Homologs in group_1263

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07365 FBDBKF_07365 93.4 Morganella morganii S1 mgsA methylglyoxal synthase
EHELCC_03605 EHELCC_03605 93.4 Morganella morganii S2 mgsA methylglyoxal synthase
NLDBIP_03605 NLDBIP_03605 93.4 Morganella morganii S4 mgsA methylglyoxal synthase
LHKJJB_09435 LHKJJB_09435 93.4 Morganella morganii S3 mgsA methylglyoxal synthase
HKOGLL_09540 HKOGLL_09540 93.4 Morganella morganii S5 mgsA methylglyoxal synthase
PMI_RS03880 PMI_RS03880 70.4 Proteus mirabilis HI4320 - methylglyoxal synthase

Distribution of the homologs in the orthogroup group_1263

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1263

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A4W8X5 5.52e-80 236 74 0 150 3 mgsA Methylglyoxal synthase Enterobacter sp. (strain 638)
A7ME47 7.42e-80 235 74 0 150 3 mgsA Methylglyoxal synthase Cronobacter sakazakii (strain ATCC BAA-894)
B5XY41 9.24e-80 235 74 0 150 3 mgsA Methylglyoxal synthase Klebsiella pneumoniae (strain 342)
B5R6C9 8.1e-79 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella gallinarum (strain 287/91 / NCTC 13346)
P65350 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65351 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella typhi
B4TSI9 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella schwarzengrund (strain CVM19633)
B5BBK4 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella paratyphi A (strain AKU_12601)
C0Q8C9 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella paratyphi C (strain RKS4594)
A9N6W4 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PGC6 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T206 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella newport (strain SL254)
B4TE03 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella heidelberg (strain SL476)
B5QZG6 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella enteritidis PT4 (strain P125109)
B5FR06 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella dublin (strain CT_02021853)
Q57QS7 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella choleraesuis (strain SC-B67)
A9MHS6 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F1W0 1.06e-78 233 73 0 150 3 mgsA Methylglyoxal synthase Salmonella agona (strain SL483)
B7LNX3 1.56e-78 232 73 0 150 3 mgsA Methylglyoxal synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A8AIB5 7.09e-78 230 72 0 150 3 mgsA Methylglyoxal synthase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LE63 1.48e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli (strain 55989 / EAEC)
Q8FJ74 2.1e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MS74 2.1e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli O81 (strain ED1a)
B7MIB7 2.1e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UN42 2.1e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P0A733 2.42e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Shigella flexneri
B2TTT1 2.42e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LJ35 2.42e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli (strain SMS-3-5 / SECEC)
B6I938 2.42e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli (strain SE11)
P0A731 2.42e-77 229 72 0 150 1 mgsA Methylglyoxal synthase Escherichia coli (strain K12)
B1IVW9 2.42e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZYR5 2.42e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli O9:H4 (strain HS)
B1X8R7 2.42e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli (strain K12 / DH10B)
C4ZQ89 2.42e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M892 2.42e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli O8 (strain IAI1)
B7NLF4 2.42e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YT93 2.42e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A732 2.42e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli O157:H7
A7ZK67 2.42e-77 229 72 0 150 3 mgsA Methylglyoxal synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7N3C6 1.84e-76 227 71 0 150 3 mgsA Methylglyoxal synthase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B4EVE1 1.41e-75 224 71 0 150 3 mgsA Methylglyoxal synthase Proteus mirabilis (strain HI4320)
B2VDH0 8.72e-75 223 69 0 150 3 mgsA Methylglyoxal synthase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C5BDP0 1.76e-74 222 70 0 150 3 mgsA Methylglyoxal synthase Edwardsiella ictaluri (strain 93-146)
A8GCM4 5.32e-74 221 69 0 150 3 mgsA Methylglyoxal synthase Serratia proteamaculans (strain 568)
B6EI79 1.35e-73 219 67 0 150 3 mgsA Methylglyoxal synthase Aliivibrio salmonicida (strain LFI1238)
Q7MEP0 3.35e-73 219 67 0 150 3 mgsA Methylglyoxal synthase Vibrio vulnificus (strain YJ016)
Q8D7M9 3.35e-73 219 67 0 150 3 mgsA Methylglyoxal synthase Vibrio vulnificus (strain CMCP6)
B7VS36 6.26e-73 218 66 0 150 3 mgsA Methylglyoxal synthase Vibrio atlanticus (strain LGP32)
Q0I4N3 8.79e-73 218 67 0 150 3 mgsA Methylglyoxal synthase Histophilus somni (strain 129Pt)
Q6D6C8 1.03e-72 217 69 0 150 3 mgsA Methylglyoxal synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DKX3 1.16e-72 217 68 0 150 3 mgsA Methylglyoxal synthase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q5E4D0 1.42e-72 217 66 0 150 3 mgsA Methylglyoxal synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87ID3 1.91e-72 217 66 0 150 3 mgsA Methylglyoxal synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2NU68 2.05e-72 217 69 0 150 3 mgsA Methylglyoxal synthase Sodalis glossinidius (strain morsitans)
A7N2T8 2.81e-72 216 66 0 150 3 mgsA Methylglyoxal synthase Vibrio campbellii (strain ATCC BAA-1116)
B0UW70 4.7e-72 216 66 0 150 3 mgsA Methylglyoxal synthase Histophilus somni (strain 2336)
B5FF54 4.97e-72 216 66 0 150 3 mgsA Methylglyoxal synthase Aliivibrio fischeri (strain MJ11)
A5UBP8 8.12e-71 213 64 0 150 3 mgsA Methylglyoxal synthase Haemophilus influenzae (strain PittEE)
Q4QJW2 8.12e-71 213 64 0 150 3 mgsA Methylglyoxal synthase Haemophilus influenzae (strain 86-028NP)
A1JMV3 1.99e-70 211 65 0 150 3 mgsA Methylglyoxal synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A5UF70 2.18e-70 211 64 0 150 3 mgsA Methylglyoxal synthase Haemophilus influenzae (strain PittGG)
C3LVX6 5.59e-70 210 64 0 150 3 mgsA Methylglyoxal synthase Vibrio cholerae serotype O1 (strain M66-2)
Q9KLN2 5.59e-70 210 64 0 150 3 mgsA Methylglyoxal synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5EZV8 5.59e-70 210 64 0 150 3 mgsA Methylglyoxal synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7N5Z7 6.23e-70 210 68 0 150 3 mgsA Methylglyoxal synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1JQQ0 7.35e-70 210 65 0 150 3 mgsA Methylglyoxal synthase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66CE4 7.35e-70 210 65 0 150 3 mgsA Methylglyoxal synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TKV8 7.35e-70 210 65 0 150 3 mgsA Methylglyoxal synthase Yersinia pestis (strain Pestoides F)
Q1CGL4 7.35e-70 210 65 0 150 3 mgsA Methylglyoxal synthase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2N5 7.35e-70 210 65 0 150 3 mgsA Methylglyoxal synthase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZG71 7.35e-70 210 65 0 150 3 mgsA Methylglyoxal synthase Yersinia pestis
B2JYU0 7.35e-70 210 65 0 150 3 mgsA Methylglyoxal synthase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CA21 7.35e-70 210 65 0 150 3 mgsA Methylglyoxal synthase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FJS2 7.35e-70 210 65 0 150 3 mgsA Methylglyoxal synthase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P45120 2.48e-69 209 62 0 150 3 mgsA Methylglyoxal synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CNN3 4.01e-69 208 64 0 150 3 mgsA Methylglyoxal synthase Pasteurella multocida (strain Pm70)
Q6LST5 3.11e-68 206 63 0 150 3 mgsA Methylglyoxal synthase Photobacterium profundum (strain SS9)
Q65UB4 1.18e-67 204 61 0 150 3 mgsA Methylglyoxal synthase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A1SR75 2.16e-67 204 63 0 152 3 mgsA Methylglyoxal synthase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A4SIB9 1.83e-66 201 62 0 152 3 mgsA Methylglyoxal synthase Aeromonas salmonicida (strain A449)
B3PFP8 7.84e-65 197 59 0 152 3 mgsA Methylglyoxal synthase Cellvibrio japonicus (strain Ueda107)
B0BR90 1.15e-64 197 58 0 150 3 mgsA Methylglyoxal synthase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2I5 1.15e-64 197 58 0 150 3 mgsA Methylglyoxal synthase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2E6 1.15e-64 197 58 0 150 3 mgsA Methylglyoxal synthase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q21L65 2.8e-59 183 55 0 152 3 mgsA Methylglyoxal synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q3IES7 2.24e-56 176 56 0 150 3 mgsA Methylglyoxal synthase Pseudoalteromonas translucida (strain TAC 125)
C5BMN7 2.68e-56 176 54 0 150 3 mgsA Methylglyoxal synthase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q053R1 7.61e-54 169 59 0 132 3 mgsA Methylglyoxal synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04UA7 7.61e-54 169 59 0 132 3 mgsA Methylglyoxal synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q9X0R7 2.13e-53 169 57 0 143 1 mgsA Methylglyoxal synthase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q83D86 6.31e-53 167 56 0 135 3 mgsA Methylglyoxal synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KFK7 6.31e-53 167 56 0 135 3 mgsA Methylglyoxal synthase Coxiella burnetii (strain Dugway 5J108-111)
A9ND61 2.92e-52 165 55 0 135 3 mgsA Methylglyoxal synthase Coxiella burnetii (strain RSA 331 / Henzerling II)
Q8F7N5 3.46e-52 165 57 0 132 3 mgsA Methylglyoxal synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NU6 3.46e-52 165 57 0 132 3 mgsA Methylglyoxal synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q15X77 2.7e-50 160 57 1 134 3 mgsA Methylglyoxal synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q2SK75 3.65e-50 160 53 1 136 3 mgsA Methylglyoxal synthase Hahella chejuensis (strain KCTC 2396)
C6BZQ4 7.35e-47 152 50 2 156 3 mgsA Methylglyoxal synthase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q97IN6 1.15e-46 151 54 0 136 3 mgsA Methylglyoxal synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q30ZX0 3.39e-45 147 52 1 143 3 mgsA Methylglyoxal synthase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B2TK64 1.87e-44 145 59 0 115 3 mgsA Methylglyoxal synthase Clostridium botulinum (strain Eklund 17B / Type B)
B2V099 1.34e-43 142 58 0 117 3 mgsA Methylglyoxal synthase Clostridium botulinum (strain Alaska E43 / Type E3)
Q67NW2 2.41e-41 137 56 0 111 3 mgsA Methylglyoxal synthase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q81FP3 5.47e-41 136 54 0 117 3 mgsA Methylglyoxal synthase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B9IVQ6 9.65e-41 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus cereus (strain Q1)
B7HL47 9.65e-41 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus cereus (strain AH187)
B7HHT7 9.65e-41 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus cereus (strain B4264)
B7IPB1 9.65e-41 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus cereus (strain G9842)
Q73AW0 9.65e-41 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus cereus (strain ATCC 10987 / NRS 248)
A9VME4 1.19e-40 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus mycoides (strain KBAB4)
Q81ST9 1.24e-40 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus anthracis
C3L8Q6 1.24e-40 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P5Q3 1.24e-40 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus anthracis (strain A0248)
A7GN71 1.49e-40 135 52 0 117 3 mgsA Methylglyoxal synthase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q6HL22 1.65e-40 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63DJ9 1.65e-40 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus cereus (strain ZK / E33L)
C1EN30 1.65e-40 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus cereus (strain 03BB102)
B7JH18 1.65e-40 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus cereus (strain AH820)
A0RBY7 1.65e-40 135 53 0 117 3 mgsA Methylglyoxal synthase Bacillus thuringiensis (strain Al Hakam)
A0PZH3 2.63e-40 134 53 0 117 3 mgsA Methylglyoxal synthase Clostridium novyi (strain NT)
A6LPD6 2.93e-40 134 55 0 115 3 mgsA Methylglyoxal synthase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
C5D3B8 4.96e-40 134 53 0 115 3 mgsA Methylglyoxal synthase Geobacillus sp. (strain WCH70)
Q3AEV6 6.69e-40 133 53 0 117 3 mgsA Methylglyoxal synthase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q65I51 1.55e-39 133 54 0 117 3 mgsA Methylglyoxal synthase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B1HTF1 6.13e-39 131 54 0 115 3 mgsA Methylglyoxal synthase Lysinibacillus sphaericus (strain C3-41)
Q8EQD4 9.95e-39 131 52 0 117 3 mgsA Methylglyoxal synthase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P42980 2.89e-38 129 52 0 119 1 mgsA Methylglyoxal synthase Bacillus subtilis (strain 168)
Q5WGQ3 4.26e-38 129 53 0 115 3 mgsA Methylglyoxal synthase Shouchella clausii (strain KSM-K16)
C4L0B0 4.99e-38 129 52 0 117 3 mgsA Methylglyoxal synthase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q5KXW7 1.14e-37 128 50 0 117 3 mgsA Methylglyoxal synthase Geobacillus kaustophilus (strain HTA426)
A7Z5Z9 1.65e-37 127 51 0 119 3 mgsA Methylglyoxal synthase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A4IQ66 1.73e-37 128 50 0 117 3 mgsA Methylglyoxal synthase Geobacillus thermodenitrificans (strain NG80-2)
Q661Q5 2.37e-37 127 53 0 117 3 mgsA Methylglyoxal synthase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q837A4 3.15e-37 127 51 0 115 3 mgsA Methylglyoxal synthase Enterococcus faecalis (strain ATCC 700802 / V583)
A4XKM4 3.62e-37 127 53 0 118 3 mgsA Methylglyoxal synthase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B9MRV5 3.62e-37 127 53 0 118 3 mgsA Methylglyoxal synthase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B7J1T7 4.92e-37 126 53 0 117 3 mgsA Methylglyoxal synthase Borreliella burgdorferi (strain ZS7)
O51339 4.92e-37 126 53 0 117 1 mgsA Methylglyoxal synthase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
A8FEI2 7.57e-37 126 50 0 117 3 mgsA Methylglyoxal synthase Bacillus pumilus (strain SAFR-032)
Q0SNF0 2.39e-36 124 52 0 117 3 mgsA Methylglyoxal synthase Borreliella afzelii (strain PKo)
Q38WH3 2.39e-36 125 50 0 119 3 mgsA Methylglyoxal synthase Latilactobacillus sakei subsp. sakei (strain 23K)
Q0SU08 3.66e-36 124 50 0 115 3 mgsA Methylglyoxal synthase Clostridium perfringens (strain SM101 / Type A)
Q8XLN2 3.66e-36 124 50 0 115 3 mgsA Methylglyoxal synthase Clostridium perfringens (strain 13 / Type A)
Q92AA2 4.96e-36 124 52 0 116 3 mgsA Methylglyoxal synthase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B2A7A5 5.4e-36 123 50 0 117 3 mgsA Methylglyoxal synthase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q9XCV1 5.47e-36 124 49 0 119 3 mgsA Methylglyoxal synthase Thermoanaerobacterium thermosaccharolyticum
Q8UIV6 5.77e-36 123 50 1 121 3 mgsA Methylglyoxal synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
A9NF94 6.39e-36 123 50 0 115 3 mgsA Methylglyoxal synthase Acholeplasma laidlawii (strain PG-8A)
Q8Y5Z7 7.26e-36 123 52 0 116 3 mgsA Methylglyoxal synthase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DC20 7.26e-36 123 52 0 116 3 mgsA Methylglyoxal synthase Listeria monocytogenes serotype 4a (strain HCC23)
Q71YA9 7.26e-36 123 52 0 116 3 mgsA Methylglyoxal synthase Listeria monocytogenes serotype 4b (strain F2365)
C1KWK6 7.26e-36 123 52 0 116 3 mgsA Methylglyoxal synthase Listeria monocytogenes serotype 4b (strain CLIP80459)
A0AK11 8.64e-36 123 53 0 114 3 mgsA Methylglyoxal synthase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A6TQI6 8.93e-36 123 51 0 117 3 mgsA Methylglyoxal synthase Alkaliphilus metalliredigens (strain QYMF)
Q8XXD0 9.2e-36 123 47 0 120 3 mgsA Methylglyoxal synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0TRM9 3.04e-35 121 48 0 115 3 mgsA Methylglyoxal synthase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A6WYJ6 5.55e-35 121 49 1 125 3 mgsA Methylglyoxal synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
C0ZCG5 5.78e-35 121 47 0 122 3 mgsA Methylglyoxal synthase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A9WW58 6.12e-35 120 48 1 125 3 mgsA Methylglyoxal synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
P0A3Q3 6.46e-35 120 48 1 125 3 mgsA Methylglyoxal synthase Brucella suis biovar 1 (strain 1330)
A5VVV1 6.46e-35 120 48 1 125 3 mgsA Methylglyoxal synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P0A3Q2 6.46e-35 120 48 1 125 3 mgsA Methylglyoxal synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RMI7 6.46e-35 120 48 1 125 3 mgsA Methylglyoxal synthase Brucella melitensis biotype 2 (strain ATCC 23457)
A9MCX4 6.46e-35 120 48 1 125 3 mgsA Methylglyoxal synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
P0CB36 6.46e-35 120 48 1 125 3 mgsA Methylglyoxal synthase Brucella abortus biovar 1 (strain 9-941)
Q2YJP0 6.46e-35 120 48 1 125 3 mgsA Methylglyoxal synthase Brucella abortus (strain 2308)
B2SC33 6.46e-35 120 48 1 125 3 mgsA Methylglyoxal synthase Brucella abortus (strain S19)
Q2RJ00 8.41e-35 120 47 0 111 3 mgsA Methylglyoxal synthase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q9KC92 1.5e-34 120 48 0 115 3 mgsA Methylglyoxal synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B0K427 1.67e-34 120 49 0 115 3 mgsA Methylglyoxal synthase Thermoanaerobacter sp. (strain X514)
B0KAD1 1.67e-34 120 49 0 115 3 mgsA Methylglyoxal synthase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B1YKL9 4.65e-34 119 47 0 117 3 mgsA Methylglyoxal synthase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B3R3G1 5.94e-34 119 46 0 115 3 mgsA Methylglyoxal synthase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
C3MBY3 6.64e-34 118 50 1 121 3 mgsA Methylglyoxal synthase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8RBB6 6.86e-34 118 49 0 115 3 mgsA Methylglyoxal synthase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q46YB8 1.05e-33 118 47 0 115 3 mgsA Methylglyoxal synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q92T28 1.29e-33 117 50 1 121 3 mgsA Methylglyoxal synthase Rhizobium meliloti (strain 1021)
A9AJK3 1.99e-33 117 47 0 115 3 mgsA Methylglyoxal synthase Burkholderia multivorans (strain ATCC 17616 / 249)
Q1LQ98 7.16e-33 116 46 0 115 3 mgsA Methylglyoxal synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B9J6R7 8.31e-33 115 50 1 119 3 mgsA Methylglyoxal synthase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q2SZS7 1.34e-32 115 46 0 115 3 mgsA Methylglyoxal synthase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P58761 2.27e-32 115 43 1 131 3 mgsA Methylglyoxal synthase Treponema socranskii
Q5SHD6 2.82e-32 114 46 0 116 1 mgsA Methylglyoxal synthase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72HP3 2.82e-32 114 46 0 116 3 mgsA Methylglyoxal synthase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q39EA4 3.23e-32 114 46 0 115 3 mgsA Methylglyoxal synthase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q18B16 5.98e-32 114 44 0 119 3 mgsA Methylglyoxal synthase Clostridioides difficile (strain 630)
B9JYQ6 7.1e-32 113 46 1 121 3 mgsA Methylglyoxal synthase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A4JGH2 8.8e-32 113 46 0 115 3 mgsA Methylglyoxal synthase Burkholderia vietnamiensis (strain G4 / LMG 22486)
B1JW38 1.3e-31 112 45 0 115 3 mgsA Methylglyoxal synthase Burkholderia orbicola (strain MC0-3)
B4E5R3 1.3e-31 112 45 0 115 3 mgsA Methylglyoxal synthase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0K965 1.3e-31 112 45 0 115 3 mgsA Methylglyoxal synthase Burkholderia cenocepacia (strain HI2424)
Q63VS6 1.47e-31 112 46 0 115 3 mgsA Methylglyoxal synthase Burkholderia pseudomallei (strain K96243)
A3N7G3 1.47e-31 112 46 0 115 3 mgsA Methylglyoxal synthase Burkholderia pseudomallei (strain 668)
Q3JUF3 1.47e-31 112 46 0 115 3 mgsA Methylglyoxal synthase Burkholderia pseudomallei (strain 1710b)
A3NT52 1.47e-31 112 46 0 115 3 mgsA Methylglyoxal synthase Burkholderia pseudomallei (strain 1106a)
A1V2G6 1.47e-31 112 46 0 115 3 mgsA Methylglyoxal synthase Burkholderia mallei (strain SAVP1)
Q62IJ3 1.47e-31 112 46 0 115 3 mgsA Methylglyoxal synthase Burkholderia mallei (strain ATCC 23344)
A2S4A9 1.47e-31 112 46 0 115 3 mgsA Methylglyoxal synthase Burkholderia mallei (strain NCTC 10229)
A3MI51 1.47e-31 112 46 0 115 3 mgsA Methylglyoxal synthase Burkholderia mallei (strain NCTC 10247)
Q1BUX2 2.17e-31 112 45 0 115 3 mgsA Methylglyoxal synthase Burkholderia orbicola (strain AU 1054)
Q0BD88 4.31e-31 111 45 0 115 3 mgsA Methylglyoxal synthase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YU46 4.31e-31 111 45 0 115 3 mgsA Methylglyoxal synthase Burkholderia ambifaria (strain MC40-6)
Q2KDT8 3.61e-30 108 47 1 117 3 mgsA Methylglyoxal synthase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3PXK7 7.4e-30 108 48 1 113 3 mgsA Methylglyoxal synthase Rhizobium etli (strain CIAT 652)
Q55452 5.56e-29 112 44 0 114 3 sll0036 Uncharacterized protein sll0036 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01550
Feature type CDS
Gene -
Product methylglyoxal synthase
Location 347876 - 348334 (strand: -1)
Length 459 (nucleotides) / 152 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1263
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02142 MGS-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1803 Carbohydrate transport and metabolism (G) G Methylglyoxal synthase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01734 methylglyoxal synthase [EC:4.2.3.3] Propanoate metabolism
Metabolic pathways
Microbial metabolism in diverse environments		 -

Protein Sequence

MESTTRVLTKHKKIALVAHDHYKTKLLDWVKRNLAALQEHQLFATGTTGLLISRETGLEITGMLSGPMGGDQQIGAMIAEAKIDVLIFFWDPLNAVPHDPDVKALLRLATVWNIPVATNMSTADFIIHSPDFDKDVDIVIPDYARYLSERAQ

Flanking regions ( +/- flanking 50bp)

GTTATTGAATAATATTTTATTCGTCTTATTCGCCGCAAAAAGAGAGCGTTATGGAATCCACAACCCGTGTACTGACCAAGCATAAAAAAATTGCCCTTGTGGCGCATGACCATTACAAAACCAAATTACTGGACTGGGTTAAACGCAATCTGGCAGCATTACAGGAACATCAGCTCTTTGCCACCGGCACCACCGGGCTGCTTATCAGCCGGGAAACAGGGTTGGAGATTACCGGCATGCTGAGCGGGCCGATGGGTGGCGATCAGCAAATTGGCGCAATGATTGCGGAAGCAAAAATTGATGTGCTCATTTTTTTCTGGGATCCGCTCAATGCCGTACCGCATGATCCGGATGTCAAAGCACTGTTGCGCCTGGCGACCGTCTGGAATATCCCGGTCGCCACAAATATGTCCACCGCTGATTTTATTATTCATTCCCCGGATTTTGACAAAGATGTGGATATTGTCATCCCGGATTACGCCCGCTATTTAAGTGAGCGCGCACAATAAGATAATCAGGGCTTTTTCACCCGGCTGACGCCCATGTCAGCCAGCTCGGC