Homologs in group_265

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07130 FBDBKF_07130 95.8 Morganella morganii S1 pflB formate C-acetyltransferase
EHELCC_03840 EHELCC_03840 95.8 Morganella morganii S2 pflB formate C-acetyltransferase
NLDBIP_03840 NLDBIP_03840 95.8 Morganella morganii S4 pflB formate C-acetyltransferase
LHKJJB_09670 LHKJJB_09670 95.8 Morganella morganii S3 pflB formate C-acetyltransferase
HKOGLL_09305 HKOGLL_09305 95.8 Morganella morganii S5 pflB formate C-acetyltransferase
PMI_RS03470 PMI_RS03470 85.9 Proteus mirabilis HI4320 pflB formate C-acetyltransferase
PMI_RS13385 PMI_RS13385 32.2 Proteus mirabilis HI4320 cutC choline trimethylamine-lyase

Distribution of the homologs in the orthogroup group_265

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_265

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P09373 0.0 1411 86 0 760 1 pflB Formate acetyltransferase 1 Escherichia coli (strain K12)
P43753 0.0 1337 81 2 770 3 pflB Formate acetyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P42632 0.0 1254 76 0 753 1 tdcE PFL-like enzyme TdcE Escherichia coli (strain K12)
Q7A1W9 0.0 1040 64 3 760 3 pflB Formate acetyltransferase Staphylococcus aureus (strain MW2)
Q6GCQ0 0.0 1040 64 3 760 3 pflB Formate acetyltransferase Staphylococcus aureus (strain MSSA476)
Q6GK90 0.0 1040 64 3 760 3 pflB Formate acetyltransferase Staphylococcus aureus (strain MRSA252)
Q7A7X6 0.0 1040 64 3 760 1 pflB Formate acetyltransferase Staphylococcus aureus (strain N315)
Q99WZ7 0.0 1040 64 3 760 3 pflB Formate acetyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJF4 0.0 1040 64 3 760 1 pflB Formate acetyltransferase Staphylococcus aureus (strain COL)
Q2YV53 0.0 1040 64 3 760 3 pflB Formate acetyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G1D8 0.0 1040 64 3 760 3 pflB Formate acetyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK44 0.0 1040 64 3 760 3 pflB Formate acetyltransferase Staphylococcus aureus (strain USA300)
Q8CTX6 0.0 1036 64 3 751 3 pflB Formate acetyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HKH9 0.0 1036 64 3 751 3 pflB Formate acetyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q46266 0.0 940 60 5 749 3 pfl Formate acetyltransferase Clostridium pasteurianum
Q59934 0.0 619 43 8 766 3 pfl Formate acetyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
O32797 0.0 596 42 11 773 3 pfl Formate acetyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
O32799 0.0 595 41 10 773 3 pfl Formate acetyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
P37836 2.27e-80 258 61 2 200 2 PFL Formate acetyltransferase (Fragment) Chlamydomonas reinhardtii
P75793 1.11e-38 157 24 19 617 3 ybiW Probable dehydratase YbiW Escherichia coli (strain K12)
P32674 4.7e-35 146 24 16 633 3 pflD Probable dehydratase PflD Escherichia coli (strain K12)
Q30W70 1.49e-27 123 23 18 553 1 cutC Choline trimethylamine-lyase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A6TCJ1 6.92e-27 109 79 0 64 3 grcA Autonomous glycyl radical cofactor Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XNF9 6.92e-27 109 79 0 64 3 grcA Autonomous glycyl radical cofactor Klebsiella pneumoniae (strain 342)
A0A031WDE4 1.14e-26 120 23 17 567 1 pflD Trans-4-hydroxy-L-proline dehydratase Clostridioides difficile
B2VED1 1.4e-26 108 81 0 61 3 grcA Autonomous glycyl radical cofactor Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q7VMC2 4.01e-26 107 80 0 61 3 grcA Autonomous glycyl radical cofactor Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B8F6C4 4.12e-26 107 80 0 61 3 grcA Autonomous glycyl radical cofactor Glaesserella parasuis serovar 5 (strain SH0165)
B0BTB3 4.96e-26 107 80 0 61 3 grcA Autonomous glycyl radical cofactor Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H0M3 4.96e-26 107 80 0 61 3 grcA Autonomous glycyl radical cofactor Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MZ79 4.96e-26 107 80 0 61 3 grcA Autonomous glycyl radical cofactor Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0UWA8 6.02e-26 106 80 0 61 3 grcA Autonomous glycyl radical cofactor Histophilus somni (strain 2336)
Q0I272 6.02e-26 106 80 0 61 3 grcA Autonomous glycyl radical cofactor Histophilus somni (strain 129Pt)
B4F057 8.54e-26 106 80 0 61 3 grcA Autonomous glycyl radical cofactor Proteus mirabilis (strain HI4320)
Q9CPH6 8.62e-26 106 80 0 61 3 grcA Autonomous glycyl radical cofactor Pasteurella multocida (strain Pm70)
C5BAK4 1.01e-25 106 80 0 61 3 grcA Autonomous glycyl radical cofactor Edwardsiella ictaluri (strain 93-146)
A5UBC1 1.15e-25 105 78 0 61 3 grcA Autonomous glycyl radical cofactor Haemophilus influenzae (strain PittEE)
Q4QPM7 1.15e-25 105 78 0 61 3 grcA Autonomous glycyl radical cofactor Haemophilus influenzae (strain 86-028NP)
A8GI38 1.37e-25 105 80 0 61 3 grcA Autonomous glycyl radical cofactor Serratia proteamaculans (strain 568)
A1JKI9 1.44e-25 105 80 0 61 3 grcA Autonomous glycyl radical cofactor Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JRB2 1.7e-25 105 78 0 61 3 grcA Autonomous glycyl radical cofactor Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667T8 1.7e-25 105 78 0 61 3 grcA Autonomous glycyl radical cofactor Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TKZ1 1.7e-25 105 78 0 61 3 grcA Autonomous glycyl radical cofactor Yersinia pestis (strain Pestoides F)
Q1CKF7 1.7e-25 105 78 0 61 3 grcA Autonomous glycyl radical cofactor Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3Y7 1.7e-25 105 78 0 61 3 grcA Autonomous glycyl radical cofactor Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD84 1.7e-25 105 78 0 61 3 grcA Autonomous glycyl radical cofactor Yersinia pestis
B2KA62 1.7e-25 105 78 0 61 3 grcA Autonomous glycyl radical cofactor Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C569 1.7e-25 105 78 0 61 3 grcA Autonomous glycyl radical cofactor Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFS5 1.7e-25 105 78 0 61 3 grcA Autonomous glycyl radical cofactor Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q65VN1 2.17e-25 105 78 0 61 3 grcA Autonomous glycyl radical cofactor Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q83K21 2.39e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Shigella flexneri
Q32CU0 2.46e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Shigella dysenteriae serotype 1 (strain Sd197)
Q3YYT6 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Shigella sonnei (strain Ss046)
Q31XQ5 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Shigella boydii serotype 4 (strain Sb227)
B2TYK2 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I5F4 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli (strain SE11)
P68066 2.53e-25 105 76 0 64 1 grcA Autonomous glycyl radical cofactor Escherichia coli (strain K12)
B1IVP8 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A391 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli O9:H4 (strain HS)
B1XBQ6 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli (strain K12 / DH10B)
C4ZYK2 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli (strain K12 / MC4100 / BW2952)
B7M8J4 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli O8 (strain IAI1)
B7MYL2 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli O81 (strain ED1a)
B5Z153 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli O157:H7 (strain EC4115 / EHEC)
P68067 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli O157:H7
B7LDH2 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli (strain 55989 / EAEC)
A7ZQ24 2.53e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli O139:H28 (strain E24377A / ETEC)
B7LUY6 2.63e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LP92 2.63e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli (strain SMS-3-5 / SECEC)
B7N6H0 2.63e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FF10 2.63e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEQ9 2.63e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AEA9 2.63e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli O1:K1 / APEC
B7NRN5 2.63e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MIR4 2.63e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UH18 2.63e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q0T1S7 2.66e-25 105 76 0 64 3 grcA Autonomous glycyl radical cofactor Shigella flexneri serotype 5b (strain 8401)
C6DC10 2.74e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8AD08 2.79e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P44455 3.1e-25 104 78 0 61 1 grcA Autonomous glycyl radical cofactor Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UFJ0 3.1e-25 104 78 0 61 3 grcA Autonomous glycyl radical cofactor Haemophilus influenzae (strain PittGG)
Q7CQ05 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XFE0 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella typhi
B4TS28 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella schwarzengrund (strain CVM19633)
B5BAR8 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella paratyphi A (strain AKU_12601)
C0PVZ1 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella paratyphi C (strain RKS4594)
A9N0W4 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PLH7 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T289 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella newport (strain SL254)
B4TE27 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella heidelberg (strain SL476)
B5RD61 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QTW0 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella enteritidis PT4 (strain P125109)
Q57L55 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella choleraesuis (strain SC-B67)
A9MGW0 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F227 3.26e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella agona (strain SL483)
B5FRD8 3.42e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Salmonella dublin (strain CT_02021853)
A7MH19 4.11e-25 104 76 0 64 3 grcA Autonomous glycyl radical cofactor Cronobacter sakazakii (strain ATCC BAA-894)
Q6LUP6 4.44e-25 104 76 0 63 3 grcA Autonomous glycyl radical cofactor Photobacterium profundum (strain SS9)
A4WDE8 5.45e-25 103 76 0 64 3 grcA Autonomous glycyl radical cofactor Enterobacter sp. (strain 638)
C3LQD3 5.66e-25 103 77 0 61 3 grcA Autonomous glycyl radical cofactor Vibrio cholerae serotype O1 (strain M66-2)
Q9KPK6 5.66e-25 103 77 0 61 3 grcA Autonomous glycyl radical cofactor Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5R7 5.66e-25 103 77 0 61 3 grcA Autonomous glycyl radical cofactor Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A6VLV5 5.94e-25 103 78 0 61 3 grcA Autonomous glycyl radical cofactor Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
P18953 6.36e-25 103 78 0 61 2 grcA Autonomous glycyl radical cofactor Serratia liquefaciens
Q7MNR2 7.65e-25 103 77 0 61 3 grcA Autonomous glycyl radical cofactor Vibrio vulnificus (strain YJ016)
Q8DEP5 7.65e-25 103 77 0 61 3 grcA Autonomous glycyl radical cofactor Vibrio vulnificus (strain CMCP6)
B6EKY5 1.54e-24 102 75 0 61 3 grcA Autonomous glycyl radical cofactor Aliivibrio salmonicida (strain LFI1238)
Q87SC7 1.57e-24 102 75 0 61 3 grcA Autonomous glycyl radical cofactor Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B5FAJ9 2.1e-24 102 75 0 61 3 grcA Autonomous glycyl radical cofactor Aliivibrio fischeri (strain MJ11)
Q5E2Y6 2.1e-24 102 75 0 61 3 grcA Autonomous glycyl radical cofactor Aliivibrio fischeri (strain ATCC 700601 / ES114)
E5Y7I4 2.37e-24 112 24 19 558 1 hpsG (2S)-3-sulfopropanediol sulfolyase Bilophila wadsworthia (strain 3_1_6)
B7VJ50 2.38e-24 102 75 0 61 3 grcA Autonomous glycyl radical cofactor Vibrio atlanticus (strain LGP32)
Q6D209 2.81e-24 102 75 0 64 3 grcA Autonomous glycyl radical cofactor Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7MS83 3.09e-24 101 75 0 61 3 grcA Autonomous glycyl radical cofactor Vibrio campbellii (strain ATCC BAA-1116)
A1SUE3 6.85e-24 100 76 0 60 3 grcA Autonomous glycyl radical cofactor Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
P13316 7.06e-24 100 75 0 61 3 grcA Autonomous glycyl radical cofactor Enterobacteria phage T4
B8J0R1 1.71e-23 110 23 18 555 1 islA Isethionate sulfite-lyase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q727N1 5.73e-21 102 23 15 548 1 iseG Isethionate sulfite-lyase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
E5Y378 7.77e-21 101 23 18 560 1 islA Isethionate sulfite-lyase Bilophila wadsworthia (strain 3_1_6)
Q312S2 8.32e-21 101 22 21 564 2 islA Isethionate sulfite-lyase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A0A318FL05 4.72e-20 99 22 17 562 1 hpfG (2S)-3-sulfopropanediol dehydratase Klebsiella oxytoca
A0A100YXA1 6.37e-19 95 24 23 598 1 AUL39_03420 Indoleacetate decarboxylase Tractidigestivibacter scatoligenes
C9YHW1 2.7e-18 93 22 27 676 3 hpdB 4-hydroxyphenylacetate decarboxylase glycyl radical subunit Clostridioides difficile (strain R20291)
C9XIS5 2.7e-18 93 22 27 676 3 hpdB 4-hydroxyphenylacetate decarboxylase glycyl radical subunit Clostridioides difficile (strain CD196)
Q18CP5 5.01e-18 92 22 27 676 3 hpdB 4-hydroxyphenylacetate decarboxylase glycyl radical subunit Clostridioides difficile (strain 630)
Q84F16 5.1e-18 92 22 27 676 1 hpdB 4-hydroxyphenylacetate decarboxylase glycyl radical subunit Clostridioides difficile
Q38HX4 1.27e-14 81 22 23 599 1 csdB 4-hydroxyphenylacetate decarboxylase glycyl radical subunit Clostridium scatologenes
O87943 2.14e-10 68 28 7 205 1 bssA Benzylsuccinate synthase alpha subunit Thauera aromatica

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01315
Feature type CDS
Gene pflB
Product formate C-acetyltransferase
Location 282838 - 285120 (strand: -1)
Length 2283 (nucleotides) / 760 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_265
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF01228 Glycine radical
PF02901 Pyruvate formate lyase-like

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1882 Energy production and conversion (C) C Pyruvate-formate lyase

Kegg Ortholog Annotation(s)

Protein Sequence

MSELNEKFASAWQGFNTGDWSQEVNVRDFIQKNYTPFEGDESFLAGATDATTALWTSVMEGIKIENSTHAPVDFDTDMPSTITSHDAGYINKDLEKVVGLQTEKPLKRAMLPFGGIRMIESSCHAYGRELNPQIETIFTDYRKTHNQGVFDVYTPDIVRCRKSGVLTGLPDAYGRGRIIGDYRRVALYGIDYLMKDKFAQFTSLQARLESGENLRDTIQLREEIAEQHRALGQMKKMAAKYGMDISVPAANAQEAAQWTYFGYLAAVKSQNGAAMSFGRVSTFLDVYIQRDLEQGKITEVEAQEIVDHLIMKLRMVRFLRTPEYDELFSGDPIWATESLAGMGTDGRTLVTKNSFRFLNTLYTMGPSPEPNMTILWSERLPLNFKRFAAKVSIDTSSVQYENDDLMRPDFDNDDYAIACCVSPMIVGKQMQFFGARANMAKTLLYAINGGVDEKLKIQVGPKHEPIHTDILDYEVVMARLDEFMDWLATNYVTALNCIHYMHDKYSYEAALMALHDRDVYRTMACGIAGLSVAADSLSAIKYAKVSPIIDESGLAVDFKIDGEYPQFGNNDSRVDDIACDIVERFMKKIQKHHMYRNAVPTQSILTITSNVVYGKKTGNTPDGRRAGAPFGPGANPMHGRDQKGAVASLTSVAKLPFAYAKDGISYTFSIVPNALGKDDDVRRTNLAGLMDGYFHHESSVEGGQHLNVNVMNREMLLEAMEDPEKYPQLTIRVSGYAVRFNSLTKEQQKDVITRTFTKSM

Flanking regions ( +/- flanking 50bp)

TGCTTATCACGACTGAATTTCTAAGTTCCATTGTTAAAAGGTAAAGTATCATGTCAGAATTAAATGAAAAATTCGCTTCAGCATGGCAAGGCTTTAATACAGGTGATTGGTCACAGGAAGTAAACGTCCGTGACTTCATCCAGAAAAACTACACCCCATTTGAAGGCGATGAGTCTTTCTTAGCTGGTGCTACAGACGCAACTACTGCTCTGTGGACGTCAGTTATGGAAGGCATCAAAATCGAAAACAGCACCCACGCTCCTGTCGATTTTGATACTGATATGCCGTCTACTATCACTTCCCACGATGCCGGTTATATCAACAAAGATTTAGAAAAAGTTGTTGGTCTGCAGACTGAGAAACCTCTGAAACGTGCGATGCTGCCGTTTGGTGGTATTCGTATGATCGAAAGTTCATGCCACGCCTATGGCCGTGAACTGAACCCGCAGATCGAAACAATCTTTACTGATTACCGTAAAACGCACAACCAGGGCGTGTTCGACGTTTATACTCCGGACATCGTTCGCTGCCGTAAATCAGGTGTTCTGACCGGTCTGCCTGATGCATACGGCCGTGGTCGTATCATTGGTGACTACCGTCGTGTTGCACTGTACGGTATCGACTACCTGATGAAAGACAAATTCGCACAGTTTACTTCTCTGCAAGCCAGATTAGAAAGCGGCGAAAACCTGCGTGATACCATTCAGCTGCGTGAAGAAATCGCTGAACAGCACCGTGCATTAGGCCAGATGAAAAAAATGGCTGCCAAATACGGTATGGATATTTCTGTTCCTGCTGCGAATGCGCAAGAAGCTGCACAGTGGACTTACTTCGGCTACCTGGCTGCTGTTAAGTCTCAGAACGGTGCTGCAATGTCCTTCGGTCGTGTTTCCACATTCCTGGATGTTTACATTCAGCGTGACCTGGAACAAGGCAAAATCACTGAAGTTGAAGCTCAGGAAATCGTTGACCACCTGATCATGAAACTGCGTATGGTCCGCTTCCTGCGTACCCCTGAATACGATGAACTGTTCTCAGGTGACCCAATCTGGGCAACTGAATCATTAGCAGGTATGGGCACCGATGGCCGTACTCTGGTAACGAAAAACAGCTTCCGTTTCCTGAATACCCTGTACACCATGGGTCCTTCACCAGAACCAAACATGACCATCCTGTGGTCAGAGCGTCTGCCGCTGAACTTCAAACGTTTCGCAGCGAAAGTGTCTATCGATACCTCTTCTGTACAGTATGAGAACGATGACCTGATGCGTCCTGACTTTGACAACGATGACTACGCTATCGCATGTTGCGTAAGCCCGATGATCGTTGGTAAACAAATGCAGTTCTTCGGCGCCCGTGCAAACATGGCTAAAACCCTGCTGTACGCGATAAATGGTGGTGTTGACGAAAAACTGAAAATCCAGGTTGGTCCTAAACACGAACCAATTCATACAGATATTCTGGATTATGAAGTTGTTATGGCGCGTCTGGACGAGTTCATGGACTGGCTGGCAACTAACTATGTCACCGCTCTGAACTGCATCCACTACATGCACGACAAATACAGCTACGAAGCAGCGCTGATGGCTCTGCATGACCGTGATGTATATCGTACAATGGCATGTGGTATCGCTGGTCTGTCTGTTGCAGCTGACTCACTGTCTGCTATCAAATATGCGAAAGTAAGCCCGATCATTGACGAAAGCGGCCTGGCTGTTGACTTCAAAATTGACGGTGAATATCCGCAGTTTGGTAACAATGATTCACGCGTTGATGACATCGCATGTGACATCGTTGAACGTTTCATGAAGAAAATTCAGAAACACCACATGTACCGTAACGCGGTTCCGACTCAGTCAATTCTGACTATCACATCTAACGTTGTGTATGGTAAGAAAACCGGTAACACCCCTGATGGTCGTCGCGCAGGCGCGCCATTCGGACCAGGTGCTAACCCTATGCACGGTCGTGACCAGAAAGGTGCTGTTGCCTCTCTGACTTCAGTTGCAAAACTGCCGTTTGCTTACGCGAAAGATGGTATCTCTTATACCTTCTCTATCGTACCAAACGCATTAGGTAAAGATGACGATGTTCGTCGTACTAACCTGGCCGGCCTGATGGATGGTTATTTCCACCACGAATCAAGCGTCGAAGGTGGTCAGCATCTGAACGTGAACGTAATGAACCGTGAAATGCTGTTAGAAGCCATGGAAGATCCTGAGAAATATCCTCAGCTGACCATCCGTGTATCCGGTTATGCAGTTCGTTTCAACTCACTGACCAAAGAACAGCAGAAAGACGTTATTACCCGTACATTCACAAAATCCATGTAATTTGTGCGGTAACCATTTGCTGTCTTATTAAAATAACATAAACTAAAAGG