein GrpE Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q07ZD3 3.42e-49 161 51 1 164 3 grpE Protein GrpE Shewanella frigidimarina (strain NCIMB 400)
Q6IT00 4.83e-49 160 52 1 159 3 grpE Protein GrpE Vibrio harveyi
B5FA13 7.22e-49 160 50 2 170 3 grpE Protein GrpE Aliivibrio fischeri (strain MJ11)
A4XYF7 1e-48 159 54 0 144 3 grpE Protein GrpE Pseudomonas mendocina (strain ymp)
Q48E61 1.38e-48 159 52 0 144 3 grpE Protein GrpE Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A6VCL9 1.51e-48 159 50 0 158 3 grpE Protein GrpE Pseudomonas aeruginosa (strain PA7)
A5W9A4 1.63e-48 159 55 0 145 3 grpE Protein GrpE Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q87WN9 2.54e-48 158 52 0 144 3 grpE Protein GrpE Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9HV42 3.34e-48 158 49 2 168 3 grpE Protein GrpE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02FR0 3.34e-48 158 49 2 168 3 grpE Protein GrpE Pseudomonas aeruginosa (strain UCBPP-PA14)
Q88DU1 3.9e-48 158 55 0 145 3 grpE Protein GrpE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1IF60 5.53e-48 157 52 0 146 3 grpE Protein GrpE Pseudomonas entomophila (strain L48)
C1DFM4 6.98e-48 157 48 2 173 3 grpE Protein GrpE Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B7VJW7 1.22e-47 157 50 1 159 3 grpE Protein GrpE Vibrio atlanticus (strain LGP32)
Q4ZNP6 1.36e-47 156 51 0 144 3 grpE Protein GrpE Pseudomonas syringae pv. syringae (strain B728a)
B7V1H4 1.63e-47 156 48 2 168 3 grpE Protein GrpE Pseudomonas aeruginosa (strain LESB58)
B1J253 6.19e-47 155 53 0 146 3 grpE Protein GrpE Pseudomonas putida (strain W619)
C3K276 6.65e-47 155 52 1 145 3 grpE Protein GrpE Pseudomonas fluorescens (strain SBW25)
Q0VST7 7.41e-47 155 50 0 152 3 grpE Protein GrpE Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q3KIA1 8.49e-46 152 49 2 164 3 grpE Protein GrpE Pseudomonas fluorescens (strain Pf0-1)
B1KQY9 8.51e-46 152 50 1 164 3 grpE Protein GrpE Shewanella woodyi (strain ATCC 51908 / MS32)
Q15UD4 6.31e-45 150 47 4 197 3 grpE Protein GrpE Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B0KIS6 1.44e-44 149 48 2 177 3 grpE Protein GrpE Pseudomonas putida (strain GB-1)
C5BQ34 2.65e-43 145 53 1 153 3 grpE Protein GrpE Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q8DF59 7.2e-43 144 47 5 185 3 grpE Protein GrpE Vibrio vulnificus (strain CMCP6)
A1STE3 1.07e-42 145 53 0 131 3 grpE Protein GrpE Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q8D392 1.49e-42 145 44 1 154 3 grpE Protein GrpE Wigglesworthia glossinidia brevipalpis
Q31HA8 1.66e-42 144 42 2 173 3 grpE Protein GrpE Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q1QSW9 5.53e-42 143 48 2 154 3 grpE Protein GrpE Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q3J7D7 8.75e-41 140 44 1 168 3 grpE Protein GrpE Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A4VPQ6 8.15e-40 137 48 1 172 3 grpE Protein GrpE Stutzerimonas stutzeri (strain A1501)
A4IR32 3.59e-39 136 43 3 178 3 grpE Protein GrpE Geobacillus thermodenitrificans (strain NG80-2)
Q607A4 1.59e-38 133 48 1 150 3 grpE Protein GrpE Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5KWZ6 2.52e-38 134 45 2 157 1 grpE Protein GrpE Geobacillus kaustophilus (strain HTA426)
Q9KWS8 6.39e-37 130 44 2 157 3 grpE Protein GrpE Parageobacillus thermoglucosidasius
Q5WV14 1.2e-36 129 48 1 134 3 grpE Protein GrpE Legionella pneumophila (strain Lens)
O32481 1.21e-36 129 48 1 134 3 grpE Protein GrpE Legionella pneumophila
A5IDK9 1.28e-36 129 48 1 134 3 grpE Protein GrpE Legionella pneumophila (strain Corby)
Q5ZTY2 1.33e-36 129 48 1 134 3 grpE Protein GrpE Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
B7GKC7 1.72e-36 129 41 2 162 3 grpE Protein GrpE Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q5X3M6 3.17e-36 128 47 1 134 3 grpE Protein GrpE Legionella pneumophila (strain Paris)
Q1H3B7 3.48e-36 127 49 4 169 3 grpE Protein GrpE Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q0A7E2 4.86e-36 128 40 3 195 3 grpE Protein GrpE Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B8GNX0 2.48e-35 125 51 1 132 3 grpE Protein GrpE Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q1BYX5 1.03e-34 124 50 2 136 3 grpE Protein GrpE Burkholderia orbicola (strain AU 1054)
B1JW17 1.03e-34 124 50 2 136 3 grpE Protein GrpE Burkholderia orbicola (strain MC0-3)
A0K4S6 1.03e-34 124 50 2 136 3 grpE Protein GrpE Burkholderia cenocepacia (strain HI2424)
B2SXC5 1.32e-34 124 47 4 163 3 grpE Protein GrpE Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q39JD0 1.49e-34 123 50 2 136 3 grpE Protein GrpE Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A4IX27 1.78e-34 123 40 3 195 3 grpE Protein GrpE Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NFG6 1.78e-34 123 40 3 195 3 grpE Protein GrpE Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14GW8 1.78e-34 123 40 3 195 3 grpE Protein GrpE Francisella tularensis subsp. tularensis (strain FSC 198)
A1AXV2 1.89e-34 123 41 0 143 3 grpE Protein GrpE Ruthia magnifica subsp. Calyptogena magnifica
P48204 6.57e-34 122 40 3 195 3 grpE Protein GrpE Francisella tularensis
Q2A329 6.57e-34 122 40 3 195 3 grpE Protein GrpE Francisella tularensis subsp. holarctica (strain LVS)
A7NCM8 6.57e-34 122 40 3 195 3 grpE Protein GrpE Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A1K4C6 8.92e-34 121 50 2 135 3 grpE Protein GrpE Azoarcus sp. (strain BH72)
Q0BLK5 9.08e-34 121 40 3 195 3 grpE Protein GrpE Francisella tularensis subsp. holarctica (strain OSU18)
Q59240 9.44e-34 122 44 1 133 3 grpE Protein GrpE Geobacillus stearothermophilus
A0Q7F1 1.09e-33 121 40 3 195 3 grpE Protein GrpE Francisella tularensis subsp. novicida (strain U112)
A4JBR9 1.15e-33 121 50 3 136 3 grpE Protein GrpE Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q65H53 1.38e-33 121 40 1 145 3 grpE Protein GrpE Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q2SYZ6 1.66e-33 120 48 2 136 3 grpE Protein GrpE Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A9AGC0 1.75e-33 120 49 3 136 3 grpE Protein GrpE Burkholderia multivorans (strain ATCC 17616 / 249)
B4EDZ4 2.1e-33 120 49 3 136 3 grpE Protein GrpE Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q63R45 2.94e-33 120 48 2 136 3 grpE Protein GrpE Burkholderia pseudomallei (strain K96243)
A3ND70 2.94e-33 120 48 2 136 3 grpE Protein GrpE Burkholderia pseudomallei (strain 668)
Q3JP08 2.94e-33 120 48 2 136 3 grpE Protein GrpE Burkholderia pseudomallei (strain 1710b)
A3NYX9 2.94e-33 120 48 2 136 3 grpE Protein GrpE Burkholderia pseudomallei (strain 1106a)
A1V0U4 2.94e-33 120 48 2 136 3 grpE Protein GrpE Burkholderia mallei (strain SAVP1)
Q62HD3 2.94e-33 120 48 2 136 3 grpE Protein GrpE Burkholderia mallei (strain ATCC 23344)
A2S567 2.94e-33 120 48 2 136 3 grpE Protein GrpE Burkholderia mallei (strain NCTC 10229)
A3MNA1 2.94e-33 120 48 2 136 3 grpE Protein GrpE Burkholderia mallei (strain NCTC 10247)
Q9L516 3.97e-33 120 42 5 189 3 grpE Protein GrpE Psychrobacter sp. (strain St1)
B2SGV9 5.44e-33 119 39 3 195 3 grpE Protein GrpE Francisella tularensis subsp. mediasiatica (strain FSC147)
Q47HK1 9.37e-33 119 49 2 135 3 grpE Protein GrpE Dechloromonas aromatica (strain RCB)
B5EC43 1.06e-32 119 41 4 175 3 grpE Protein GrpE Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q8PAL0 1.07e-32 118 46 1 132 3 grpE Protein GrpE Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
C6E644 1.08e-32 118 41 4 175 3 grpE Protein GrpE Geobacter sp. (strain M21)
Q3BVB9 1.12e-32 118 46 1 132 3 grpE Protein GrpE Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PMB1 1.12e-32 118 46 1 132 3 grpE Protein GrpE Xanthomonas axonopodis pv. citri (strain 306)
A5EYG2 1.22e-32 118 43 1 137 3 grpE Protein GrpE Dichelobacter nodosus (strain VCS1703A)
Q5H187 1.69e-32 117 47 2 133 3 grpE Protein GrpE Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SQU5 1.69e-32 117 47 2 133 3 grpE Protein GrpE Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P460 1.69e-32 117 47 2 133 3 grpE Protein GrpE Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2Y6T9 1.94e-32 118 49 3 136 3 grpE Protein GrpE Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A6T227 2.35e-32 117 45 5 173 3 grpE Protein GrpE Janthinobacterium sp. (strain Marseille)
B2JGE4 2.63e-32 118 49 3 135 3 grpE Protein GrpE Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q145F3 3.14e-32 117 49 3 135 3 grpE Protein GrpE Paraburkholderia xenovorans (strain LB400)
B0TYF1 4.13e-32 117 43 1 145 3 grpE Protein GrpE Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B5ENA4 6.68e-32 116 46 2 158 3 grpE Protein GrpE Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J7Y0 6.68e-32 116 46 2 158 3 grpE Protein GrpE Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
B4SSQ5 1.28e-31 115 46 2 132 3 grpE Protein GrpE Stenotrophomonas maltophilia (strain R551-3)
Q1LPN6 3.91e-31 114 44 3 157 3 grpE Protein GrpE Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A7Z6W2 4.1e-31 114 38 4 171 3 grpE Protein GrpE Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q39PT6 4.77e-31 114 43 2 136 3 grpE Protein GrpE Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q0AIY2 5.98e-31 114 40 5 186 3 grpE Protein GrpE Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q5P1H4 6.83e-31 114 50 2 152 3 grpE Protein GrpE Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B2FMY4 3.99e-30 111 45 1 131 3 grpE Protein GrpE Stenotrophomonas maltophilia (strain K279a)
B2UBP7 4.1e-30 112 47 3 142 3 grpE Protein GrpE Ralstonia pickettii (strain 12J)
A4G8D3 4.72e-30 111 43 4 172 3 grpE Protein GrpE Herminiimonas arsenicoxydans
A0LH27 8.26e-30 111 42 2 144 3 grpE Protein GrpE Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q8XW36 1.22e-29 111 47 4 152 3 grpE Protein GrpE Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3SIN5 1.26e-29 110 47 2 135 3 grpE Protein GrpE Thiobacillus denitrificans (strain ATCC 25259)
O08384 1.67e-29 110 40 6 173 3 grpE Protein GrpE Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A1TLI0 2.84e-29 110 44 4 161 3 grpE Protein GrpE Paracidovorax citrulli (strain AAC00-1)
A1ANV1 4.79e-29 109 35 3 192 3 grpE Protein GrpE Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A5GDC7 4.86e-29 109 44 2 133 3 grpE Protein GrpE Geotalea uraniireducens (strain Rf4)
A8FFD3 6.26e-29 108 36 2 152 3 grpE Protein GrpE Bacillus pumilus (strain SAFR-032)
A1WX32 6.38e-29 110 38 1 155 3 grpE Protein GrpE Halorhodospira halophila (strain DSM 244 / SL1)
B9MDJ6 6.39e-29 108 42 4 161 3 grpE Protein GrpE Acidovorax ebreus (strain TPSY)
Q9KD73 6.65e-29 109 41 2 151 3 grpE Protein GrpE Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q128K3 6.85e-29 108 40 7 195 3 grpE Protein GrpE Polaromonas sp. (strain JS666 / ATCC BAA-500)
B3R450 7.88e-29 108 48 3 131 3 grpE Protein GrpE Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A7GXU2 7.96e-29 108 40 2 153 3 grpE Protein GrpE Campylobacter curvus (strain 525.92)
A4SZR9 8.51e-29 108 45 4 151 3 grpE Protein GrpE Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q03WI1 8.89e-29 108 42 1 135 3 grpE Protein GrpE Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q9PB04 9.74e-29 108 44 1 133 3 grpE Protein GrpE Xylella fastidiosa (strain 9a5c)
A7GT09 1.15e-28 108 38 2 143 3 grpE Protein GrpE Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q87BS7 1.6e-28 107 44 1 133 3 grpE Protein GrpE Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6F7 1.6e-28 107 44 1 133 3 grpE Protein GrpE Xylella fastidiosa (strain M23)
B1XRU2 1.81e-28 107 45 4 151 3 grpE Protein GrpE Polynucleobacter necessarius subsp. necessarius (strain STIR1)
B7HPL4 3.13e-28 107 37 2 143 3 grpE Protein GrpE Bacillus cereus (strain AH187)
Q7NXI4 3.39e-28 107 43 4 153 3 grpE Protein GrpE Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7MA34 3.51e-28 107 36 2 173 3 grpE Protein GrpE Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A1VMG3 3.95e-28 107 45 6 164 3 grpE Protein GrpE Polaromonas naphthalenivorans (strain CJ2)
Q6HDK6 4.07e-28 107 39 1 132 3 grpE Protein GrpE Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634M6 4.07e-28 107 39 1 132 3 grpE Protein GrpE Bacillus cereus (strain ZK / E33L)
B7JN40 4.07e-28 107 39 1 132 3 grpE Protein GrpE Bacillus cereus (strain AH820)
Q81LS1 4.07e-28 107 39 1 132 3 grpE Protein GrpE Bacillus anthracis
Q818E8 4.11e-28 107 39 1 132 3 grpE Protein GrpE Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HCU1 4.11e-28 107 39 1 132 3 grpE Protein GrpE Bacillus cereus (strain B4264)
B7IYG8 4.11e-28 107 39 1 132 3 grpE Protein GrpE Bacillus cereus (strain G9842)
Q730M0 4.5e-28 107 37 2 143 3 grpE Protein GrpE Bacillus cereus (strain ATCC 10987 / NRS 248)
Q473L4 6.77e-28 106 43 4 157 3 grpE Protein GrpE Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A1WAR5 9e-28 105 41 4 161 3 grpE Protein GrpE Acidovorax sp. (strain JS42)
A1WGK0 9.22e-28 105 44 5 163 3 grpE Protein GrpE Verminephrobacter eiseniae (strain EF01-2)
Q89AN1 1.17e-27 106 32 2 175 3 grpE1 Protein GrpE 1 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q7VVY0 1.72e-27 105 43 4 139 3 grpE Protein GrpE Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W517 1.72e-27 105 43 4 139 3 grpE Protein GrpE Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WGI2 1.72e-27 105 43 4 139 3 grpE Protein GrpE Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A0RPW8 2.12e-27 104 39 1 136 3 grpE Protein GrpE Campylobacter fetus subsp. fetus (strain 82-40)
B1Y785 2.13e-27 105 43 4 158 3 grpE Protein GrpE Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
B1MZG7 2.18e-27 105 39 1 133 3 grpE Protein GrpE Leuconostoc citreum (strain KM20)
P15874 2.65e-27 105 35 2 153 1 grpE Protein GrpE Bacillus subtilis (strain 168)
A9BNG4 3.68e-27 104 45 5 138 3 grpE Protein GrpE Delftia acidovorans (strain DSM 14801 / SPH-1)
A9IGC0 4.64e-27 104 40 5 154 3 grpE Protein GrpE Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q2G6M5 6.43e-27 103 40 2 154 3 grpE Protein GrpE Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q5WHG2 7.56e-27 103 39 1 136 3 grpE Protein GrpE Shouchella clausii (strain KSM-K16)
Q6F6N4 9.38e-27 103 47 4 148 3 grpE Protein GrpE Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q7VIE2 9.52e-27 103 38 2 136 3 grpE Protein GrpE Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A7ZEB6 1.21e-26 103 37 4 182 3 grpE Protein GrpE Campylobacter concisus (strain 13826)
A6QBG1 1.27e-26 103 40 3 141 3 grpE Protein GrpE Sulfurovum sp. (strain NBC37-1)
Q2NAJ5 1.93e-26 102 35 2 167 3 grpE Protein GrpE Erythrobacter litoralis (strain HTCC2594)
B3E7X0 2.49e-26 102 39 2 144 3 grpE Protein GrpE Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A9KG91 3.15e-26 102 37 3 164 3 grpE Protein GrpE Coxiella burnetii (strain Dugway 5J108-111)
B8FGS4 3.58e-26 102 37 4 189 3 grpE Protein GrpE Desulfatibacillum aliphaticivorans
B2URT9 4.36e-26 102 35 5 189 3 grpE Protein GrpE Helicobacter pylori (strain Shi470)
Q1AXX5 4.47e-26 102 35 3 191 3 grpE Protein GrpE Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q92SK0 4.67e-26 102 39 1 141 3 grpE Protein GrpE Rhizobium meliloti (strain 1021)
Q88VL9 5.14e-26 102 36 3 164 3 grpE Protein GrpE Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9ZFC7 5.55e-26 100 43 4 156 3 grpE Protein GrpE Methylovorus sp. (strain SS1 / DSM 11726)
Q8YEV0 6.1e-26 102 38 2 160 3 grpE Protein GrpE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8KML7 6.3e-26 101 34 3 155 3 grpE Protein GrpE Fructilactobacillus sanfranciscensis
B0CJ30 6.67e-26 102 38 2 160 3 grpE Protein GrpE Brucella suis (strain ATCC 23445 / NCTC 10510)
A6U5E2 6.72e-26 102 39 1 141 3 grpE Protein GrpE Sinorhizobium medicae (strain WSM419)
Q8G2Y6 6.88e-26 102 38 2 160 3 grpE Protein GrpE Brucella suis biovar 1 (strain 1330)
A9M7B6 6.88e-26 102 38 2 160 3 grpE Protein GrpE Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q8XIT0 7.8e-26 101 39 4 153 3 grpE Protein GrpE Clostridium perfringens (strain 13 / Type A)
A6WVA7 7.89e-26 102 37 2 158 3 grpE Protein GrpE Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q0TNS6 8.68e-26 101 39 4 153 3 grpE Protein GrpE Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SRE2 9.76e-26 101 38 4 153 3 grpE Protein GrpE Clostridium perfringens (strain SM101 / Type A)
Q182F1 1.13e-25 101 40 1 130 3 grpE Protein GrpE Clostridioides difficile (strain 630)
Q9LCQ6 1.18e-25 100 34 3 187 3 grpE Protein GrpE (Fragment) Brevibacillus choshinensis
Q74IT5 1.85e-25 100 39 2 146 3 grpE Protein GrpE Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q2KW99 1.97e-25 99 45 4 131 3 grpE Protein GrpE Bordetella avium (strain 197N)
A5VNA6 2.52e-25 100 38 2 160 3 grpE Protein GrpE Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q049W5 2.59e-25 100 37 2 145 3 grpE Protein GrpE Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
B9JZG5 3.2e-25 100 35 2 167 3 grpE Protein GrpE Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q1MPH5 4.1e-25 99 38 1 130 3 grpE Protein GrpE Lawsonia intracellularis (strain PHE/MN1-00)
Q74H60 4.27e-25 99 40 2 135 3 grpE Protein GrpE Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A8EWT7 4.41e-25 99 41 2 135 3 grpE Protein GrpE Aliarcobacter butzleri (strain RM4018)
A9GHU4 4.48e-25 99 38 1 136 3 grpE Protein GrpE Sorangium cellulosum (strain So ce56)
A7H485 4.85e-25 99 38 2 136 3 grpE Protein GrpE Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q044B0 5.4e-25 99 39 2 146 3 grpE Protein GrpE Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q2VYM5 5.61e-25 99 37 2 156 3 grpE Protein GrpE Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B3PZA4 5.75e-25 99 37 1 141 3 grpE Protein GrpE Rhizobium etli (strain CIAT 652)
Q2KD99 6.01e-25 99 37 1 141 3 grpE Protein GrpE Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P63188 6.69e-25 99 34 2 183 3 grpE Protein GrpE Rhizobium radiobacter
P63187 6.69e-25 99 34 2 183 3 grpE Protein GrpE Agrobacterium fabrum (strain C58 / ATCC 33970)
Q83C41 6.96e-25 99 37 3 164 3 grpE Protein GrpE Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9N8H5 6.96e-25 99 37 3 164 3 grpE Protein GrpE Coxiella burnetii (strain RSA 331 / Henzerling II)
Q98GQ5 7.43e-25 99 39 1 137 3 grpE Protein GrpE Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5HV34 8.9e-25 98 38 3 149 3 grpE Protein GrpE Campylobacter jejuni (strain RM1221)
Q49Y23 9.46e-25 98 32 3 185 3 grpE Protein GrpE Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q1CV45 9.59e-25 98 34 4 189 3 grpE Protein GrpE Helicobacter pylori (strain HPAG1)
Q84BU5 1.02e-24 98 36 2 146 3 grpE Protein GrpE Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q1MMC9 1.04e-24 99 36 1 141 3 grpE Protein GrpE Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B5Z9P1 1.6e-24 97 35 5 189 3 grpE Protein GrpE Helicobacter pylori (strain G27)
Q5F6X1 1.82e-24 97 40 9 199 3 grpE Protein GrpE Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9ZMW3 2.07e-24 97 36 5 189 3 grpE Protein GrpE Helicobacter pylori (strain J99 / ATCC 700824)
O69267 2.1e-24 97 37 2 150 3 grpE Protein GrpE Lysinibacillus sphaericus
Q17VY3 2.13e-24 97 36 2 156 3 grpE Protein GrpE Helicobacter acinonychis (strain Sheeba)
P55970 2.29e-24 97 37 2 156 3 grpE Protein GrpE Helicobacter pylori (strain ATCC 700392 / 26695)
A1KSH0 2.41e-24 97 41 10 200 3 grpE Protein GrpE Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q7DDM9 2.41e-24 97 41 10 200 3 grpE Protein GrpE Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JR00 2.41e-24 97 41 10 200 3 grpE Protein GrpE Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M2A3 2.41e-24 97 41 10 200 3 grpE Protein GrpE Neisseria meningitidis serogroup C (strain 053442)
B4RNG7 2.41e-24 97 41 10 200 3 grpE Protein GrpE Neisseria gonorrhoeae (strain NCCP11945)
B6JPL1 2.73e-24 97 37 2 156 3 grpE Protein GrpE Helicobacter pylori (strain P12)
Q5NRL4 2.93e-24 97 39 3 137 3 grpE Protein GrpE Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B2GBQ4 3.52e-24 97 32 3 196 3 grpE Protein GrpE Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B8IJD7 4.55e-24 97 35 3 188 3 grpE Protein GrpE Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
P63191 5.48e-24 97 35 1 146 3 grpE Protein GrpE Staphylococcus aureus
P99086 5.48e-24 97 35 1 146 1 grpE Protein GrpE Staphylococcus aureus (strain N315)
P63189 5.48e-24 97 35 1 146 3 grpE Protein GrpE Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ITA9 5.48e-24 97 35 1 146 3 grpE Protein GrpE Staphylococcus aureus (strain JH9)
A6U253 5.48e-24 97 35 1 146 3 grpE Protein GrpE Staphylococcus aureus (strain JH1)
A7X2Y2 5.48e-24 97 35 1 146 3 grpE Protein GrpE Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NWA9 5.53e-24 97 35 1 146 3 grpE Protein GrpE Staphylococcus aureus (strain MW2)
A8Z4C0 5.53e-24 97 35 1 146 3 grpE Protein GrpE Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8Y6 5.53e-24 97 35 1 146 3 grpE Protein GrpE Staphylococcus aureus (strain MSSA476)
Q6GGB9 5.53e-24 97 35 1 146 3 grpE Protein GrpE Staphylococcus aureus (strain MRSA252)
A6QHC4 5.53e-24 97 35 1 146 3 grpE Protein GrpE Staphylococcus aureus (strain Newman)
Q2FXZ1 5.53e-24 97 35 1 146 3 grpE Protein GrpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGE2 5.53e-24 97 35 1 146 3 grpE Protein GrpE Staphylococcus aureus (strain USA300)
Q21X08 5.95e-24 96 44 4 136 3 grpE Protein GrpE Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B0V5U3 6.43e-24 96 45 4 148 3 grpE Protein GrpE Acinetobacter baumannii (strain AYE)
A3M8W8 6.43e-24 96 45 4 148 3 grpE Protein GrpE Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HZZ8 6.43e-24 96 45 4 148 3 grpE Protein GrpE Acinetobacter baumannii (strain ACICU)
B7IBK6 6.43e-24 96 45 4 148 3 grpE Protein GrpE Acinetobacter baumannii (strain AB0057)
B7H316 6.43e-24 96 45 4 148 3 grpE Protein GrpE Acinetobacter baumannii (strain AB307-0294)
P57281 6.5e-24 96 31 1 191 3 grpE2 Protein GrpE 2 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5HFH9 6.56e-24 96 35 1 146 3 grpE Protein GrpE Staphylococcus aureus (strain COL)
Q11B39 6.58e-24 97 38 1 141 3 grpE Protein GrpE Chelativorans sp. (strain BNC1)
Q2YT46 6.7e-24 96 35 1 146 3 grpE Protein GrpE Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q1RIX7 7.93e-24 95 39 5 155 3 grpE Protein GrpE Rickettsia bellii (strain RML369-C)
A8GW24 7.93e-24 95 39 5 155 3 grpE Protein GrpE Rickettsia bellii (strain OSU 85-389)
O69297 7.93e-24 95 38 2 136 3 grpE Protein GrpE Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8MG50 9.42e-24 95 37 2 131 3 grpE Protein GrpE Alkaliphilus oremlandii (strain OhILAs)
A8FLH1 1.01e-23 95 38 2 136 3 grpE Protein GrpE Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q8RH07 1.41e-23 95 33 4 168 3 grpE Protein GrpE Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B3Q970 2.07e-23 95 36 1 141 3 grpE Protein GrpE Rhodopseudomonas palustris (strain TIE-1)
Q8K9R7 2.14e-23 95 37 2 150 3 grpE1 Protein GrpE 1 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q3IYI4 2.58e-23 94 37 3 152 3 grpE Protein GrpE Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P57340 2.81e-23 94 42 2 124 3 grpE1 Protein GrpE 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q6NCY6 4.99e-23 94 36 1 141 3 grpE Protein GrpE Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A6Q422 5.79e-23 93 38 3 154 3 grpE Protein GrpE Nitratiruptor sp. (strain SB155-2)
Q38W92 5.98e-23 94 32 4 183 3 grpE Protein GrpE Latilactobacillus sakei subsp. sakei (strain 23K)
B9DNK1 7.95e-23 93 34 1 146 3 grpE Protein GrpE Staphylococcus carnosus (strain TM300)
Q835R8 1.37e-22 92 39 5 165 3 grpE Protein GrpE Enterococcus faecalis (strain ATCC 700802 / V583)
Q75C01 1.66e-22 93 36 3 160 3 mge1 GrpE protein homolog, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q8RB69 1.69e-22 92 41 4 132 3 grpE Protein GrpE Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B2G6W2 1.76e-22 92 32 3 170 3 grpE Protein GrpE Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VJE6 1.76e-22 92 32 3 170 3 grpE Protein GrpE Limosilactobacillus reuteri (strain DSM 20016)
Q2J322 1.76e-22 92 36 1 141 3 grpE Protein GrpE Rhodopseudomonas palustris (strain HaA2)
B5ZMX0 2.35e-22 92 35 1 141 3 grpE Protein GrpE Rhizobium leguminosarum bv. trifolii (strain WSM2304)
A5V5Q2 2.72e-22 91 35 3 177 3 grpE Protein GrpE Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q72DW7 3.03e-22 92 38 3 136 3 grpE Protein GrpE Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A4YJR1 3.51e-22 92 37 1 140 3 grpE Protein GrpE Bradyrhizobium sp. (strain ORS 278)
Q93R28 4e-22 91 38 2 133 3 grpE Protein GrpE Tetragenococcus halophilus
B8DE37 4.26e-22 91 33 2 160 3 grpE Protein GrpE Listeria monocytogenes serotype 4a (strain HCC23)
Q71ZJ6 4.45e-22 91 33 2 160 3 grpE Protein GrpE Listeria monocytogenes serotype 4b (strain F2365)
C1KVC1 4.45e-22 91 33 2 160 3 grpE Protein GrpE Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8CXD2 4.49e-22 91 32 5 197 3 grpE Protein GrpE Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P0DJM3 4.64e-22 91 33 2 160 3 grpE Protein GrpE Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
G2K047 4.64e-22 91 33 2 160 3 grpE Protein GrpE Listeria monocytogenes serotype 1/2a (strain 10403S)
A0AIS5 6.18e-22 91 33 2 160 3 grpE Protein GrpE Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q4L6T1 6.86e-22 91 36 1 135 3 grpE Protein GrpE Staphylococcus haemolyticus (strain JCSC1435)
Q70WY9 9.29e-22 90 34 3 151 3 grpE Protein GrpE Fusobacterium nucleatum subsp. polymorphum
Q03FR8 1.1e-21 90 38 2 133 3 grpE Protein GrpE Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B6JCI1 1.25e-21 90 36 1 141 3 grpE Protein GrpE Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q13E58 1.78e-21 90 36 1 140 3 grpE Protein GrpE Rhodopseudomonas palustris (strain BisB5)
Q92BN7 2.05e-21 89 33 2 153 3 grpE Protein GrpE Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A9ILE9 2.33e-21 90 34 2 149 3 grpE Protein GrpE Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q5GSA3 3.63e-21 89 36 1 131 3 grpE Protein GrpE Wolbachia sp. subsp. Brugia malayi (strain TRS)
O87776 3.71e-21 89 32 5 183 3 grpE Protein GrpE Latilactobacillus sakei
Q30Q11 4.46e-21 88 35 2 146 3 grpE Protein GrpE Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q6G563 4.69e-21 89 33 2 149 3 grpE Protein GrpE Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A8GPC0 6.59e-21 88 36 5 160 3 grpE Protein GrpE Rickettsia akari (strain Hartford)
B3CPX8 6.98e-21 88 36 1 133 3 grpE Protein GrpE Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q6G1E4 7.62e-21 89 34 2 149 3 grpE Protein GrpE Bartonella quintana (strain Toulouse)
Q07US4 1.22e-20 88 35 1 140 3 grpE Protein GrpE Rhodopseudomonas palustris (strain BisA53)
Q0BX02 1.55e-20 87 35 4 157 3 grpE Protein GrpE Hyphomonas neptunium (strain ATCC 15444)
A1UUC9 1.62e-20 88 33 1 148 3 grpE Protein GrpE Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
O43047 1.66e-20 88 31 8 203 3 mge1 GrpE protein homolog, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P95333 2.21e-20 88 34 2 158 3 grpE Protein GrpE Myxococcus xanthus (strain DK1622)
Q9P5U4 2.23e-20 88 34 5 181 3 grpe GrpE protein homolog, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A4VT28 2.47e-20 86 40 4 132 3 grpE Protein GrpE Streptococcus suis (strain 05ZYH33)
A4VZB4 2.47e-20 86 40 4 132 3 grpE Protein GrpE Streptococcus suis (strain 98HAH33)
P30726 2.72e-20 87 35 2 135 3 grpE Protein GrpE Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q4UJN5 3.32e-20 86 37 5 159 3 grpE Protein GrpE Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B1YKS8 3.4e-20 86 31 2 148 3 grpE Protein GrpE Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q8KCD7 5.68e-20 86 34 2 168 3 grpE Protein GrpE Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q73GX9 6.1e-20 85 37 1 131 3 grpE Protein GrpE Wolbachia pipientis wMel
B3QTT2 7.18e-20 86 32 3 176 3 grpE Protein GrpE Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A7HZ43 8.2e-20 86 33 2 142 3 grpE Protein GrpE Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
O66745 9.04e-20 85 33 2 154 3 grpE Protein GrpE Aquifex aeolicus (strain VF5)
Q8CP16 9.62e-20 85 35 3 146 3 grpE Protein GrpE Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNW5 9.62e-20 85 35 3 146 3 grpE Protein GrpE Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q79V15 9.65e-20 85 37 1 139 3 grpE Protein GrpE Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q68WA8 9.79e-20 85 38 5 155 3 grpE Protein GrpE Rickettsia typhi (strain ATCC VR-144 / Wilmington)
C0R3M5 1.16e-19 85 36 1 131 3 grpE Protein GrpE Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q9ZCT4 1.59e-19 84 38 6 157 3 grpE Protein GrpE Rickettsia prowazekii (strain Madrid E)
Q04EE0 1.67e-19 85 37 2 136 3 grpE Protein GrpE Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
A8EY32 1.74e-19 84 36 5 155 3 grpE Protein GrpE Rickettsia canadensis (strain McKiel)
B2IDD9 1.78e-19 85 32 1 141 3 grpE Protein GrpE Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
P48604 1.84e-19 85 33 3 181 2 Roe1 GrpE protein homolog, mitochondrial Drosophila melanogaster
B2S0M1 1.88e-19 84 34 3 153 3 grpE Protein GrpE Borrelia hermsii (strain HS1 / DAH)
Q8LB47 2.26e-19 87 35 2 149 1 Mge2 GrpE protein homolog 2, mitochondrial Arabidopsis thaliana
Q3B0Y4 2.76e-19 85 33 4 185 3 grpE Protein GrpE Synechococcus sp. (strain CC9902)
B4S9D1 2.98e-19 84 29 5 197 3 grpE Protein GrpE Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q3SW78 3.81e-19 84 33 1 136 3 grpE Protein GrpE Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q3AF09 8.05e-19 83 35 1 133 3 grpE Protein GrpE Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B8GXP4 8.16e-19 83 36 3 139 3 grpE Protein GrpE Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAV1 8.16e-19 83 36 3 139 3 grpE Protein GrpE Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
C4K2U3 8.87e-19 82 37 4 140 3 grpE Protein GrpE Rickettsia peacockii (strain Rustic)
Q92GZ5 8.87e-19 82 37 4 140 3 grpE Protein GrpE Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PP76 8.87e-19 82 37 4 140 3 grpE Protein GrpE Rickettsia africae (strain ESF-5)
Q7V9C9 9.16e-19 84 30 3 183 3 grpE Protein GrpE Prochlorococcus marinus (strain MIT 9313)
B8ET77 1.04e-18 82 31 1 141 3 grpE Protein GrpE Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
A4SFR6 1.05e-18 82 36 5 199 3 grpE Protein GrpE Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A3CQC3 1.12e-18 82 37 3 132 3 grpE Protein GrpE Streptococcus sanguinis (strain SK36)
B9KCH1 1.22e-18 82 38 2 136 3 grpE Protein GrpE Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
P38523 2.21e-18 82 33 4 167 1 MGE1 GrpE protein homolog, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B4SG55 2.91e-18 82 32 5 203 3 grpE Protein GrpE Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q3YSZ3 3e-18 81 34 1 130 3 grpE Protein GrpE Ehrlichia canis (strain Jake)
C0QX60 3.19e-18 81 32 2 191 3 grpE Protein GrpE Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q9CGY9 3.55e-18 80 37 5 150 3 grpE Protein GrpE Lactococcus lactis subsp. lactis (strain IL1403)
Q7UA77 3.63e-18 82 32 4 163 3 grpE Protein GrpE Parasynechococcus marenigrum (strain WH8102)
Q6CRQ1 3.69e-18 82 32 2 164 3 mge1 GrpE protein homolog, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A2C5L7 3.7e-18 82 30 3 183 3 grpE Protein GrpE Prochlorococcus marinus (strain MIT 9303)
Q892Q9 4.06e-18 81 33 2 135 3 grpE Protein GrpE Clostridium tetani (strain Massachusetts / E88)
O06941 4.77e-18 80 37 4 148 3 grpE Protein GrpE Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B7J283 5.72e-18 80 34 3 152 3 grpE Protein GrpE Borreliella burgdorferi (strain ZS7)
P28609 5.72e-18 80 34 3 152 3 grpE Protein GrpE Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
B0T367 6.83e-18 80 35 3 139 3 grpE Protein GrpE Caulobacter sp. (strain K31)
P42369 7.42e-18 80 37 5 150 3 grpE Protein GrpE Lactococcus lactis subsp. cremoris (strain MG1363)
Q03MR7 1.01e-17 80 35 4 149 3 grpE Protein GrpE Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q8K9V9 1.9e-17 79 30 4 195 3 grpE2 Protein GrpE 2 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q6BTP9 1.94e-17 80 32 4 183 3 mge1 GrpE protein homolog, mitochondrial Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q6MB27 2.81e-17 79 32 0 136 3 grpE Protein GrpE Protochlamydia amoebophila (strain UWE25)
A8AVA7 3.15e-17 78 37 3 132 3 grpE Protein GrpE Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q6FPH2 4.13e-17 79 32 3 159 3 mge1 GrpE protein homolog, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q2JH51 4.34e-17 79 31 3 154 3 grpE Protein GrpE Synechococcus sp. (strain JA-2-3B'a(2-13))
Q7NDP1 5.51e-17 78 31 0 130 3 grpE Protein GrpE Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q3ANN0 5.71e-17 79 31 4 182 3 grpE Protein GrpE Synechococcus sp. (strain CC9605)
Q3B2T4 7.68e-17 77 32 5 197 3 grpE Protein GrpE Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q97S73 1.04e-16 77 36 3 131 1 grpE Protein GrpE Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q0SMY9 1.36e-16 77 33 3 152 3 grpE Protein GrpE Borreliella afzelii (strain PKo)
C1CQ17 1.54e-16 76 36 3 131 3 grpE Protein GrpE Streptococcus pneumoniae (strain Taiwan19F-14)
C1CJ05 1.54e-16 76 36 3 131 3 grpE Protein GrpE Streptococcus pneumoniae (strain P1031)
C1CCQ7 1.54e-16 76 36 3 131 3 grpE Protein GrpE Streptococcus pneumoniae (strain JJA)
B8ZLY8 1.54e-16 76 36 3 131 3 grpE Protein GrpE Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1IA51 1.54e-16 76 36 3 131 3 grpE Protein GrpE Streptococcus pneumoniae (strain Hungary19A-6)
C1C5N6 1.54e-16 76 36 3 131 3 grpE Protein GrpE Streptococcus pneumoniae (strain 70585)
B5E231 1.54e-16 76 36 3 131 3 grpE Protein GrpE Streptococcus pneumoniae serotype 19F (strain G54)
Q3SZC1 1.7e-16 77 35 2 151 1 GRPEL1 GrpE protein homolog 1, mitochondrial Bos taurus
P97576 2.15e-16 77 35 2 151 1 Grpel1 GrpE protein homolog 1, mitochondrial Rattus norvegicus
Q7VEJ7 2.46e-16 77 30 3 191 3 grpE Protein GrpE Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q8A8C4 2.92e-16 76 32 6 167 3 grpE Protein GrpE Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B2V8C9 3e-16 76 32 2 107 3 grpE Protein GrpE Sulfurihydrogenibium sp. (strain YO3AOP1)
Q9FLP3 3.88e-16 77 32 3 186 2 Mge1 GrpE protein homolog 1, mitochondrial Arabidopsis thaliana
Q8CWT4 3.93e-16 75 35 3 131 3 grpE Protein GrpE Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04LY1 3.93e-16 75 35 3 131 3 grpE Protein GrpE Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q6MGQ3 3.97e-16 75 30 1 153 3 grpE Protein GrpE Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q661A2 4.82e-16 75 33 3 152 3 grpE Protein GrpE Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q2JVR0 5.36e-16 76 29 4 174 3 grpE Protein GrpE Synechococcus sp. (strain JA-3-3Ab)
Q5RA81 5.78e-16 75 35 2 151 2 GRPEL1 GrpE protein homolog 1, mitochondrial Pongo abelii
Q9HAV7 5.78e-16 75 35 2 151 1 GRPEL1 GrpE protein homolog 1, mitochondrial Homo sapiens
Q64VI6 7.32e-16 75 31 4 140 3 grpE Protein GrpE Bacteroides fragilis (strain YCH46)
Q5LED3 7.32e-16 75 31 4 140 3 grpE Protein GrpE Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
B3EPC6 8.56e-16 75 34 5 179 3 grpE Protein GrpE Chlorobium phaeobacteroides (strain BS1)
Q99LP6 8.94e-16 75 35 2 151 1 Grpel1 GrpE protein homolog 1, mitochondrial Mus musculus
A6LRN3 9.14e-16 75 29 4 203 3 grpE Protein GrpE Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q8L2F3 9.2e-16 74 30 5 185 3 grpE Protein GrpE Meiothermus ruber
Q3K3T3 1.1e-15 74 37 3 131 3 grpE Protein GrpE Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
A5GHN3 1.17e-15 75 29 1 154 3 grpE Protein GrpE Synechococcus sp. (strain WH7803)
Q2NK66 1.27e-15 75 29 4 174 3 grpE Protein GrpE Aster yellows witches'-broom phytoplasma (strain AYWB)
Q8TQR3 1.61e-15 74 28 5 197 3 grpE Protein GrpE Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q7MU00 1.9e-15 74 29 2 158 2 grpE Protein GrpE Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q2GHU0 1.98e-15 74 35 3 131 3 grpE Protein GrpE Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q8E299 2.01e-15 73 37 3 131 3 grpE Protein GrpE Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7Q8 2.01e-15 73 37 3 131 3 grpE Protein GrpE Streptococcus agalactiae serotype III (strain NEM316)
A9B9L4 2.2e-15 75 32 6 178 3 grpE Protein GrpE Prochlorococcus marinus (strain MIT 9211)
P0DB49 2.28e-15 73 37 3 131 3 grpE Protein GrpE Streptococcus pyogenes serotype M3 (strain SSI-1)
P63193 2.28e-15 73 37 3 131 3 grpE Protein GrpE Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XAD5 2.28e-15 73 37 3 131 1 grpE Protein GrpE Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DB48 2.28e-15 73 37 3 131 3 grpE Protein GrpE Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P68892 2.28e-15 73 37 3 131 3 grpE Protein GrpE Streptococcus pyogenes serotype M1
Q89AS0 2.56e-15 73 28 1 158 3 grpE2 Protein GrpE 2 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q59984 3.02e-15 73 32 1 147 3 grpE Protein GrpE Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8YUA7 3.88e-15 74 29 4 161 3 grpE Protein GrpE Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B2RLI9 4.65e-15 73 30 3 159 3 grpE Protein GrpE Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q465Y5 7.1e-15 72 29 2 148 3 grpE Protein GrpE Methanosarcina barkeri (strain Fusaro / DSM 804)
Q05562 7.81e-15 73 30 4 197 3 grpE Protein GrpE Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q3MG83 9.96e-15 73 29 4 161 3 grpE Protein GrpE Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q7UM95 1.03e-14 72 32 2 152 3 grpE Protein GrpE Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q46I46 1.61e-14 72 28 5 184 3 grpE Protein GrpE Prochlorococcus marinus (strain NATL2A)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01915
Feature type CDS
Gene grpE
Product nucleotide exchange factor GrpE
Location 419690 - 420268 (strand: 1)
Length 579 (nucleotides) / 192 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_569
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01025 GrpE

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0576 Posttranslational modification, protein turnover, chaperones (O) O Molecular chaperone GrpE (heat shock protein HSP-70)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03687 molecular chaperone GrpE - -

Protein Sequence

MSSHEQKTHEEPVVEAADTLNAGQEQAAGAEIDHAAEAAGRIAELEHELEESRKTEREAMLRAKAEIENNRRRMELDIEKAHKFALERFSNELLPVIDNLERALEAVNPEDEAQKSMLEGLELTLKSFLDAVKKFGIDVVAETKVPFNPDVHQAISMVEAEGHEPNQIVNVLQKGYTLSGRLLRPAMVIVSK

Flanking regions ( +/- flanking 50bp)

TCCCCATAATAAACAAGAATCAGGATTATTGCGAAATACGCGGAGATTTTATGAGTAGTCACGAACAAAAAACACACGAAGAACCTGTTGTCGAAGCAGCAGACACCCTGAATGCCGGGCAGGAACAGGCAGCAGGCGCAGAAATTGACCACGCGGCAGAGGCGGCGGGTCGTATTGCGGAACTGGAGCATGAGCTGGAAGAGTCCCGTAAAACGGAACGTGAAGCAATGCTGCGGGCGAAGGCGGAGATTGAAAATAACCGTCGCCGTATGGAGCTGGACATTGAAAAAGCGCATAAATTTGCATTAGAGCGTTTTTCTAATGAACTGTTGCCGGTGATTGATAACCTGGAACGCGCGCTGGAAGCCGTCAATCCGGAAGATGAAGCGCAGAAAAGTATGCTCGAAGGTCTTGAGCTGACGCTGAAATCATTCCTGGATGCCGTGAAAAAATTCGGTATTGATGTGGTTGCCGAGACAAAAGTGCCGTTCAATCCGGATGTGCATCAGGCTATCAGCATGGTTGAGGCCGAAGGGCATGAGCCGAACCAGATAGTGAATGTGTTGCAGAAAGGCTACACCCTGAGCGGACGTCTGTTGCGTCCGGCGATGGTGATTGTGTCTAAATAAGCAGAGATTTTCTGCATACGCAACGCAATGCCGCCTTTATAGTATAGGGC