Homologs in group_1227

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07150 FBDBKF_07150 88.0 Morganella morganii S1 aroA 3-phosphoshikimate 1-carboxyvinyltransferase
EHELCC_03820 EHELCC_03820 88.0 Morganella morganii S2 aroA 3-phosphoshikimate 1-carboxyvinyltransferase
NLDBIP_03820 NLDBIP_03820 88.0 Morganella morganii S4 aroA 3-phosphoshikimate 1-carboxyvinyltransferase
LHKJJB_09650 LHKJJB_09650 88.0 Morganella morganii S3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase
HKOGLL_09325 HKOGLL_09325 88.0 Morganella morganii S5 aroA 3-phosphoshikimate 1-carboxyvinyltransferase
PMI_RS03505 PMI_RS03505 75.1 Proteus mirabilis HI4320 aroA 3-phosphoshikimate 1-carboxyvinyltransferase

Distribution of the homologs in the orthogroup group_1227

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1227

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8RLV9 0.0 690 79 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Xenorhabdus nematophila (strain ATCC 19061 / DSM 3370 / CCUG 14189 / LMG 1036 / NCIMB 9965 / AN6)
P19688 0.0 674 79 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7N6D5 0.0 669 77 0 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GCH1 0.0 668 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Serratia proteamaculans (strain 568)
B5XY87 0.0 668 78 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Klebsiella pneumoniae (strain 342)
A8AIH5 0.0 663 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4W8S8 0.0 662 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Enterobacter sp. (strain 638)
A6T701 0.0 661 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MES7 0.0 661 76 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
B4TD38 0.0 659 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella heidelberg (strain SL476)
B4TRT9 0.0 658 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella schwarzengrund (strain CVM19633)
B5BBP9 0.0 658 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PGG5 0.0 658 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P07637 0.0 657 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P19786 0.0 657 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella typhi
P22299 0.0 657 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella gallinarum
B5R8J5 0.0 657 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QYQ8 0.0 657 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella enteritidis PT4 (strain P125109)
B5FQ51 0.0 657 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella dublin (strain CT_02021853)
C0PXU4 0.0 657 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella paratyphi C (strain RKS4594)
A9N7V6 0.0 657 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T142 0.0 657 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella newport (strain SL254)
Q57R23 0.0 657 77 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella choleraesuis (strain SC-B67)
P24497 0.0 657 76 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Klebsiella pneumoniae
B5F161 0.0 655 76 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella agona (strain SL483)
Q93ED4 0.0 655 77 1 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Yersinia ruckeri
B1JRD9 0.0 653 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66CI8 0.0 653 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2KA23 0.0 653 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FJW9 0.0 653 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q1RDV0 0.0 653 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli (strain UTI89 / UPEC)
Q0TJE5 0.0 653 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A9I5 0.0 653 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli O1:K1 / APEC
B7MS23 0.0 653 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli O81 (strain ED1a)
B7MHL7 0.0 653 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
A4TN18 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Yersinia pestis (strain Pestoides F)
Q1CGG5 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7I2 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q60112 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Yersinia pestis
Q1CA73 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A9MHX5 0.0 652 76 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q3Z3L4 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shigella sonnei (strain Ss046)
Q31YU3 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shigella boydii serotype 4 (strain Sb227)
B2TUH3 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I8Y0 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli (strain SE11)
P0A6D3 0.0 652 76 0 425 1 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli (strain K12)
B1X848 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli (strain K12 / DH10B)
C4ZQ34 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M836 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli O8 (strain IAI1)
B5YT42 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A6D4 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli O157:H7
B7LDA0 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli (strain 55989 / EAEC)
A7ZJZ7 0.0 652 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8FJB6 0.0 652 75 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9ZFF7 0.0 651 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shigella sonnei
B1IW23 0.0 651 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZYL1 0.0 651 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli O9:H4 (strain HS)
Q83RY8 0.0 649 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shigella flexneri
Q0SX08 0.0 649 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shigella flexneri serotype 5b (strain 8401)
B2VC79 0.0 649 73 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q32E25 0.0 648 76 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
C6DF65 0.0 647 77 1 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B7NAQ7 0.0 647 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7UMZ4 0.0 647 75 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1LJV6 0.0 647 75 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B7NM67 0.0 647 75 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
O87006 0.0 645 76 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shigella dysenteriae
Q6D401 0.0 645 77 1 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B4ET25 0.0 639 75 0 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Proteus mirabilis (strain HI4320)
Q2NUA9 0.0 630 72 1 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Sodalis glossinidius (strain morsitans)
B7VM38 0.0 623 71 1 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Vibrio atlanticus (strain LGP32)
Q87QX9 0.0 619 71 1 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MJ45 0.0 616 71 1 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Vibrio vulnificus (strain YJ016)
Q6LPE1 0.0 616 71 1 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Photobacterium profundum (strain SS9)
Q9X4H2 0.0 615 72 0 423 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Edwardsiella ictaluri (strain 93-146)
A7N1K3 0.0 614 72 1 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Vibrio campbellii (strain ATCC BAA-1116)
B6EIX8 0.0 612 70 2 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Aliivibrio salmonicida (strain LFI1238)
B5FG60 0.0 610 70 1 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Aliivibrio fischeri (strain MJ11)
Q5E3Z0 0.0 610 70 1 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8VP65 0.0 608 71 1 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Photobacterium damsela subsp. piscicida
P54220 0.0 608 72 5 431 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mannheimia haemolytica
A5UCH8 0.0 600 71 4 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Haemophilus influenzae (strain PittEE)
Q4QL19 0.0 600 71 4 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Haemophilus influenzae (strain 86-028NP)
C3LN54 0.0 600 70 1 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KRB0 0.0 600 70 1 425 1 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q65S78 0.0 600 70 4 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0I320 0.0 598 71 5 431 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Histophilus somni (strain 129Pt)
A5F7G5 0.0 598 70 1 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q15T04 0.0 598 69 1 422 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A5UJ35 0.0 598 71 4 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Haemophilus influenzae (strain PittGG)
A3N063 0.0 598 69 4 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0BNY1 0.0 598 69 4 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GXD4 0.0 598 69 4 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0UT47 0.0 597 71 5 431 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Histophilus somni (strain 2336)
Q03421 0.0 595 71 4 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
C4LEG3 0.0 594 69 3 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
P52310 0.0 593 70 5 431 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Histophilus somni
Q04570 0.0 592 69 4 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Pasteurella multocida (strain Pm70)
A1STZ0 0.0 590 69 2 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A6Q7Q0 0.0 589 67 1 421 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Sulfurovum sp. (strain NBC37-1)
A4SM13 0.0 589 69 2 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Aeromonas salmonicida (strain A449)
Q482G5 0.0 582 67 1 425 1 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A6VMU5 0.0 581 68 5 434 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A1S6D3 0.0 579 65 1 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A6WNN0 0.0 574 64 1 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella baltica (strain OS185)
A3D4A6 0.0 570 64 1 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EA95 0.0 570 64 1 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella baltica (strain OS223)
A9L2X7 0.0 568 64 1 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella baltica (strain OS195)
A4Y732 0.0 566 64 1 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q12NE1 0.0 564 64 1 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1RJF8 0.0 563 63 1 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella sp. (strain W3-18-1)
Q8EEH8 0.0 563 64 1 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HV11 0.0 561 64 1 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella sp. (strain MR-7)
A3QEC0 0.0 561 64 1 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q0HIX1 0.0 560 64 1 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella sp. (strain MR-4)
A8FVN6 0.0 559 64 1 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella sediminis (strain HAW-EB3)
A6VXX9 0.0 559 65 2 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Marinomonas sp. (strain MWYL1)
A0KWN7 0.0 558 64 1 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella sp. (strain ANA-3)
B1KF47 0.0 557 64 1 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella woodyi (strain ATCC 51908 / MS32)
Q7VLN9 0.0 556 66 4 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q081U4 0.0 555 63 1 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella frigidimarina (strain NCIMB 400)
B0TT43 0.0 555 63 1 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella halifaxensis (strain HAW-EB4)
Q492S6 0.0 555 62 3 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Blochmanniella pennsylvanica (strain BPEN)
A8H4A4 0.0 554 63 1 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B8D7K3 0.0 546 59 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57396 0.0 545 59 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9A1 0.0 545 59 0 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B8CMH2 0.0 545 62 1 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
P59416 0.0 544 60 0 419 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q1LTL1 0.0 543 63 1 420 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q03321 0.0 533 65 4 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Aeromonas salmonicida
C4K4D4 0.0 532 61 0 423 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q59178 0.0 524 62 0 417 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q057N6 2.21e-180 513 56 1 420 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q7VR41 1.21e-179 511 59 4 419 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Blochmanniella floridana
Q3ILA2 3.26e-177 504 61 2 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Pseudoalteromonas translucida (strain TAC 125)
Q0KDH9 7.56e-158 455 57 7 433 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B2T630 2.35e-157 454 56 6 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A9ADV6 4.28e-157 453 56 6 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q46Y50 6.56e-157 453 57 7 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q13VC2 1e-156 452 56 6 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Paraburkholderia xenovorans (strain LB400)
B2JF04 1.39e-155 449 55 7 440 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B4EB42 2.98e-155 449 56 6 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q0BH93 3.96e-155 448 55 6 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B3R368 1.03e-154 447 56 7 433 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B1JXR9 1.99e-154 446 55 6 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Burkholderia orbicola (strain MC0-3)
B1YV33 2.85e-154 446 55 6 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Burkholderia ambifaria (strain MC40-6)
Q1BY28 4.65e-154 446 55 7 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Burkholderia orbicola (strain AU 1054)
A4JCH4 2.01e-153 444 55 7 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A0K5M1 3.73e-153 443 55 7 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Burkholderia cenocepacia (strain HI2424)
Q39IG1 2.16e-152 441 55 7 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P05466 4.12e-152 444 52 6 440 1 At2g45300 3-phosphoshikimate 1-carboxyvinyltransferase, chloroplastic Arabidopsis thaliana
Q3SK83 1.8e-151 439 55 5 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Thiobacillus denitrificans (strain ATCC 25259)
A4G861 4.82e-151 438 53 5 431 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Herminiimonas arsenicoxydans
Q0AIZ5 8.69e-151 437 54 7 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A6T1G3 3.14e-150 436 54 5 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Janthinobacterium sp. (strain Marseille)
A1KUN6 1.13e-147 429 54 8 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JYU1 2.74e-147 428 54 8 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q82TD4 4.04e-147 428 53 6 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P23981 9.42e-146 427 53 6 440 2 EPSPS-1 3-phosphoshikimate 1-carboxyvinyltransferase 1, chloroplastic Nicotiana tabacum
B2U886 1.56e-145 424 55 7 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Ralstonia pickettii (strain 12J)
Q8Y0Y6 1.86e-145 424 54 6 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9JTT3 1.29e-144 422 53 6 431 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P10748 2.11e-144 424 53 6 440 2 None 3-phosphoshikimate 1-carboxyvinyltransferase, chloroplastic Solanum lycopersicum
P17688 1.46e-143 422 53 6 440 3 None 3-phosphoshikimate 1-carboxyvinyltransferase, chloroplastic Brassica napus
C1D543 2.57e-143 418 55 8 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Laribacter hongkongensis (strain HLHK9)
P11043 5.88e-143 420 52 6 440 1 EPSPS 3-phosphoshikimate 1-carboxyvinyltransferase, chloroplastic Petunia hybrida
Q5F889 8.09e-143 417 52 6 431 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B4RL93 8.36e-143 417 52 6 431 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Neisseria gonorrhoeae (strain NCCP11945)
B3PJM0 4.39e-141 412 53 5 422 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Cellvibrio japonicus (strain Ueda107)
Q5QZ50 7.83e-139 407 50 4 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q7W602 1.78e-136 401 54 7 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q9RND7 2.78e-136 400 54 10 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P12421 2.2e-135 398 54 10 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q2L2S7 9.17e-130 384 52 5 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bordetella avium (strain 197N)
A9IJI7 3.13e-116 350 52 8 434 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
P23281 4.11e-106 320 53 4 335 2 EPSPS-2 3-phosphoshikimate 1-carboxyvinyltransferase 2 (Fragment) Nicotiana tabacum
B2IYE4 6.15e-105 320 42 6 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P39915 4.78e-104 319 51 11 395 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Burkholderia pseudomallei
Q3MAV9 9.44e-102 312 40 7 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YMB5 1.07e-100 309 41 6 420 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9L213 4.85e-94 293 41 5 424 3 aroA2 3-phosphoshikimate 1-carboxyvinyltransferase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q2FQ54 1.15e-90 283 40 6 408 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
A4RD09 1.72e-88 297 43 14 448 3 MGG_01128 Pentafunctional AROM polypeptide Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A3CV28 3.47e-87 274 38 4 410 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
D1ZA70 5.32e-86 290 42 15 442 3 SMAC_02366 Pentafunctional AROM polypeptide Sordaria macrospora (strain ATCC MYA-333 / DSM 997 / K(L3346) / K-hell)
A5UJV0 2.59e-85 270 35 8 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A7F7H0 4.16e-85 287 43 13 428 3 SS1G_13550 Pentafunctional AROM polypeptide Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
B8GF70 4.43e-85 269 39 6 421 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
Q8X071 7.75e-85 286 44 15 426 3 aro-1 Pentafunctional AROM polypeptide Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
C7YZ74 1.81e-84 285 41 14 434 3 NECHADRAFT_47780 Pentafunctional AROM polypeptide Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
Q5XNP0 4.04e-84 284 42 13 432 3 None Pentafunctional AROM polypeptide Sclerotinia sclerotiorum
B2B223 6.59e-84 283 43 14 427 3 Pa_6_5280 Pentafunctional AROM polypeptide Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
Q6C1X5 7.89e-84 283 42 12 428 3 ARO1 Pentafunctional AROM polypeptide Yarrowia lipolytica (strain CLIB 122 / E 150)
B9WFG1 1.04e-83 283 43 14 425 3 ARO1 Pentafunctional AROM polypeptide Candida dubliniensis (strain CD36 / ATCC MYA-646 / CBS 7987 / NCPF 3949 / NRRL Y-17841)
C5M1X2 1.77e-83 282 43 14 429 3 ARO1 Pentafunctional AROM polypeptide Candida tropicalis (strain ATCC MYA-3404 / T1)
Q0V3H0 6.17e-83 281 42 16 435 3 SNOG_01444 Pentafunctional AROM polypeptide Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
C5PA86 8.42e-83 280 42 16 439 3 CPC735_008210 Pentafunctional AROM polypeptide Coccidioides posadasii (strain C735)
C5G8R4 1.12e-82 280 41 14 441 3 BDCG_01028 Pentafunctional AROM polypeptide Ajellomyces dermatitidis (strain ER-3 / ATCC MYA-2586)
C5JKE6 1.26e-82 280 41 14 441 3 BDBG_02999 Pentafunctional AROM polypeptide Blastomyces gilchristii (strain SLH14081)
A5H2Q8 1.58e-82 280 41 13 427 3 ARO1-1 Pentafunctional AROM polypeptide 1 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
C9SE96 2.59e-82 279 42 12 431 3 VDBG_03429 Pentafunctional AROM polypeptide Verticillium alfalfae (strain VaMs.102 / ATCC MYA-4576 / FGSC 10136)
A6ZY89 4.37e-82 278 40 11 443 3 ARO1 Pentafunctional AROM polypeptide Saccharomyces cerevisiae (strain YJM789)
Q5AME2 4.71e-82 278 42 14 427 1 ARO1 Pentafunctional AROM polypeptide Candida albicans (strain SC5314 / ATCC MYA-2876)
C0NL63 5.7e-82 278 42 14 438 3 HCBG_03893 Pentafunctional AROM polypeptide Ajellomyces capsulatus (strain G186AR / H82 / ATCC MYA-2454 / RMSCC 2432)
A5H2P4 6.05e-82 278 41 13 430 3 ARO1-2 Pentafunctional AROM polypeptide 2 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
C0S433 7.08e-82 278 42 14 437 3 PABG_02447 Pentafunctional AROM polypeptide Paracoccidioides brasiliensis (strain Pb03)
Q74ZZ1 8.93e-82 277 41 12 439 3 ARO1 Pentafunctional AROM polypeptide Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q6FIV4 1.09e-81 277 41 12 449 3 ARO1 Pentafunctional AROM polypeptide Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
C1H8L1 1.43e-81 277 42 14 436 3 PAAG_07102 Pentafunctional AROM polypeptide Paracoccidioides lutzii (strain ATCC MYA-826 / Pb01)
C8Z543 1.78e-81 276 40 11 443 3 ARO1 Pentafunctional AROM polypeptide Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
B3LGE9 1.94e-81 276 41 12 443 3 ARO1 Pentafunctional AROM polypeptide Saccharomyces cerevisiae (strain RM11-1a)
P08566 2.1e-81 276 40 11 443 1 ARO1 Pentafunctional AROM polypeptide Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C1FYJ9 2.74e-81 276 42 14 437 3 PADG_00875 Pentafunctional AROM polypeptide Paracoccidioides brasiliensis (strain Pb18)
A6R8Q8 3.2e-81 276 42 14 434 3 HCAG_06699 Pentafunctional AROM polypeptide Ajellomyces capsulatus (strain NAm1 / WU24)
C7GIN5 3.47e-81 276 40 11 443 3 ARO1 Pentafunctional AROM polypeptide Saccharomyces cerevisiae (strain JAY291)
Q6CJC4 3.86e-81 276 43 13 438 3 ARO1 Pentafunctional AROM polypeptide Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
C4JYG6 5.58e-81 275 42 14 430 3 UREG_07217 Pentafunctional AROM polypeptide Uncinocarpus reesii (strain UAMH 1704)
C4R4R8 8.52e-81 275 42 16 428 3 ARO1 Pentafunctional AROM polypeptide Komagataella phaffii (strain GS115 / ATCC 20864)
B0XRM8 9.9e-81 275 42 14 429 1 aroM Pentafunctional AROM polypeptide Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
Q4WS76 1.02e-80 275 42 14 429 3 aroM Pentafunctional AROM polypeptide Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B6HAA7 1.1e-80 274 41 14 439 3 aroM Pentafunctional AROM polypeptide Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B8N4Q9 1.18e-80 274 42 14 429 3 aroM Pentafunctional AROM polypeptide Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
C5DN02 1.3e-80 274 41 12 439 3 ARO1 Pentafunctional AROM polypeptide Lachancea thermotolerans (strain ATCC 56472 / CBS 6340 / NRRL Y-8284)
A1D244 1.4e-80 274 42 14 429 3 aroM Pentafunctional AROM polypeptide Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
C6HCG7 1.62e-80 274 42 14 438 3 HCDG_03716 Pentafunctional AROM polypeptide Ajellomyces capsulatus (strain H143)
A8QCB2 1.65e-80 274 41 13 447 3 MGL_3989 Pentafunctional AROM polypeptide Malassezia globosa (strain ATCC MYA-4612 / CBS 7966)
Q2UCP6 1.72e-80 274 42 14 429 3 aroM Pentafunctional AROM polypeptide Aspergillus oryzae (strain ATCC 42149 / RIB 40)
C5DVG6 3.05e-80 273 40 12 451 3 ARO1 Pentafunctional AROM polypeptide Zygosaccharomyces rouxii (strain ATCC 2623 / CBS 732 / NBRC 1130 / NCYC 568 / NRRL Y-229)
Q12659 4.91e-80 272 40 15 431 3 arom Pentafunctional AROM polypeptide Pneumocystis carinii
C5FQ73 9.3e-80 271 40 13 437 3 MCYG_04845 Pentafunctional AROM polypeptide Arthroderma otae (strain ATCC MYA-4605 / CBS 113480)
A1CP85 1.09e-79 271 41 15 431 3 aroM Pentafunctional AROM polypeptide Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A3LSZ2 2.43e-79 270 41 14 430 3 ARO1 Pentafunctional AROM polypeptide Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
A0LLU6 4.09e-79 253 37 6 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
C4Y9D5 4.12e-79 270 41 15 428 3 ARO1 Pentafunctional AROM polypeptide Clavispora lusitaniae (strain ATCC 42720)
B8M0U4 4.93e-79 270 43 15 429 3 aroM Pentafunctional AROM polypeptide Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
P07547 2.32e-78 268 41 14 432 1 aromA Pentafunctional AROM polypeptide Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B6QWH9 2.45e-78 268 42 15 429 3 aroM-1 Pentafunctional AROM polypeptide 1 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
A7I8L8 3.96e-78 251 37 4 423 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
P0CM22 1.63e-77 265 40 12 443 3 CNB01990 Pentafunctional AROM polypeptide Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CM23 1.63e-77 265 40 12 443 3 CNBB3730 Pentafunctional AROM polypeptide Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
B6QCA7 1.12e-76 263 42 15 429 3 aroM-2 Pentafunctional AROM polypeptide 2 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
Q9K9D5 2.21e-76 247 36 8 422 3 aroA2 3-phosphoshikimate 1-carboxyvinyltransferase 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8J294 2.91e-75 259 39 16 451 3 None Pentafunctional AROM polypeptide Thanatephorus cucumeris
B6JVD0 3.2e-74 256 41 14 431 3 aro1 Pentafunctional AROM polypeptide Schizosaccharomyces japonicus (strain yFS275 / FY16936)
B0D6H2 4.21e-74 255 40 13 432 3 LACBIDRAFT_233717 Pentafunctional AROM polypeptide Laccaria bicolor (strain S238N-H82 / ATCC MYA-4686)
Q9P7R0 4.37e-74 255 41 16 434 1 aro1 Pentafunctional AROM polypeptide Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q888I3 8.12e-74 239 38 13 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2NH05 1.73e-73 239 35 9 434 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q48N21 1.08e-72 237 38 13 434 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A0Q388 1.41e-72 237 32 7 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Clostridium novyi (strain NT)
Q57925 1.84e-72 236 37 7 400 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B3PRH7 3.86e-72 235 37 13 431 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Rhizobium etli (strain CIAT 652)
Q4P8F6 4.38e-72 249 38 14 445 3 UMAG_03607 Pentafunctional AROM polypeptide Ustilago maydis (strain 521 / FGSC 9021)
Q4ZY26 6.93e-72 234 38 13 434 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Pseudomonas syringae pv. syringae (strain B728a)
B1ZMW8 1.18e-71 234 35 7 434 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q0D0F3 2.22e-71 248 40 13 430 3 aroM Pentafunctional AROM polypeptide Aspergillus terreus (strain NIH 2624 / FGSC A1156)
O26860 2.92e-71 233 36 8 414 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B5ZS37 3.44e-71 233 37 13 433 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q2KBU1 4.22e-71 233 38 14 431 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A8NMB4 9.41e-71 246 37 13 450 3 CC1G_09809 Pentafunctional AROM polypeptide Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
A9AAA7 1.37e-70 232 33 9 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q64YD8 2.81e-70 230 35 7 419 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacteroides fragilis (strain YCH46)
Q8TXN4 3.1e-70 231 35 12 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q5LHG9 7.84e-70 229 35 8 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A6VGE5 8.15e-70 229 32 10 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A5N6A9 1e-69 229 33 9 434 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DZT0 1e-69 229 33 9 434 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Clostridium kluyveri (strain NBRC 12016)
A3DK03 3.95e-69 228 34 7 413 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A4FWX2 5.53e-68 225 32 9 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q0SV34 8.01e-68 224 31 8 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Clostridium perfringens (strain SM101 / Type A)
A6UPK5 1.38e-67 224 32 7 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q0W6Q9 1.6e-67 223 36 11 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q0TT99 3.48e-67 223 31 8 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A6UTB9 4.08e-67 223 34 8 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
B2UYK7 4.59e-67 223 32 8 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Clostridium botulinum (strain Alaska E43 / Type E3)
Q8XMJ2 7.9e-67 222 31 8 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Clostridium perfringens (strain 13 / Type A)
Q6LXY8 6.16e-66 219 32 8 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
B8I5M2 4.55e-65 217 35 9 411 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q97KM2 8.02e-65 217 31 8 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B2TQ51 1.25e-64 216 32 8 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Clostridium botulinum (strain Eklund 17B / Type B)
Q187E3 3.18e-62 210 31 8 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Clostridioides difficile (strain 630)
Q5JFT3 1.4e-60 205 34 14 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
C0ZX05 4.54e-60 204 35 10 419 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
B9LUD2 1.16e-59 204 35 11 439 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
A2SU05 1.3e-59 203 34 7 419 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
A6M254 2.04e-59 202 30 10 433 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q3IQG6 7.87e-59 201 35 8 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A4FNI0 7.91e-59 201 35 10 420 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q12X18 3.2e-58 199 34 11 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q8THH3 3.75e-58 199 35 8 420 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
B0R558 4.19e-57 196 36 11 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9HQC1 4.91e-57 196 36 11 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
A0B7Z0 2.41e-55 192 33 10 418 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q8PXI0 1.65e-54 189 32 10 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q18F09 1.17e-53 187 34 10 414 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q82IU1 1.65e-53 187 33 10 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9K4A7 6.3e-53 186 33 10 424 3 aroA1 3-phosphoshikimate 1-carboxyvinyltransferase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A9A231 6.43e-52 182 30 8 415 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Nitrosopumilus maritimus (strain SCM1)
Q9V1H1 7.2e-52 182 31 14 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Pyrococcus abyssi (strain GE5 / Orsay)
A1T5Z3 2.22e-51 182 33 13 433 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
O28775 8.1e-51 179 31 13 419 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A4QC99 5.08e-50 178 32 12 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Corynebacterium glutamicum (strain R)
Q9Z470 5.53e-50 177 32 12 424 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
B0C218 1.95e-49 177 33 14 440 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Acaryochloris marina (strain MBIC 11017)
B4ULJ1 7.06e-49 175 31 10 434 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Anaeromyxobacter sp. (strain K)
Q0S2X1 7.75e-49 175 35 10 419 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Rhodococcus jostii (strain RHA1)
A9BHP7 1.01e-48 174 30 12 433 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Petrotoga mobilis (strain DSM 10674 / SJ95)
B5YH68 3.32e-48 173 29 12 433 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q1J633 4.13e-48 172 31 12 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q8RB11 5.74e-48 172 31 14 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B5XM07 8.64e-48 172 31 12 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pyogenes serotype M49 (strain NZ131)
P0CZ73 1.06e-47 172 31 12 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ72 1.06e-47 172 31 12 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
A2RE13 1.35e-47 171 31 12 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JL87 1.35e-47 171 31 12 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JB43 1.35e-47 171 31 12 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q5XBK5 1.35e-47 171 31 12 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q8P0H1 2.01e-47 171 31 12 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q48SV4 2.05e-47 171 31 12 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JGC1 2.6e-47 171 31 12 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q99Z83 2.74e-47 171 31 12 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pyogenes serotype M1
Q9PK28 2.91e-47 171 30 10 411 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Chlamydia muridarum (strain MoPn / Nigg)
B8J8W7 5.05e-47 170 30 10 440 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
C1B1F1 5.49e-47 170 34 10 419 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Rhodococcus opacus (strain B4)
Q2IMC8 8.14e-47 169 31 12 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q63A07 1.05e-46 169 31 13 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus cereus (strain ZK / E33L)
B7ILG9 2.23e-46 168 30 14 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus cereus (strain G9842)
Q3ZZI5 2.86e-46 167 31 10 413 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Dehalococcoides mccartyi (strain CBDB1)
Q9YEK9 3.05e-46 167 31 11 418 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q73UN2 3.82e-46 167 34 15 437 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
C6E2B1 6.63e-46 167 31 16 442 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Geobacter sp. (strain M21)
C1EYX7 7.05e-46 167 30 13 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus cereus (strain 03BB102)
Q81P64 8.5e-46 166 30 13 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus anthracis
C3LF06 8.5e-46 166 30 13 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3NZR4 8.5e-46 166 30 13 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus anthracis (strain A0248)
Q6HHF8 9.63e-46 166 30 13 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7JSV5 1.65e-45 166 30 13 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus cereus (strain AH820)
Q3Z992 1.74e-45 166 31 12 416 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q81C45 1.91e-45 166 30 14 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7H636 1.91e-45 166 30 14 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus cereus (strain B4264)
Q736A7 2.25e-45 165 30 13 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
A5FRZ3 6.98e-45 164 31 11 413 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
B2GLU6 8.17e-45 164 32 12 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
A8MH16 1.24e-44 163 28 12 433 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Alkaliphilus oremlandii (strain OhILAs)
Q87BU2 1.3e-44 164 32 16 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B7HVH9 2.69e-44 162 30 13 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus cereus (strain AH187)
Q8FRI2 3.04e-44 162 33 12 412 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A4TFB8 4.08e-44 162 32 12 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mycolicibacterium gilvum (strain PYR-GCK)
B5E9T1 4.29e-44 162 30 17 442 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
A7GN56 4.44e-44 162 32 15 437 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q9RVD3 5.22e-44 162 31 10 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A1ANP7 6.08e-44 162 31 15 438 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A0LS98 6.12e-44 161 33 8 411 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q0AX99 1.48e-43 160 31 15 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q39XB8 2.31e-43 160 31 15 447 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P20691 2.51e-43 160 28 14 439 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus subtilis (strain 168)
Q3KLZ0 2.71e-43 160 29 11 413 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
O84371 3.03e-43 160 30 12 415 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
A4J3N2 3.41e-43 159 30 12 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A0RFD1 3.59e-43 159 30 13 446 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus thuringiensis (strain Al Hakam)
B3DSQ0 4.22e-43 159 32 13 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bifidobacterium longum (strain DJO10A)
A7Z612 4.42e-43 159 29 12 439 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A5GE08 7.95e-43 159 30 17 440 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Geotalea uraniireducens (strain Rf4)
A8FEJ4 1.2e-42 158 28 14 442 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus pumilus (strain SAFR-032)
B1L5R5 1.56e-42 157 29 9 385 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Korarchaeum cryptofilum (strain OPF8)
B0RUW1 1.86e-42 158 33 16 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q83I86 1.88e-42 158 29 14 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Tropheryma whipplei (strain TW08/27)
B0K0J1 1.9e-42 157 28 14 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Thermoanaerobacter sp. (strain X514)
B0K928 1.9e-42 157 28 14 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q5WGR7 2e-42 157 30 13 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Shouchella clausii (strain KSM-K16)
B6J892 2.17e-42 157 32 18 437 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Coxiella burnetii (strain CbuK_Q154)
P9WPY5 2.37e-42 157 32 12 429 1 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPY4 2.37e-42 157 32 12 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U7Q1 2.37e-42 157 32 12 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AH01 2.37e-42 157 32 12 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
Q8U0A0 2.41e-42 157 29 14 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9PB21 2.77e-42 157 32 17 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Xylella fastidiosa (strain 9a5c)
O67494 4.15e-42 157 29 14 444 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Aquifex aeolicus (strain VF5)
Q8EQC1 4.29e-42 156 30 15 442 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9Z6M0 4.44e-42 157 29 10 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Chlamydia pneumoniae
B0BC00 5.39e-42 156 30 12 416 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B7T5 5.39e-42 156 30 12 416 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
B9LZG2 7.56e-42 156 30 14 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q83E11 7.83e-42 156 32 18 437 1 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A3PWC1 1.1e-41 155 32 11 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mycobacterium sp. (strain JLS)
A5GT44 1.34e-41 155 32 16 450 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Synechococcus sp. (strain RCC307)
A5IBR1 1.61e-41 155 29 13 445 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Legionella pneumophila (strain Corby)
Q72LH1 1.76e-41 155 32 14 440 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q1BCB0 1.89e-41 155 31 11 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mycobacterium sp. (strain MCS)
A1UCN4 1.89e-41 155 31 11 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mycobacterium sp. (strain KMS)
B6J1D9 2.01e-41 155 32 18 437 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Coxiella burnetii (strain CbuG_Q212)
Q7TWY4 2.19e-41 155 31 12 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A4IQ78 2.37e-41 154 31 14 447 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Geobacillus thermodenitrificans (strain NG80-2)
Q5SL36 3.1e-41 154 31 13 439 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q5ZVM1 7.25e-41 153 30 15 443 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
C0ZCE9 8.39e-41 153 28 12 440 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q8Y5Y0 9.55e-41 153 28 12 431 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5WWS9 9.56e-41 153 29 13 445 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Legionella pneumophila (strain Lens)
B9MQK4 1.05e-40 153 29 11 425 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q8PA95 1.44e-40 152 32 16 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UTD1 1.44e-40 152 32 16 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Xanthomonas campestris pv. campestris (strain 8004)
Q2S4R9 1.97e-40 152 30 15 442 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Salinibacter ruber (strain DSM 13855 / M31)
A9KCT5 2.02e-40 152 32 18 437 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Coxiella burnetii (strain Dugway 5J108-111)
Q255H3 2.92e-40 152 29 9 418 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Chlamydia felis (strain Fe/C-56)
Q5H081 2.99e-40 152 31 17 439 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SJJ3 2.99e-40 152 31 17 439 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P356 2.99e-40 152 31 17 439 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q5X5E6 4.22e-40 151 29 13 445 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Legionella pneumophila (strain Paris)
Q03LG9 4.59e-40 151 28 12 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M551 5.35e-40 151 28 12 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
A6TL04 7.38e-40 150 30 13 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Alkaliphilus metalliredigens (strain QYMF)
Q24V91 7.91e-40 150 28 10 440 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Desulfitobacterium hafniense (strain Y51)
B8G2R0 7.91e-40 150 28 10 440 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q5M0L5 7.97e-40 150 28 12 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus thermophilus (strain CNRZ 1066)
Q3A3D1 9.21e-40 150 29 12 438 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A4XMY4 9.95e-40 150 29 14 433 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A4W069 1.09e-39 150 28 12 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus suis (strain 98HAH33)
Q3BUZ1 1.13e-39 150 32 17 439 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q9CCI3 1.38e-39 150 31 14 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Mycobacterium leprae (strain TN)
A9NC18 1.42e-39 150 32 18 437 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
B1WZH9 1.42e-39 150 30 14 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Crocosphaera subtropica (strain ATCC 51142 / BH68)
A8MB38 1.46e-39 149 29 11 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Caldivirga maquilingensis (strain ATCC 700844 / DSM 13496 / JCM 10307 / IC-167)
B0SM47 2.97e-39 149 29 14 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SDL8 2.97e-39 149 29 14 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q5KXV5 3.33e-39 149 30 11 433 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Geobacillus kaustophilus (strain HTA426)
B9DSK8 3.37e-39 149 29 15 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A1B474 3.61e-39 149 31 15 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Paracoccus denitrificans (strain Pd 1222)
Q8PLY5 4.2e-39 149 31 17 439 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Xanthomonas axonopodis pv. citri (strain 306)
Q92A85 5.54e-39 148 28 12 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A1WUI9 6.49e-39 148 30 12 442 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Halorhodospira halophila (strain DSM 244 / SL1)
A3CNV3 8.79e-39 147 28 11 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus sanguinis (strain SK36)
C0QZK3 9.03e-39 147 29 12 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q65I39 1.31e-38 147 27 12 437 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q822G0 1.42e-38 147 28 8 418 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
C0MA42 1.53e-38 147 30 13 433 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus equi subsp. equi (strain 4047)
B4U246 2.7e-38 146 29 13 433 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
B5EQ20 2.91e-38 146 30 15 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J781 2.91e-38 146 30 15 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A8AXY9 3.08e-38 146 27 10 428 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A0AK35 3.3e-38 146 28 12 431 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8DLY3 3.67e-38 146 30 10 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B9KBV6 4.12e-38 145 27 12 439 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
C0MCK4 4.77e-38 145 29 13 433 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus equi subsp. zooepidemicus (strain H70)
Q59975 4.95e-38 146 32 17 450 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
F2MTI3 5.09e-38 145 29 14 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Enterococcus faecalis (strain ATCC 47077 / OG1RF)
B1L9E5 8.07e-38 145 27 12 439 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Thermotoga sp. (strain RQ2)
A5IK73 8.07e-38 145 27 12 439 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q5L5F4 9.55e-38 145 30 11 420 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Chlamydia abortus (strain DSM 27085 / S26/3)
Q3JEN6 1.21e-37 145 30 16 440 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B7KLE7 1.43e-37 145 30 15 436 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Gloeothece citriformis (strain PCC 7424)
A7H6S6 1.76e-37 144 30 9 443 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Anaeromyxobacter sp. (strain Fw109-5)
P0DH70 2.49e-37 144 29 14 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Enterococcus faecalis (strain ATCC 700802 / V583)
A5UZF9 2.53e-37 144 30 15 443 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Roseiflexus sp. (strain RS-1)
Q9KCA6 5.4e-37 143 28 12 442 1 aroA1 3-phosphoshikimate 1-carboxyvinyltransferase 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q03X10 5.68e-37 143 29 16 440 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q88VL2 6.66e-37 142 29 15 445 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A5FUH8 6.81e-37 143 31 16 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Acidiphilium cryptum (strain JF-5)
Q9WYI0 8.04e-37 142 27 12 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q0BQH9 1.01e-36 142 30 17 434 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q71Y92 1.1e-36 142 29 13 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KWM3 1.1e-36 142 29 13 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q2JLV2 1.43e-36 142 31 16 448 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q46LT7 1.5e-36 142 29 14 451 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Prochlorococcus marinus (strain NATL2A)
Q3AAT7 1.81e-36 141 28 12 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B1MYD1 1.86e-36 141 31 17 441 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Leuconostoc citreum (strain KM20)
Q8DUV8 2.13e-36 141 27 11 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q01Q26 2.3e-36 141 29 18 445 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Solibacter usitatus (strain Ellin6076)
Q6GGU5 2.46e-36 141 28 11 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Staphylococcus aureus (strain MRSA252)
B2UN97 2.53e-36 141 29 15 456 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q9S400 3.61e-36 140 27 14 438 1 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B2V630 4.82e-36 140 28 13 442 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Sulfurihydrogenibium sp. (strain YO3AOP1)
B5E5M9 5.63e-36 140 27 14 438 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pneumoniae serotype 19F (strain G54)
B1ICH2 8.03e-36 139 26 12 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pneumoniae (strain Hungary19A-6)
Q1IZN3 8.6e-36 140 30 11 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q2YY90 1.1e-35 139 28 11 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8CWQ7 1.34e-35 139 26 12 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04JX6 1.34e-35 139 26 12 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C1CL80 1.55e-35 139 26 12 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pneumoniae (strain P1031)
C1CEW0 1.55e-35 139 26 12 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pneumoniae (strain JJA)
B8ZKM0 1.55e-35 139 26 12 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1C7X2 1.55e-35 139 26 12 435 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Streptococcus pneumoniae (strain 70585)
B8DC03 2.09e-35 138 28 13 432 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Listeria monocytogenes serotype 4a (strain HCC23)
Q8NWN5 3.2e-35 138 28 11 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Staphylococcus aureus (strain MW2)
A8Z444 3.2e-35 138 28 11 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G998 3.2e-35 138 28 11 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Staphylococcus aureus (strain MSSA476)
A6QH15 3.2e-35 138 28 11 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Staphylococcus aureus (strain Newman)
Q05615 3.2e-35 138 28 11 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGX6 3.2e-35 138 28 11 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Staphylococcus aureus (strain USA300)
Q5HFV9 3.62e-35 138 28 11 430 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Staphylococcus aureus (strain COL)
Q2JSF1 4.07e-35 138 31 14 443 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Synechococcus sp. (strain JA-3-3Ab)
P63585 4.16e-35 137 28 11 429 1 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Staphylococcus aureus (strain N315)
P63584 4.16e-35 137 28 11 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X2G5 4.16e-35 137 28 11 429 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q89WF2 4.85e-35 138 29 13 427 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B8H6A8 4.9e-35 137 29 14 444 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A2H2 4.9e-35 137 29 14 444 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
C3N7H2 5.24e-35 137 27 13 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NG04 5.24e-35 137 27 13 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MRB5 5.24e-35 137 27 13 426 3 aroA 3-phosphoshikimate 1-carboxyvinyltransferase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01335
Feature type CDS
Gene aroA
Product 3-phosphoshikimate 1-carboxyvinyltransferase
Location 289751 - 291031 (strand: 1)
Length 1281 (nucleotides) / 426 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1227
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00275 EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0128 Amino acid transport and metabolism (E) E 5-enolpyruvylshikimate-3-phosphate synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MESLTLQPIARINGTINLPGSKSVSNRALLLAAQATGTTRLINLLDSDDIRHMLNALRELGIRFQLSDDKTECIVEGQGGPLSGFQGNELFLGNAGTAMRPLAAALCLGDNDIILTGEPRMKERPIGHLTDALRDGGAEITYLENENYPPLRIRGGFTGGKISVDGSVSSQFLTALLMAAPLAEQDTEISITGDLVSKPYIDITLAMMARFGITVINENYTCFRVTGQQQYHSPGDYLVEGDASSASYFLAAAAIKGGTVRVTGIGRDSLQGDTQFALVLEKMGAKITWGDTFIECTRDTLHGIDMDMNAIPDAAMTIATTALFAQGTTTIRNIYNWRVKETDRLSAMATELRKVGAEVVEGNDYIQVTPPAVLRHAEIETYNDHRIAMCFSLVALSDTPVTILDPGCTAKTFPGYFRELAMLAEQ

Flanking regions ( +/- flanking 50bp)

CCCGGGTCCGTTTTGTTCTTTTTTATTTACACCCCGGAGAATGACTTTATATGGAGTCCCTGACGTTACAACCCATCGCCCGCATTAACGGAACAATCAATCTGCCCGGCTCCAAAAGTGTCTCCAACCGGGCACTGCTGCTGGCGGCACAGGCAACAGGCACCACCCGCCTGATAAACCTGCTCGACAGTGATGACATCCGCCACATGCTCAATGCGCTGCGTGAGCTGGGGATCCGTTTTCAGCTCTCTGATGACAAAACCGAATGTATTGTCGAGGGACAAGGCGGACCACTCAGTGGTTTTCAGGGCAATGAGTTATTTCTGGGCAACGCCGGTACGGCTATGCGCCCGCTCGCAGCGGCGCTGTGTCTCGGTGATAATGACATTATTCTGACCGGCGAACCGCGCATGAAAGAGCGCCCGATCGGTCATCTGACAGATGCACTGCGCGATGGCGGAGCAGAAATAACCTATCTTGAAAATGAAAACTACCCGCCGCTTCGGATCCGCGGGGGATTTACCGGCGGAAAAATCAGTGTGGACGGCTCTGTCTCCAGTCAGTTTCTGACGGCATTGCTGATGGCGGCTCCGCTGGCTGAACAGGATACTGAAATCAGTATCACCGGTGATCTGGTCTCCAAACCTTATATTGATATCACGCTGGCAATGATGGCGCGTTTTGGTATCACGGTAATTAATGAAAATTACACCTGTTTTCGGGTCACAGGGCAGCAGCAATATCATTCACCGGGTGATTACCTGGTTGAAGGTGATGCATCCTCTGCCTCTTATTTCCTGGCGGCGGCGGCAATTAAAGGCGGAACAGTGCGGGTCACGGGTATCGGACGTGACAGTTTGCAGGGTGATACCCAATTTGCATTGGTGCTCGAAAAAATGGGCGCAAAAATCACATGGGGTGATACCTTTATAGAATGCACCCGCGACACACTGCATGGTATCGATATGGATATGAATGCCATTCCTGATGCGGCGATGACCATTGCCACCACGGCGCTGTTTGCACAGGGGACGACCACCATCCGCAATATTTATAACTGGCGCGTTAAAGAAACTGACCGCCTGAGTGCGATGGCAACTGAGCTGCGTAAGGTCGGGGCTGAGGTTGTTGAAGGGAATGACTATATTCAGGTCACGCCACCGGCTGTACTGCGTCACGCTGAAATTGAAACCTATAACGATCACCGCATCGCCATGTGTTTCTCCCTGGTGGCACTGTCAGATACACCGGTCACTATTTTGGATCCCGGCTGTACGGCAAAAACGTTTCCGGGCTATTTCCGTGAACTGGCAATGCTGGCGGAACAATAATTCTGACCGGAATAATGGTTATGGATACCGGCCTTAGCCCATATATATAC