Homologs in group_457

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10185 FBDBKF_10185 88.8 Morganella morganii S1 emrA multidrug efflux MFS transporter periplasmic adaptor subunit EmrA
EHELCC_04985 EHELCC_04985 88.8 Morganella morganii S2 emrA multidrug efflux MFS transporter periplasmic adaptor subunit EmrA
NLDBIP_04985 NLDBIP_04985 88.8 Morganella morganii S4 emrA multidrug efflux MFS transporter periplasmic adaptor subunit EmrA
LHKJJB_13645 LHKJJB_13645 88.8 Morganella morganii S3 emrA multidrug efflux MFS transporter periplasmic adaptor subunit EmrA
HKOGLL_12890 HKOGLL_12890 88.8 Morganella morganii S5 emrA multidrug efflux MFS transporter periplasmic adaptor subunit EmrA
PMI_RS01985 PMI_RS01985 70.6 Proteus mirabilis HI4320 emrA multidrug efflux MFS transporter periplasmic adaptor subunit EmrA

Distribution of the homologs in the orthogroup group_457

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_457

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P27303 6.14e-170 483 63 1 391 1 emrA Multidrug export protein EmrA Escherichia coli (strain K12)
P52599 7.06e-135 394 51 3 380 2 emrK Probable multidrug resistance protein EmrK Escherichia coli (strain K12)
P44928 1.67e-114 342 47 0 353 3 emrA Multidrug export protein EmrA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9RQ30 9.66e-93 286 44 3 349 1 farA Fatty acid resistance protein FarA Neisseria gonorrhoeae
P0DPR6 9.33e-44 158 30 8 349 2 emrA Colistin resistance protein EmrA Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q83P86 6.69e-24 104 28 9 314 3 mdtN Multidrug resistance protein MdtN Shigella flexneri
Q8FAX1 8.31e-24 104 29 9 314 3 mdtN Multidrug resistance protein MdtN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8X5R2 1.64e-23 103 28 9 314 3 mdtN Multidrug resistance protein MdtN Escherichia coli O157:H7
P32716 2.25e-23 103 28 9 314 2 mdtN Multidrug resistance protein MdtN Escherichia coli (strain K12)
P76185 4.35e-23 101 26 7 310 3 ydhJ Uncharacterized protein YdhJ Escherichia coli (strain K12)
A7MJB1 1.57e-16 83 26 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Cronobacter sakazakii (strain ATCC BAA-894)
A8A550 5.59e-15 78 26 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O9:H4 (strain HS)
B7M0V3 1.2e-14 77 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O8 (strain IAI1)
Q0T047 1.67e-14 77 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Shigella flexneri serotype 5b (strain 8401)
P46482 1.67e-14 77 25 9 317 2 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain K12)
B1XHL3 1.67e-14 77 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain K12 / DH10B)
C4ZSX9 1.67e-14 77 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain K12 / MC4100 / BW2952)
B7LHU9 1.67e-14 77 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain 55989 / EAEC)
A7ZSD5 1.67e-14 77 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83Q03 2.19e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Shigella flexneri
Q32B98 2.62e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Shigella dysenteriae serotype 1 (strain Sd197)
Q1R698 2.62e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain UTI89 / UPEC)
B1LGK7 2.62e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain SMS-3-5 / SECEC)
B6I1V9 2.62e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain SE11)
B1IQN8 2.62e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FD50 2.62e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCM4 2.62e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGD4 2.62e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O1:K1 / APEC
B7N0M6 2.62e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O81 (strain ED1a)
B7MC02 2.62e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJX3 2.62e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7NDL9 2.83e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A8AQD5 3.54e-14 76 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7NLF9 4.12e-14 75 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q3YX06 5.01e-14 75 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Shigella sonnei (strain Ss046)
B5YSW7 1.79e-13 73 26 10 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9E5 1.79e-13 73 26 10 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O157:H7
A7FDT5 2.03e-13 73 24 7 308 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q7CPM8 2.44e-13 73 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XF83 2.44e-13 73 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella typhi
B5BGR9 2.44e-13 73 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella paratyphi A (strain AKU_12601)
C0PZR0 2.44e-13 73 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella paratyphi C (strain RKS4594)
A9N863 2.44e-13 73 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJT8 2.44e-13 73 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T775 2.44e-13 73 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella newport (strain SL254)
B4TJT9 2.44e-13 73 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella heidelberg (strain SL476)
B5R1A8 2.44e-13 73 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella enteritidis PT4 (strain P125109)
B5FIU3 2.44e-13 73 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella dublin (strain CT_02021853)
Q57JA3 2.44e-13 73 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella choleraesuis (strain SC-B67)
B4TX73 4.69e-13 72 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella schwarzengrund (strain CVM19633)
B5F7M5 4.69e-13 72 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella agona (strain SL483)
B7LRL6 6.27e-13 72 24 7 318 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A1JRH9 6.32e-13 72 24 11 337 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GK45 9.01e-13 72 24 11 336 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Serratia proteamaculans (strain 568)
A9MNW9 1.12e-12 71 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
O31593 1.61e-12 69 34 1 109 3 yhbJ Putative efflux system component YhbJ Bacillus subtilis (strain 168)
B5REW3 2.44e-12 70 25 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella gallinarum (strain 287/91 / NCTC 13346)
B1JKI2 2.85e-12 70 23 6 308 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q665H1 3.05e-12 70 23 6 308 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pseudotuberculosis serotype I (strain IP32953)
A4THE9 3.05e-12 70 23 6 308 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis (strain Pestoides F)
Q1CDW6 3.05e-12 70 23 6 308 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R1V9 3.05e-12 70 23 6 308 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAU9 3.05e-12 70 23 6 308 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis
B2K437 3.05e-12 70 23 6 308 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C1L2 3.05e-12 70 23 6 308 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis bv. Antiqua (strain Antiqua)
B5XSP8 9.53e-12 68 23 9 321 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Klebsiella pneumoniae (strain 342)
Q6DAH5 5.16e-11 66 24 10 319 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9L9D4 8.56e-11 66 26 7 267 3 None UPF0194 membrane protein in asrC 5'region (Fragment) Acidithiobacillus ferridurans
B2VGW1 1.27e-10 65 22 6 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4WF55 1.57e-10 65 23 9 317 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Enterobacter sp. (strain 638)
C6DIM2 1.81e-09 62 23 7 288 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A1JSL8 6.42e-08 57 24 6 278 3 YE2891 UPF0194 membrane protein YE2891 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P0AFV0 1.01e-07 57 24 6 237 1 yibH Inner membrane protein YibH Escherichia coli (strain K12)
P0AFV1 1.01e-07 57 24 6 237 3 yibH Inner membrane protein YibH Escherichia coli O157:H7
B2K8W1 3.23e-07 55 25 4 232 3 YPTS_1292 UPF0194 membrane protein YPTS_1292 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q66D37 3.23e-07 55 25 4 232 3 YPTB1212 UPF0194 membrane protein YPTB1212 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q93AA7 4.31e-07 55 25 4 232 3 YP_0975 UPF0194 membrane protein YP_0975 Yersinia pestis
B1JSP3 4.31e-07 55 25 4 232 3 YPK_2900 UPF0194 membrane protein YPK_2900 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q1CFT7 4.31e-07 55 25 4 232 3 YPN_2816 UPF0194 membrane protein YPN_2816 Yersinia pestis bv. Antiqua (strain Nepal516)
A7FKJ7 4.31e-07 55 25 4 232 3 YpsIP31758_2812 UPF0194 membrane protein YpsIP31758_2812 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q1C912 4.31e-07 55 25 4 232 3 YPA_1093 UPF0194 membrane protein YPA_1093 Yersinia pestis bv. Antiqua (strain Antiqua)
A8AIZ1 1.42e-06 53 23 3 229 3 CKO_02332 UPF0194 membrane protein CKO_02332 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C9XVZ5 3.97e-05 49 25 6 232 3 mdtA Multidrug resistance protein MdtA Cronobacter turicensis (strain DSM 18703 / CCUG 55852 / LMG 23827 / z3032)
B7LV38 0.000144 47 27 8 253 3 mdtA Multidrug resistance protein MdtA Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7ME86 0.000184 47 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli O45:K1 (strain S88 / ExPEC)
B2TYA9 0.000207 47 25 6 252 3 mdtA Multidrug resistance protein MdtA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YUD2 0.000207 47 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7J5 0.000207 47 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli O157:H7
A7ZNP7 0.000209 47 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8CVX8 0.00021 47 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P76397 0.000216 47 25 6 252 2 mdtA Multidrug resistance protein MdtA Escherichia coli (strain K12)
A8A1U6 0.000216 47 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli O9:H4 (strain HS)
B1X7H0 0.000216 47 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli (strain K12 / DH10B)
C4ZSG2 0.000216 47 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli (strain K12 / MC4100 / BW2952)
B7UTB2 0.000216 47 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q0TG16 0.000222 46 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7M457 0.000224 46 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli O8 (strain IAI1)
B7MWY7 0.000228 46 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli O81 (strain ED1a)
Q83KI5 0.000376 45 25 6 252 3 mdtA Putative multidrug resistance protein MdtA Shigella flexneri
A4WCC0 0.000462 45 25 4 232 3 mdtA Multidrug resistance protein MdtA Enterobacter sp. (strain 638)
Q88F89 0.000503 45 27 3 165 1 pvdR Pyoverdine export membrane fusion protein PvdR Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B7NQB2 0.000611 45 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L9U7 0.000656 45 25 5 244 3 mdtA Multidrug resistance protein MdtA Escherichia coli (strain 55989 / EAEC)
B7NCB0 0.000685 45 25 6 252 3 mdtA Multidrug resistance protein MdtA Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS00155
Feature type CDS
Gene emrA
Product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA
Location 40719 - 41897 (strand: -1)
Length 1179 (nucleotides) / 392 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_457
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00529 Cation efflux system protein CusB domain 1
PF16576 Barrel-sandwich domain of CusB or HlyD membrane-fusion

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1566 Defense mechanisms (V) V Multidrug resistance efflux pump EmrA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03543 membrane fusion protein, multidrug efflux system - -

Protein Sequence

MSVSEETQATKPQVRNKKRQRRNTLMLLTLLFILLGAAYTAYWFTVLRHHESTDNAYITGNQVIVMSQVSGSVTTVSADNTDYVTAGSLLVQLDKRDAELALDKAQISLANSVRQTRQQMVNSRQLQAGIEVRRSELSRLQNDLKRREVLGAQNVIGKEELQHAREAVVSAKAQLDVATELFNANKAFILDTPLNEQPAVKQAATEVRNAWLALARTDIRSPVDGYVSRRSVQVGAQISPSTPLMAVVPAKGMWIDANFKETQLSAMRIGQPVKVITDFYGDDIVFHGTVTGLDMGTGSAFSLLPAQNASGNWIKVVQRLPVRISLDPAELEQYPLRIGLSGEVTVDTQNTQGPVLSQNVRTTPAYHTNALSIDMQPADQIIADIIKHNAGQ

Flanking regions ( +/- flanking 50bp)

AAATGCCATAAAAAACACCTTAAAATAAGAAATATATCCGGAGAAAACTGATGAGTGTCAGTGAGGAAACTCAGGCTACAAAACCCCAGGTCCGTAACAAAAAACGACAACGCCGTAATACCCTGATGTTACTGACGTTACTCTTCATCCTGCTTGGTGCGGCGTATACCGCATATTGGTTTACCGTACTCCGTCACCACGAATCTACGGATAATGCGTATATCACCGGTAATCAGGTGATTGTTATGTCACAGGTTTCCGGCAGTGTCACCACCGTGAGTGCTGATAATACAGACTATGTTACCGCAGGCTCGCTGCTGGTTCAGCTCGATAAGCGGGATGCAGAACTGGCACTGGATAAAGCACAGATTAGCCTGGCAAACAGTGTCCGCCAGACCCGCCAGCAGATGGTTAACAGCCGCCAGTTGCAGGCCGGGATTGAAGTGCGTCGCTCAGAACTCTCCCGTTTACAAAACGATCTGAAGCGCCGTGAAGTCCTCGGGGCGCAGAATGTGATCGGCAAAGAAGAGCTGCAACATGCCCGTGAAGCCGTCGTCAGCGCCAAAGCGCAGCTGGATGTCGCCACTGAACTGTTTAATGCTAACAAAGCATTTATTCTGGATACACCGCTGAATGAACAACCGGCTGTAAAACAGGCTGCCACAGAAGTACGCAATGCCTGGCTGGCACTGGCGCGAACCGATATCCGCAGCCCGGTCGATGGCTATGTTTCCCGGCGCAGTGTGCAGGTCGGTGCGCAAATCAGCCCGTCCACCCCGCTGATGGCCGTCGTCCCGGCAAAAGGAATGTGGATTGATGCCAATTTCAAAGAAACACAACTCAGCGCCATGCGTATCGGACAACCCGTTAAGGTAATAACCGACTTCTACGGTGATGACATTGTCTTTCACGGCACAGTCACCGGACTGGACATGGGAACCGGCAGCGCCTTTTCACTGCTCCCCGCACAAAATGCCAGCGGTAACTGGATAAAAGTGGTTCAGCGCCTGCCTGTCCGTATTTCACTGGACCCGGCAGAACTGGAGCAATACCCGCTGCGTATCGGACTTTCCGGTGAGGTGACTGTCGACACACAAAATACGCAAGGCCCGGTGCTGTCACAAAATGTACGTACAACACCGGCATATCATACCAATGCACTGAGCATTGATATGCAGCCTGCGGATCAGATAATCGCTGACATTATTAAACACAATGCCGGTCAGTAAGGAGTCAGGGCTATGCAAGCGCCACTGAGCGGAGCAAGACTGGCCTGGAT