Homologs in group_2211

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16910 FBDBKF_16910 90.6 Morganella morganii S1 rfaH transcription/translation regulatory transformer protein RfaH
NLDBIP_16890 NLDBIP_16890 90.6 Morganella morganii S4 rfaH transcription/translation regulatory transformer protein RfaH
LHKJJB_16580 LHKJJB_16580 90.6 Morganella morganii S3 rfaH transcription/translation regulatory transformer protein RfaH
HKOGLL_17545 HKOGLL_17545 90.6 Morganella morganii S5 rfaH transcription/translation regulatory transformer protein RfaH
F4V73_RS18380 F4V73_RS18380 84.7 Morganella psychrotolerans rfaH transcription/translation regulatory transformer protein RfaH
PMI_RS17605 PMI_RS17605 69.4 Proteus mirabilis HI4320 rfaH transcription/translation regulatory transformer protein RfaH

Distribution of the homologs in the orthogroup group_2211

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2211

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AFW0 1.98e-38 128 73 0 75 1 rfaH Transcription antitermination protein RfaH Escherichia coli (strain K12)
P0AFW1 1.98e-38 128 73 0 75 3 rfaH Transcription antitermination protein RfaH Escherichia coli O157:H7
Q8FBI4 2.18e-38 128 73 0 75 1 rfaH Transcription antitermination protein RfaH Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAL4 2.18e-38 128 73 0 75 1 rfaH Transcription antitermination protein RfaH Escherichia coli O6:K15:H31 (strain 536 / UPEC)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_19520
Feature type CDS
Gene -
Product hypothetical protein
Location 92 - 349 (strand: -1)
Length 258 (nucleotides) / 85 (amino acids)

Contig

Accession ZDB_247
Length 11457 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2211
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02357 Transcription termination factor nusG

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0250 Transcription (K) K Transcription termination/antitermination protein NusG

Protein Sequence

MKDWYLLYCKRGQLPRAMEHLQRQQVECLTPMANIEKVVRGKRVTVNEPLFPNYLFISFDPETIHTTTINSTRGAERSPHNFPKA

Flanking regions ( +/- flanking 50bp)

TTTGTTATTATCAGGCTTTATATAAGCCCCCGTTTGTGTTGGATAGCGTAATGAAGGATTGGTATTTATTGTACTGCAAACGCGGACAACTTCCGCGGGCAATGGAACATTTGCAGCGGCAGCAGGTGGAATGCCTGACACCGATGGCGAATATTGAAAAAGTGGTTCGCGGCAAACGTGTGACGGTCAATGAGCCCCTGTTCCCGAATTACCTGTTTATTTCTTTTGATCCCGAGACTATTCATACAACCACGATTAACTCAACGCGCGGCGCTGAGAGATCCCCTCATAATTTCCCCAAAGCGTAACCATGTGTGAATAAATTTTGAGCTAGTAGGGTTGCAGCCACGAGTAAGTC