Homologs in group_1253

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07295 FBDBKF_07295 93.2 Morganella morganii S1 rlmL bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL
EHELCC_03675 EHELCC_03675 93.2 Morganella morganii S2 rlmL bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL
NLDBIP_03675 NLDBIP_03675 93.2 Morganella morganii S4 rlmL bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL
LHKJJB_09505 LHKJJB_09505 93.2 Morganella morganii S3 rlmL bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL
HKOGLL_09470 HKOGLL_09470 93.2 Morganella morganii S5 rlmL bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL
PMI_RS03805 PMI_RS03805 76.4 Proteus mirabilis HI4320 rlmKL bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL

Distribution of the homologs in the orthogroup group_1253

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1253

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N612 0.0 1177 79 0 704 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B2JYS1 0.0 1132 76 1 705 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q66CG1 0.0 1132 76 1 705 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FJT9 0.0 1132 76 1 705 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JQR7 0.0 1130 76 1 705 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q1CGJ3 0.0 1130 76 1 705 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7L5 0.0 1130 76 1 705 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Yersinia pestis bv. Antiqua (strain Angola)
Q7CHK7 0.0 1130 76 1 705 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Yersinia pestis
Q1CA41 0.0 1130 76 1 705 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Yersinia pestis bv. Antiqua (strain Antiqua)
A4TMZ0 0.0 1127 76 1 705 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Yersinia pestis (strain Pestoides F)
B4EVC6 0.0 1120 76 0 704 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Proteus mirabilis (strain HI4320)
Q6D459 0.0 1118 75 0 704 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JMQ6 0.0 1115 75 2 706 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GCK7 0.0 1109 75 1 704 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Serratia proteamaculans (strain 568)
B2VDF6 0.0 1085 74 2 707 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A7MEX5 0.0 1063 73 1 701 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Cronobacter sakazakii (strain ATCC BAA-894)
A8AID1 0.0 1053 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B4TRX1 0.0 1050 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella schwarzengrund (strain CVM19633)
Q57QU1 0.0 1050 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella choleraesuis (strain SC-B67)
Q8ZQ73 0.0 1049 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BBL9 0.0 1049 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella paratyphi A (strain AKU_12601)
Q5PGE3 0.0 1049 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T1Z1 0.0 1049 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella newport (strain SL254)
B4TDY8 0.0 1049 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella heidelberg (strain SL476)
B5QZF1 0.0 1049 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella enteritidis PT4 (strain P125109)
B5FQZ1 0.0 1049 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella dublin (strain CT_02021853)
B5F1U5 0.0 1049 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella agona (strain SL483)
B5R6B4 0.0 1048 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9N6Y0 0.0 1047 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A9MHU0 0.0 1046 70 1 699 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8Z7S6 0.0 1045 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Salmonella typhi
Q0TJB3 0.0 1042 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1LJR4 0.0 1042 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Escherichia coli (strain SMS-3-5 / SECEC)
Q1RDR6 0.0 1041 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Escherichia coli (strain UTI89 / UPEC)
A1A9L8 0.0 1041 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Escherichia coli O1:K1 / APEC
Q32HV8 0.0 1041 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shigella dysenteriae serotype 1 (strain Sd197)
P75864 0.0 1040 71 1 702 1 rlmL Ribosomal RNA large subunit methyltransferase K/L Escherichia coli (strain K12)
B1IVY4 0.0 1040 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZYQ0 0.0 1040 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Escherichia coli O9:H4 (strain HS)
B1X8Q2 0.0 1040 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Escherichia coli (strain K12 / DH10B)
Q3Z3H3 0.0 1040 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shigella sonnei (strain Ss046)
Q8FJ88 0.0 1039 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B5YT79 0.0 1039 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XDB2 0.0 1039 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Escherichia coli O157:H7
Q83RX5 0.0 1038 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shigella flexneri
Q0T686 0.0 1038 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shigella flexneri serotype 5b (strain 8401)
Q31YL1 0.0 1038 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shigella boydii serotype 4 (strain Sb227)
A7ZK52 0.0 1038 71 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Escherichia coli O139:H28 (strain E24377A / ETEC)
B2TUD1 0.0 1037 70 1 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A4W8W0 0.0 1033 71 1 699 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Enterobacter sp. (strain 638)
B5XY56 0.0 1032 71 0 701 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Klebsiella pneumoniae (strain 342)
A6T742 0.0 1031 71 0 701 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q2NU80 0.0 995 69 1 707 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Sodalis glossinidius (strain morsitans)
Q4QP66 0.0 909 61 3 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Haemophilus influenzae (strain 86-028NP)
Q9CNW9 0.0 907 61 3 715 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pasteurella multocida (strain Pm70)
A5UFS2 0.0 904 60 3 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Haemophilus influenzae (strain PittGG)
A5UB28 0.0 902 60 3 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Haemophilus influenzae (strain PittEE)
P44524 0.0 902 60 3 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B0BRL8 0.0 893 61 3 708 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZQ0 0.0 893 61 3 708 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0UUM5 0.0 892 60 4 717 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Histophilus somni (strain 2336)
A3MYD2 0.0 892 61 3 708 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q0I4C6 0.0 890 60 4 717 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Histophilus somni (strain 129Pt)
Q7VP04 0.0 883 60 3 708 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q65UK6 0.0 879 61 4 713 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5E5B4 0.0 859 57 3 704 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Aliivibrio fischeri (strain ATCC 700601 / ES114)
A0KKK7 0.0 857 57 3 714 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B5FE19 0.0 855 57 3 704 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Aliivibrio fischeri (strain MJ11)
A4SME4 0.0 855 57 3 714 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Aeromonas salmonicida (strain A449)
A6VMR3 0.0 853 58 3 714 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B6ELD3 0.0 841 56 3 704 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Aliivibrio salmonicida (strain LFI1238)
Q9KRZ5 0.0 833 57 3 707 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F836 0.0 833 57 3 707 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A7N0M8 0.0 823 57 3 707 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Vibrio campbellii (strain ATCC BAA-1116)
Q7MKX1 0.0 816 56 2 706 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Vibrio vulnificus (strain YJ016)
Q87PC0 0.0 811 56 3 707 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6LRA0 0.0 789 54 4 711 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Photobacterium profundum (strain SS9)
A1SX09 0.0 762 50 6 747 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A1S601 0.0 727 51 4 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A4Y5X4 0.0 707 48 5 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1RKM2 0.0 707 48 5 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella sp. (strain W3-18-1)
Q8EFW4 0.0 701 49 5 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q12LC6 0.0 698 47 5 713 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8K9I4 0.0 696 45 3 701 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q0HJZ9 0.0 692 48 6 716 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella sp. (strain MR-4)
A9L591 0.0 692 47 5 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella baltica (strain OS195)
A0KVL6 0.0 692 48 6 716 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella sp. (strain ANA-3)
Q0HWA0 0.0 692 48 6 716 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella sp. (strain MR-7)
A3QDY0 0.0 687 47 4 714 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q07ZR3 0.0 687 47 6 713 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella frigidimarina (strain NCIMB 400)
A3D5Q0 0.0 681 47 5 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella baltica (strain OS155 / ATCC BAA-1091)
A6WPK6 0.0 681 47 5 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella baltica (strain OS185)
Q47Z09 0.0 680 47 3 709 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
P57444 0.0 680 47 3 702 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A8H3Y1 0.0 679 46 4 714 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A8FW59 0.0 673 46 5 714 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella sediminis (strain HAW-EB3)
Q15UB5 0.0 673 48 6 703 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B0TIX7 0.0 671 46 4 714 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella halifaxensis (strain HAW-EB4)
B1KDN0 0.0 659 45 5 714 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Shewanella woodyi (strain ATCC 51908 / MS32)
Q3A2U5 0.0 659 47 6 708 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B4RZ48 0.0 648 46 8 705 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A6VW36 0.0 634 44 8 707 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Marinomonas sp. (strain MWYL1)
Q1W3E0 0.0 622 45 7 718 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
A6V328 0.0 620 45 4 718 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudomonas aeruginosa (strain PA7)
Q60AX5 0.0 619 45 8 731 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q9HZG0 0.0 619 45 5 718 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B0KG92 0.0 614 45 5 723 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudomonas putida (strain GB-1)
Q88L39 0.0 613 45 6 721 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W6K7 0.0 612 45 6 721 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A4VM39 0.0 611 45 4 714 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Stutzerimonas stutzeri (strain A1501)
B1J5B7 0.0 611 45 5 721 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudomonas putida (strain W619)
B3PIL6 0.0 609 44 9 756 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Cellvibrio japonicus (strain Ueda107)
A4XWP8 0.0 609 45 5 714 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudomonas mendocina (strain ymp)
Q1ICL2 0.0 609 45 5 724 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudomonas entomophila (strain L48)
Q5QX63 0.0 605 43 5 708 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A5EX48 0.0 603 45 8 714 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Dichelobacter nodosus (strain VCS1703A)
Q6AQA5 0.0 601 43 6 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q3IGZ3 0.0 597 44 7 709 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudoalteromonas translucida (strain TAC 125)
Q3KFC5 0.0 593 43 5 749 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudomonas fluorescens (strain Pf0-1)
Q4ZUM1 0.0 591 43 5 742 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudomonas syringae pv. syringae (strain B728a)
Q4KFI6 0.0 590 43 5 749 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1QXV9 0.0 590 45 5 724 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q5X0J6 0.0 587 43 6 706 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Legionella pneumophila (strain Lens)
Q48JX8 0.0 587 43 5 742 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5ZZI8 0.0 585 42 6 706 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5I9H3 0.0 584 42 6 706 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Legionella pneumophila (strain Corby)
Q883N9 0.0 584 43 6 743 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5X969 0.0 583 42 6 706 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Legionella pneumophila (strain Paris)
A1TZG2 0.0 580 43 6 721 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A0L8B5 0.0 575 43 9 726 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q21JW7 0.0 574 42 6 740 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q6FCR7 0.0 573 43 9 729 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q0A793 0.0 567 44 8 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B0VLH0 0.0 566 42 8 733 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Acinetobacter baumannii (strain SDF)
B0VAL5 0.0 565 42 8 733 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Acinetobacter baumannii (strain AYE)
Q3BV47 0.0 565 43 12 715 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B2HWX8 0.0 563 41 8 733 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Acinetobacter baumannii (strain ACICU)
B2SIS8 0.0 558 42 10 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P309 0.0 558 42 10 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8PM40 0.0 558 43 12 715 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Xanthomonas axonopodis pv. citri (strain 306)
Q5H029 0.0 558 42 10 712 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q31IC8 0.0 556 40 10 734 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q8PAE0 0.0 553 42 11 713 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UT85 0.0 553 42 11 713 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Xanthomonas campestris pv. campestris (strain 8004)
B0RV07 0.0 553 42 11 713 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Xanthomonas campestris pv. campestris (strain B100)
B0U0U4 0.0 546 41 11 726 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q0BLC3 0.0 545 40 11 722 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Francisella tularensis subsp. holarctica (strain OSU18)
Q2A2U4 0.0 545 40 11 722 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Francisella tularensis subsp. holarctica (strain LVS)
A7NCY2 0.0 545 40 11 722 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q5NGC3 0.0 544 40 11 722 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HS5 0.0 544 40 11 722 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Francisella tularensis subsp. tularensis (strain FSC 198)
A4IXN4 0.0 543 40 11 722 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Francisella tularensis subsp. tularensis (strain WY96-3418)
B2SGG3 0.0 542 40 11 722 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Francisella tularensis subsp. mediasiatica (strain FSC147)
A0Q621 0.0 542 40 11 722 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Francisella tularensis subsp. novicida (strain U112)
Q2SCH1 0.0 540 44 10 721 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Hahella chejuensis (strain KCTC 2396)
B4SQ79 0.0 540 42 10 718 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Stenotrophomonas maltophilia (strain R551-3)
B2FJ58 0.0 537 42 10 718 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Stenotrophomonas maltophilia (strain K279a)
Q9PA69 1.4e-162 488 42 13 731 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Xylella fastidiosa (strain 9a5c)
Q0VQU5 1.2e-160 483 39 9 711 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q4FTN9 1.46e-159 482 37 14 751 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1QCP8 1.54e-159 482 37 14 744 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q87A16 2.3e-158 478 42 14 731 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA87 2.3e-158 478 42 14 731 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Xylella fastidiosa (strain M23)
B0U5Z5 4.69e-158 477 42 14 731 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Xylella fastidiosa (strain M12)
A5WGC0 5.53e-156 474 36 12 778 3 rlmL Ribosomal RNA large subunit methyltransferase K/L Psychrobacter sp. (strain PRwf-1)
Q9JYY8 3.95e-89 286 46 4 311 1 rlmK Ribosomal RNA large subunit methyltransferase K Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q55156 2.83e-80 263 37 3 378 3 slr0064 Putative RNA methyltransferase slr0064 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9K0V4 4.1e-79 260 40 3 372 1 rlmL Ribosomal RNA large subunit methyltransferase L Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P50840 1.15e-45 170 30 6 367 1 ypsC Putative RNA methyltransferase YpsC Bacillus subtilis (strain 168)
Q57880 3.02e-34 138 29 8 338 1 trm14 tRNA (guanine(6)-N2)-methyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O28105 4.22e-26 114 28 7 334 3 trm14 tRNA (guanine(6)-N2)-methyltransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P39587 1.11e-21 101 28 8 280 3 ywbD Putative ribosomal RNA large subunit methyltransferase YwbD Bacillus subtilis (strain 168)
A0KKF0 1.95e-18 91 30 11 273 3 rlmI Ribosomal RNA large subunit methyltransferase I Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q12JE5 3.13e-18 90 27 9 272 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q3IKJ0 7.49e-18 89 27 8 256 3 rlmI Ribosomal RNA large subunit methyltransferase I Pseudoalteromonas translucida (strain TAC 125)
A4SML8 8.9e-18 89 26 7 266 3 rlmI Ribosomal RNA large subunit methyltransferase I Aeromonas salmonicida (strain A449)
A1S9W1 1.07e-17 89 26 8 272 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q15TV2 3.58e-17 87 27 7 241 3 rlmI Ribosomal RNA large subunit methyltransferase I Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B6EMK8 4.53e-17 87 27 8 253 3 rlmI Ribosomal RNA large subunit methyltransferase I Aliivibrio salmonicida (strain LFI1238)
Q6LQ36 1.32e-16 86 26 7 266 3 rlmI Ribosomal RNA large subunit methyltransferase I Photobacterium profundum (strain SS9)
Q07VV2 2.83e-16 85 26 8 272 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella frigidimarina (strain NCIMB 400)
Q5E4P6 3.52e-16 84 26 10 295 3 rlmI Ribosomal RNA large subunit methyltransferase I Aliivibrio fischeri (strain ATCC 700601 / ES114)
A7ME44 4.45e-16 84 27 9 272 3 rlmI Ribosomal RNA large subunit methyltransferase I Cronobacter sakazakii (strain ATCC BAA-894)
Q8EHR8 5.68e-16 84 26 8 268 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A6T766 6.6e-16 84 29 10 282 3 rlmI Ribosomal RNA large subunit methyltransferase I Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XY38 7.56e-16 84 29 10 282 3 rlmI Ribosomal RNA large subunit methyltransferase I Klebsiella pneumoniae (strain 342)
Q0HXZ5 7.59e-16 83 26 8 268 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella sp. (strain MR-7)
Q482P5 9.78e-16 83 32 3 156 3 rlmI Ribosomal RNA large subunit methyltransferase I Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A0KTU3 9.95e-16 83 26 8 268 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella sp. (strain ANA-3)
Q0HLL4 1e-15 83 26 8 268 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella sp. (strain MR-4)
B5FEQ2 1.04e-15 83 26 10 295 3 rlmI Ribosomal RNA large subunit methyltransferase I Aliivibrio fischeri (strain MJ11)
A4W8X9 1.59e-15 82 28 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Enterobacter sp. (strain 638)
C0Q8C5 2.69e-15 82 27 7 267 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella paratyphi C (strain RKS4594)
Q57QS3 2.99e-15 82 27 7 267 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella choleraesuis (strain SC-B67)
A1RGR7 5.39e-15 81 28 8 278 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella sp. (strain W3-18-1)
A4Y9L4 5.39e-15 81 28 8 278 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WRS8 5.44e-15 81 28 8 278 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella baltica (strain OS185)
Q8Z7R6 6.21e-15 80 27 7 267 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella typhi
B5R6D3 6.21e-15 80 28 11 279 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZH0 1.04e-14 80 28 11 279 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella enteritidis PT4 (strain P125109)
Q87P89 1.08e-14 80 27 9 254 3 rlmI Ribosomal RNA large subunit methyltransferase I Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8ZQ64 1.21e-14 80 27 7 267 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N6W0 1.21e-14 80 27 7 267 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TE06 1.21e-14 80 27 7 267 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella heidelberg (strain SL476)
B5FR09 1.21e-14 80 27 7 267 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella dublin (strain CT_02021853)
B5F1W3 1.21e-14 80 27 7 267 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella agona (strain SL483)
B4TSJ2 1.3e-14 80 27 7 267 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella schwarzengrund (strain CVM19633)
B4T209 1.3e-14 80 27 7 267 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella newport (strain SL254)
A7FJR8 1.33e-14 80 27 8 268 3 rlmI Ribosomal RNA large subunit methyltransferase I Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JQP6 1.39e-14 79 27 8 268 3 rlmI Ribosomal RNA large subunit methyltransferase I Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66CE0 1.39e-14 79 27 8 268 3 rlmI Ribosomal RNA large subunit methyltransferase I Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TKV4 1.39e-14 79 27 8 268 3 rlmI Ribosomal RNA large subunit methyltransferase I Yersinia pestis (strain Pestoides F)
Q1CGL8 1.39e-14 79 27 8 268 3 rlmI Ribosomal RNA large subunit methyltransferase I Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2N9 1.39e-14 79 27 8 268 3 rlmI Ribosomal RNA large subunit methyltransferase I Yersinia pestis bv. Antiqua (strain Angola)
Q7CHM1 1.39e-14 79 27 8 268 3 rlmI Ribosomal RNA large subunit methyltransferase I Yersinia pestis
B2JYU4 1.39e-14 79 27 8 268 3 rlmI Ribosomal RNA large subunit methyltransferase I Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CA17 1.39e-14 79 27 8 268 3 rlmI Ribosomal RNA large subunit methyltransferase I Yersinia pestis bv. Antiqua (strain Antiqua)
A9MHS2 1.54e-14 79 27 7 267 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5YT98 1.85e-14 79 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XD85 1.85e-14 79 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli O157:H7
A7ZK71 1.85e-14 79 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli O139:H28 (strain E24377A / ETEC)
B7UN46 1.88e-14 79 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B2VDG5 2.28e-14 79 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q32HT9 2.31e-14 79 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Shigella dysenteriae serotype 1 (strain Sd197)
B5BBK0 2.44e-14 79 27 7 267 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella paratyphi A (strain AKU_12601)
Q5PGB6 2.44e-14 79 27 7 267 3 rlmI Ribosomal RNA large subunit methyltransferase I Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A7MZM6 3.17e-14 79 26 9 254 3 rlmI Ribosomal RNA large subunit methyltransferase I Vibrio campbellii (strain ATCC BAA-1116)
A8AIB0 3.84e-14 78 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q9KSA5 4.23e-14 78 26 10 277 3 rlmI Ribosomal RNA large subunit methyltransferase I Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F8G8 4.23e-14 78 26 10 277 3 rlmI Ribosomal RNA large subunit methyltransferase I Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A9L0P6 4.59e-14 78 27 8 278 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella baltica (strain OS195)
A3D7R1 4.59e-14 78 27 8 278 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q9RYA1 5.16e-14 78 27 5 216 1 DR_0049 Ribosomal RNA large subunit methyltransferase DR_0049 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A8GCM8 6.12e-14 77 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Serratia proteamaculans (strain 568)
Q59047 6.53e-14 77 27 7 203 3 MJ1653 Putative ribosomal RNA large subunit methyltransferase MJ1653 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B6I942 6.64e-14 77 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli (strain SE11)
P75876 6.64e-14 77 27 10 274 1 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli (strain K12)
B1IVW5 6.64e-14 77 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZYR9 6.64e-14 77 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli O9:H4 (strain HS)
B1X8S1 6.64e-14 77 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli (strain K12 / DH10B)
C4ZQ93 6.64e-14 77 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli (strain K12 / MC4100 / BW2952)
Q8FJ71 7.53e-14 77 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJ93 7.53e-14 77 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A9N6 7.53e-14 77 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli O1:K1 / APEC
B1LJ30 7.94e-14 77 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli (strain SMS-3-5 / SECEC)
C4L7I7 8e-14 77 28 8 242 3 rlmI Ribosomal RNA large subunit methyltransferase I Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q1RDP5 8.54e-14 77 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Escherichia coli (strain UTI89 / UPEC)
B4RRY8 8.91e-14 77 33 1 124 3 rlmI Ribosomal RNA large subunit methyltransferase I Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q31YN0 9.09e-14 77 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Shigella boydii serotype 4 (strain Sb227)
A1JMW5 9.21e-14 77 26 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B2TTS7 1e-13 77 27 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q7ML80 1.25e-13 77 25 9 271 3 rlmI Ribosomal RNA large subunit methyltransferase I Vibrio vulnificus (strain YJ016)
Q0T667 1.31e-13 77 26 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Shigella flexneri serotype 5b (strain 8401)
Q59043 1.37e-13 76 26 10 228 3 MJ1649 Putative ribosomal RNA large subunit methyltransferase MJ1649 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8D992 2.86e-13 75 24 9 271 3 rlmI Ribosomal RNA large subunit methyltransferase I Vibrio vulnificus (strain CMCP6)
Q83LM0 4.61e-13 75 26 10 274 3 rlmI Ribosomal RNA large subunit methyltransferase I Shigella flexneri
Q5SIT4 1.42e-10 67 31 12 247 1 TTHA1280 Ribosomal RNA large subunit methyltransferase I Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q8U248 1.71e-07 57 28 6 242 1 trm14 tRNA (guanine(6)-N2)-methyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9BTF0 0.000619 46 28 4 160 1 THUMPD2 THUMP domain-containing protein 2 Homo sapiens
Q54BW1 0.000642 46 23 9 233 2 DDB_G0293380 Putative uncharacterized protein DDB_G0293380 Dictyostelium discoideum

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01480
Feature type CDS
Gene rlmKL
Product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL
Location 329259 - 331373 (strand: 1)
Length 2115 (nucleotides) / 704 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1253
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01170 RMKL-like, methyltransferase domain
PF02926 THUMP domain
PF10672 S-adenosylmethionine-dependent methyltransferase
PF22020 RlmL ferredoxin-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0116 Translation, ribosomal structure and biogenesis (J) J 23S rRNA G2445 N2-methylase RlmL

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12297 23S rRNA (guanine2069-N7)-methyltransferase / 23S rRNA (guanine2445-N2)-methyltransferase [EC:2.1.1.264 2.1.1.173] - -

Protein Sequence

MNTYFASTARGLEELLKTELATLGAEDLSIAQGGVHFRASPRTMYECLMWSRLASRILLPLNEFDVYSDLDLYLAVQSIDWPSVFTVDKTFAVHFNGTNDEIRNSQYGALKVKDAIVDSFTRKIDARPDVAKQQPDIRINVYLNKEKASLAIDLSGDSLHIRGYRELAGQAPLKENLAAAIVQRSGWQKDTPMVDPMCGSGTLLIEAAMMAADCAPGLNRTHWGFEAWSSHDSALWDSVKAEARERANAGVVSATARFFGSDTDKRVLDMARANARRAGVDKLITFQQKDATKLENPLPEGPKGTIISNPPYGERLESEPALIALHSVFSRVVRTRFPGWRLSMFSGSPELLSSLQLRAEREFKAKNGPLDCVQKNYQLSETPPAGAQDLGSDFANRLRKNEKKLAKWAKQEGVECYRLYDADLPEYNVAVDRYADYVVVQEYAPPKTIDPNKARQRLFDVISATLAVLELPANQLVLKTRQRQKGKQQYEKLDEKKNSFLVKEYNAQLWVNLTDYLDTGLFLDHRIARKMLGQMSKGKDFLNLFAYTGSATVHAGLGGARSTTSVDMSRTYLEWAERNLQSNGLSGRQHRLVQADCLSWLAQTPEQFDLIFIDPPTFSNSKRMEDTFDVQRDHIMLMKQLKRLLRRGGTLMFSNNKRGFKLDQAGMDEAGLVAQEITAKTQSQDFARNRQIHNCWLIRHAGEE

Flanking regions ( +/- flanking 50bp)

CCGGATCCGCTATAATGCGCTCCAAATTTTTATTTCAACGGTAAACCATGATGAACACGTATTTTGCCAGCACCGCCCGTGGGCTGGAAGAGCTTTTAAAAACTGAATTAGCAACACTGGGTGCTGAAGACCTCAGCATTGCGCAGGGTGGTGTTCATTTTCGTGCTTCACCGCGTACAATGTACGAATGCCTGATGTGGAGCCGTCTGGCATCCCGTATTCTATTACCGCTGAATGAGTTCGATGTCTACAGCGATCTGGATCTTTATCTTGCCGTGCAATCAATTGACTGGCCGTCTGTCTTTACGGTGGACAAAACCTTTGCTGTGCATTTTAACGGCACCAATGATGAAATCCGTAACAGTCAGTACGGCGCGCTGAAAGTTAAAGATGCTATCGTCGACAGCTTTACCCGCAAAATTGATGCGCGTCCTGATGTGGCAAAACAGCAGCCCGATATCCGCATCAATGTGTACCTGAATAAAGAAAAAGCCTCACTGGCCATCGACCTGAGCGGCGATTCCCTGCATATCCGTGGTTACCGCGAACTGGCAGGTCAGGCACCGCTGAAAGAAAACCTGGCGGCAGCGATTGTCCAGCGTTCCGGCTGGCAGAAAGATACCCCGATGGTGGATCCGATGTGCGGCTCCGGCACACTGCTGATTGAAGCGGCGATGATGGCGGCTGATTGTGCGCCGGGTCTGAACCGTACGCACTGGGGCTTTGAAGCCTGGAGCAGCCATGACAGTGCGCTCTGGGACTCTGTTAAAGCAGAAGCCCGCGAGCGGGCCAATGCCGGTGTTGTCAGTGCTACGGCGCGTTTTTTCGGGTCTGATACGGACAAACGTGTGCTGGATATGGCGCGTGCCAATGCCCGCCGTGCCGGTGTGGATAAACTGATTACGTTCCAGCAGAAAGATGCCACTAAACTGGAAAACCCGCTGCCGGAAGGGCCGAAAGGTACTATTATTTCCAACCCGCCATACGGTGAGCGTCTGGAAAGCGAACCGGCACTGATTGCGCTGCACAGTGTGTTCAGCCGTGTTGTCCGCACCCGTTTTCCGGGCTGGCGCCTGTCCATGTTCAGCGGTTCACCGGAGCTGCTCAGCAGCCTTCAGTTACGCGCTGAACGTGAGTTCAAAGCAAAAAATGGTCCGCTGGACTGCGTACAGAAAAACTATCAGTTAAGCGAAACCCCACCGGCGGGTGCGCAGGATCTTGGTTCAGATTTCGCAAACCGTCTGCGTAAGAATGAGAAAAAATTGGCAAAATGGGCGAAGCAGGAAGGCGTTGAGTGTTATCGTCTGTACGATGCTGATTTGCCTGAGTATAATGTTGCAGTTGATCGCTATGCCGATTATGTCGTGGTTCAGGAGTATGCACCGCCGAAAACAATTGACCCGAACAAAGCGCGTCAGCGCCTGTTTGATGTGATCAGCGCAACACTTGCGGTACTGGAACTGCCGGCGAATCAGCTTGTTTTAAAGACTCGTCAGCGCCAGAAAGGCAAGCAGCAATATGAAAAGCTGGATGAGAAAAAGAACAGTTTCCTGGTAAAAGAGTATAACGCACAGTTATGGGTTAACCTGACTGATTACCTGGACACCGGCTTGTTCCTTGACCATCGTATTGCCCGCAAAATGCTGGGGCAGATGAGTAAAGGTAAAGATTTTCTCAATCTGTTCGCCTACACCGGGTCTGCGACAGTTCATGCCGGACTTGGCGGGGCGCGCTCCACCACATCAGTGGATATGTCACGCACCTATCTGGAGTGGGCGGAACGCAATTTACAAAGTAACGGACTGAGCGGCAGACAGCACCGTCTGGTGCAGGCGGATTGCCTGAGCTGGCTGGCGCAGACCCCGGAACAGTTTGATCTGATCTTTATCGATCCGCCGACGTTTTCTAACTCAAAACGGATGGAAGACACCTTTGATGTCCAGCGCGACCATATCATGCTGATGAAACAGCTGAAACGTCTGCTGCGCCGTGGCGGAACACTGATGTTCTCCAATAACAAACGTGGTTTTAAATTAGATCAGGCCGGGATGGATGAAGCCGGACTGGTGGCTCAGGAAATCACGGCCAAAACACAATCACAAGATTTTGCACGTAACCGTCAGATTCATAACTGCTGGCTAATCCGCCACGCAGGCGAGGAATAACAGAACTATGTCGTTGATTAATATGGCGGGCGCCTGGCTCGCATTCAGTG